.01)П)П/+I,H`,H@ xF@ @#?0G@! 0 "I+"H"I &!I"J"L("I"J#L#"J#IS"J"I"J#L"J#IS"J !!KF!KGGFF)"9pG;pG ~@t@QtQii#2O@-#%" @        000)@-/@000)@i/@ m(0L #E!HY `k !J#;(H!` ( 1 G !J#  (T<t< O-(Ih(N5h-I h";PB `Bы IKh";PBK`BHJCG 4Ap@Nuhlx(x"H#BH" H`x?" @x"@H C HHhy@ B@Y H K K K HpBBAAABhJ J Hjr`J HIHK I BlhBlx(x"H#BJ  `x?" @x"@H CHHhy@ B@Y H H$ K K KBBA`AABHJJJh0`K I  /(bBdBJz1r ! B{3s@r;+ S{3Ss@s;+ِ{0QssHJCG@I L! ((I HC GKI CKI C JC# BGIHHJCpGHJCpGHJCpGHJCpGHJCpGHJCpGHJCpGHJCpGHJCpGHJCpG@HJCpG HJCpG6I"6H6L&6J6H7I7M&`$``6J `6H,`6I6M``6J `6H,`6I6M`` `,`5I%4J`4H5I#pp p3Hp3M"3I4H,pUB ``2H` /*.I"v) " rv uu )I*H `` %+]/"I ` G<P(,3$+,` /+3WFNFEFHIKJ HM9FFF P MBFtjrrHh4)> KM H+5+5(+5+5(+ 5+5(+M)h)L ` x AB"!`*`8FFFG "(+L# hYBB(L"h*FЮyRFtxJFp !I"L"O#N` $(%ЩyRFtKFxxBrCFkq+q   Jh(if  I hB3h+crcq#q x:pRF|q4GWFNFEF I hXO).=H%`({JK$FF=F&( JFPSFBF>P54.8 I `8FFFG#>p@0 K H J0000M 00(h(L ` x  AB"!`*`0G 6(L# hYBBH!`H9`pGKHKIi( GHJHOxHNII0``(B2EH70h$B CM#(g1h4P5B>H%>H(![8L%6N%`% 9H!`H2h$BR5Ix (?/` (4"x*1H p,h,%M(h,Lx0!p`(h)Jj`j(J`(Jj`'JCj`'Jk`Ck&J`k%J`k%J`l$J`Cl$J`l#J`l#I ` 0h4B](P!aCK I,` I< <&<<,3<ldh*O*N, G(G"^(+"J5BaFEЮF2rEFEёx pTaLH"ht*L"h* ( x 0UIh J( a Hqh*!9ua|FE#;L(-X=4")!B)HIcCH("^) #XBtG@ IJH Ih(Hx* HtpBMOLN("QBBG.I<JB,A0ML ((!HB!JBB0GH(HIB,  AMONL;(:tX=4") !B)J`*hHt(GJL:I&"B>Ih)AJh(Hx) HpB!HBG0"QBBЂTKIJH BKI 0GHz+ؚIX `CJDBn*B HKI I" BL( 4")!B)HIcCHGX=t IJH Ih(Hx* HtpBy ((!HBG  FJ$](4,](р"QBV E(BLHIbL! H  H H I\$ IhX)J]d= BpBCBd( 4,H! ]G H I LJ Hb" H  H8C=pB B=H#hZH GKh ʋB0( Gd# B G *IB *JBI#KvH H Kh!ʃB 1)"HBvH  BpB BCd#I BB MFB$ Fʊ3@+C˂b bbvwHwHvv81aEH% I!K`!H`!H!` I$# p KxYp !JrI `{pXqqtx+++ I#p T GJ++ъzKH$ `chJ=ah GK!H`#`H GWFFFHhJYhnF4r0FF  Mx1pr/h.`, (hBFSF/``FFGI`zOSZhI `+x3 `*N< %iC1pX $#h+x3#`*O8hGLUL h0"h !`G!N!O$%3hx33`*! !QC1xX ,Ih"( `I h$*-TG-% "* **#,#33`-%3xKpIhx0`* N % * *iC1hr\`!h x1!`*pG hx[2 `xKpIhx0`* N % * *iC1hr\`!h x1!`* L h 0!h"`pG hx[2 `xKpI#J pI I I I I pI pI pI pI# p(%#O! HD@\4 8< lHKI`H`HIh `Hx2 `p"3BN%#x)@1X "x2"BpG`%P=-H!=(Q+H!7(>(Kh(Hx2`#p B0 O N%"x @(/ 9x(@ )ٟ!"x @(#0x@*٧"HpHpHh x#1`"pBG#0x@ 9x(@  8P WFNFEFം;H @(9Kh9Hx2`"p Bټ5Ix hF0!(ѹhF0!(ѩ(LkF%3x$,@y%H'N0/ڏ"Qh !w^9B2 S3FkFJ3xFdF'<,qۧ! aF$_9B ObF<! ;3DFcFk MJ( IC_`F$J" @\P@4>*0 " @*1411DEIF12 7REb! +@j+и%j@ @+!@)I pI2 p"cA;@*LaF J2l88FFFG H_FVFMFDF-KFx#FF+K,Mx(xBK*L#xBDW/="#x,x.1#FB(4c%FDESF[FDECF[FHDJ[FppD<,xFFFFG<c%F%kBFvB&rBB 8'Hh'K xlFp14#"p`B7#+2!xMO)ppjM,x,CpLpM xpJ(ppNxF3poLpFF^F2x*iM)x'xCcLFaH[Mx&x)xCFeHZ#x8@BVKh*aNK*xxBYXHNFXL2x&xFECSFhTFQ!`GHxp!`CNx0p!`DHxp!`x\F&pPVF0`xGHp1` x:IF p2`4xAHpHFxtYF pxFFFFG,Kh)QBp%L&N x0J0pxZFT,p*LHFx#xB,JxFE+I xFEٌL!xEZ *pBӆQ)ppIOFNIBFx:xC@= p4uE5 x3x x@B.=-,THD<L$0X8(I#J pI I I I I pI pI pI pI# p(! H#` ID@\4 8<H`G` I K phBX H2` H!`G(JIp hXH1`  H!` I H hBPp`G(` Hx#Cp L x"@ Hhx3 C"p`Jx3p`GD<PHx!@pHx#CpHhJx3p`pGD<P0 L!h Mx(x#@C*p Hx"1C!`pH x1p!`0G<DPHx!@pHx#CpHhJx3p`pGD<PHhJx3`Jx3p`pG\PH!(H!( L H!( !(G 8  H!i( H!c( (+(G 8 H!I( H!C( ((G 8 L H!(( !"(GJ xxL 8 ! ( !G 0 H h K x1p#"p`B 0G xB%p PpJIx xB N2x&VC xNBMNP x2xC*x8@ p1(HppGx pp% 8<DpIJ xxB x&qCKxNBNMP x2xC*x8@ p1(HppGxpp%8D< Hx!HCJxKBKxxCKx@ppG8D<GF(d%J- 7GC2jC!L9`X J7YJ('hJ- 1ACJKUXx"' FFrFQw) bFhzR Lx#Y92)8x7(ڠ'x! OCBJhJ ?py w!93)0x7BFG J ( "4TCx%7oCM)YKzWh"2FX('H'F %FrFQY) cFh{[ L9;)8x7(J( 'BI ?pJ hy w!93)0x7Bۢ &I%K_BB%K_B8%K_B.%K_B$1Ox!#KCBCHhBSF9)M+@90)4`DBG%K_B%K_B%K_B%K_Bݷhp_FVFMFDFFFFF+>FcFWFNF+/#F4x65xpF61x @6tF2x,@uF @qF@#CCC;(+C#C7 C8 C C7(C!8HBDcF67+ D8D"CFD+xFFFFGGF  CF/?.=!H!B^F#^#^dFvtE.@F#^FEE(ܕBGEGFB vEvFzx'#{C2QjC HhB{Z +eF;0+4BFGhp.I/G!HF#^sF%@_%[_ F?aE7uF#^FtE1ܔBvEvFBgEgF2x& sC2UbC HhBrV**L:#C0*1BhpG0!=HBB $ !4,"=PBB0G IB x C p1BG !"#}G7GIh( !"#G(0J%S_B%S_B%S_B%S_Bx#KCBK I h"@*x#C0G #@ Chp0J%S_B%S_B%S_B%S_Bx#KCBK I h"@* H@"C0G H@ Chp0J%S_B%S_B%S_B%S_Bx#KCBK I h"@* H@"C0G H@"hpJ$_B$_B$_B$_Bx#KCBK I h"@* KCGhpKJ$_B$_B$_B$_Bx#KCBK I h"@* H@JCGphp H@JpJ$_B$_B$_B$_Bx#KCBK I h"@* H@G Hhp  (ا)ؠ"JCHDTG  Jh$(  Cx!92)<,Gp 9   <-8ۛ,6,7ۤ-ݤ%!KCx"3^FKCbFbCXHJhP I:# @;@CC BbF[,2* :0*p<,G$ -:*8-? O9h)7!# 'F(+,+ۜB&ܘBN+ݟ# !MCKC)31XsX!HC)qX@IdD@x!aCtY  L$hI23 G$!#'%?pCH h H 2+Gpx'zCQKI h(ݠ ,ݠ$u{B^ **L :#C 1*8(pG x'"zCPCHh,ݠ$)ݠ!vB_ 1)M+@90)<,Gp x"FrFbC(FCHh,ݠ$)ݠ!rF.bF.CCB[F 9)+@3C90)<`D,Gpp^FUFLFpFF@F#CDFFPFIF+ X<=!FPFIF !0AF"+  DYF6<="0AF"+ ! 6D<=w AF0"+ xFFFFpG 9x!F"JCCHh,ݠ$-ݠ%bFF I:# @;@CC BbFQ,2* :0*p<@,GF0Ih(&M!(xILxy I (x"#  f(J LI  Hx# "0GJFFFF( G@B#L@ Ab\C`TG#L@"A`\C`TG#L@ Ab\P@`TGK\#@ A@)!G#!ZH G! "H G!2"H G!"H GGF L'B JNFQ!@Q)-I84B/L 4!Ht GH IÊ@FG PG%`FH@'%(#`~( @(a +3cw*  `w-{B )"|1 !HB|I XIx(Ѐ#BH@E) ( 4(!|)|X(GWFFF 3OxB ҁ!JBFQ @Q( -J87BFFGy~);}+a+X+Q$Ih(; @ F+|)"^#^!.1|H~XKCKXHC* )B K JCAFtB I@FqRF@SF@%FF8+88#WFFF! L H#CqpqBQ" @Q*J84BFFG%b~(ل#^F"^ J%~ @ev&EFF*e*)Zۢz( If&#^z @BB1P& ^(VFAFa &. "x( I qNq }(K@Ⴀ Jp () J& @(JxB3&f&| I~XACKiXECxa 0`vaFF銀"@( GL"BN0@A(J84B+x xB"^z'_BۣzB!h^"^B B#^'_BۈB +^!`^BA%!F^%uC!C^j5IexŠ#@$+\B}*#&F;wB$&F+xbF@5*G0*<@*: *69))x*"@ G @( %!!@)  , (!!@)Š#Š#Y@)!JB@4CŠ3@+sF@#ZB@K]BuQJ#^x&%'B @(я#^*ڇz(݂"^z"RBBy(v#@+k#+ (]a*V۠z)Rz#^"PBBJۧ)H @(?#+ (/. ѡ=1-7a&=.. Р=8-7a&=c=;c- &.c=3c-&= (G HxB# (ћKxBݎ#Jl_FVFMFDFz!|^QbF?JFQFz#^F<F04#^&xFKF"^YFX1(BF1(!B`/HY)O=25(x(5#@(/ p"@0tRF#^!S^IF[F X \~4B+pxFFFFG$ H @(p~B*x( +и~B)p (pt"*pt9u911xG0 j (IР|B!x *bjiPet0bj SbxrYx"^rzB* K JCP`"^z"CPBBKCJKxB"@*0GH!x %Jh)5Їj}xA{Es{4B$**,<,<,B4B)01x!"PB@tv_FVFMFDF𴃰B}jF!@Fx@F @|xF$ #@9xF, $#@{BЃF #^DF$cC "^:J;KZFF7*bTCFF+;x)Y F&@7E ZF*Ф@F(x(xFFFFG* c q"x @/(#!"LE%1 x*@IE/*bE#XB"QBBrFC p XF(<>.ѻ4`EcF CB$!KBD7DTFg_FVFMFDF !83 /:N ,2hF#FXF F4M(ѧXCF0(bsx{0)tBӘ(U*N2j<*щ3|B1x :73|B{1jbs0L4j+ rbxu| tB ptq|0 0jJxrs]F xIKFXFJF%4sp2uu0SFTF+@tu+BM(bL  `R0E!H;)H50IH hB@FkFpxpXFpHFqPFPq0Wp`xFFFFG|1x p!e AF2hQFF&GFi} F @(p(mn}!1@)FG!h^3IF#D(8 \]BЩjOxGEGF`F DC *^(Hx!x#"3@ @C8#p4(n}/!n^$tC +^jH 1xN!xF'i} ItB(x( 73!2#(pB0GJqO :hX(бX1!bsx{ tB  G! :h0(j ((+|B)x "+|B*jaPs0*j ibxi|tB hti|(0G<)x 08 !AC H , !j*7!@)0G IC(Vjx,sAxj,Lis HCH!`F.(H@ !pp8 DCH%) `$!@)!N0 C,H AB@, I H1 H(~pG`FF!e^ hC !c^ Hfi#^"90 ! =7v-G!e^ hC !c^ Hfi#^"18 ! =7v-GÊQ @!Q(G!ÊQ @!A(G!H0H-G`IHgIHa GF`FH(H%G`GFhF+- !h^$`C !j^H"^ni*18 ) <7v,-h-AF h- hi( q,h(!"% .- BFP``FG_FVFMFDF"F(L FF"S`FB& (!OQ!@5O)3`}xQ 6DJ84BBF*DF" BEM)ɃBF2BEKF hP J09BACx092*`aJh!_x2x78'?mF09B ACx21x63>09BACx092*`NJhq!6x2x78'?mF09B ACx21x63>09BACx092*`:JhXXx2x79'?mF08B !HCx20x63>08BHCx082(!HC*`'J!2% p94x2x0 mF09B ACx21x63&609BACx092*`KJX) u $` +sld7_FVFMFDFPJhPO(ܗOKOL ` `1x)r""`2x +kУF F62x+ + + +CF, -l:I%hB)zx -` #;p7ZFh5`2JhB2K2JFF*hKF`AF8@)h #;pRFh0`*hdD7B%,8AF"*?!I hhB 3x+' +% +# +! `2x )):p61x 7 +"H:pxFFFFGZFh0`2x B prx )< `d3 /3 3_FVFMFDFgM+xgMhLhNF+x"FF"x3xeIFcIh(1'/p ,^Ih(]M]J.hhB ZL ZJ `hFF-WN2h*PI h( "PBbF1``")QCNHHI hQC 11h2dFB#h4ĀrFl1`1`BN$0_"^$3_$2_O&;L2N h4J0ph.*6H-Jhp;x+ +*M+x!x#8xYC#"x2"p"7Bю;x+ +L"x>27"p.H$J`CFLpIFjF!pHIy\Fp p e(2 <I#XB`I`I`H#`PFxFFFFG`\ +P 333+ /+/JS}+1 BJ!Qu+|F p)x1)pjIh($isF`Jh#XLB"`$ cC H;;CfCQ63À3 3+/0L"x)L!h)!M*x#YCKx#@ "U*x2*p"B0G"*pHx1p I x-, < \`,WFFFF F#FF- x ( x1:SF=46- "x *=FF7-4 x(FFG=7-4!x)I !G +0#  )  I H ``"H`(0G!+ /3) Jh)GJx) 8,p L"x)M)h)M*x#YC"3*x2*p"BpG"*pHx1pI x,, < \,0"hx2x1 ! 08B !HCx2(x5+%-08BHCx082"`0G0 (,3 3(6 6,6_FVFMFDF4L#x4L5J!x5NFFx1xF7 !i p.Hh-+-K7F&,|*hx2*` pxapQ)`PxpH(`JxA)`pBxH"q(`Jx>1bq)`4.L&h5x6&`]H2!x$p9fB20BI#hIL0`BҘF{ 84DE-JxKKLI`IIKNk3`&B ]6B/і@M>x98mT(4,`\X  /+ 333/%`,y(xixxxly>5t. I# `; I ` FG"h(!x$p9eB20BL h0 `IH(o%h I5%` h#q@@HJ!1"/#HD HKFX"(!1"X# H8FFFpGq<n>pH(\v0L!hh 0X@%&x**Lx+8+%+(h(%Ih 0?} pG# + +(h"!$)hh*hh+# + +(h" !## + +(h"!#Ih 00<p<GFh,!x 7F)$5aBp ,@ @򊰊20@ @!9;4u4u9  5I @C{ZkFZ#==BFx!+*+JXFd6<Vt2@ @(D jF4e5:9e2 @(b 2b%b_*!! ^*#^%{_B݈ ^%{_BȀ2 2FGHHM%L @( jF4e5:9 jF4`0=9`ေ3%jF0e59:e jF0a1:=a倒3%@-ь jF4`09:`}2$@, аj([%EC J2!@)紊40簂GFF,~! @(x`h(xhh-oBm+m*- kh+МFbF*ShF+.ZЮBX#'(!"k+#1hBC"h*ahQ`bh* h`CF+e`'`,`h`!(Y! U# !"D FGBЬBu`kh.`o`c`+` t`ch&`+`,`#he`+_`'`7`u`.`o`h` &"h*Ђ0, Уh +h) СB % +@+*Ih)СB( (РB"QBL0G ,ah)% +@+Ih)( M" +^& .^+Y((7jl*4k,1(l(.'H;@_l+A@!B bh* KBch+,ldBݬd!(;  !(#GBھ!kB Bh* KBCh+Ѩd!KBplhx&#^"$3_S+r2;F*;(9k*62l*3$cBBQDh,,hxBdh,%hxB,гl+;'O:@,1"#O:@tdBݴd!0(;! 0 !#GbFBڽ!kB Bh* KBCh+Ѱd#ZB#ZBh,hxB$h,hxBҬ3 (J,H Id`a J ;#BÌ0",2 p!x! ((ؠh(0Í @(&KChh*)L`!`!a` #YB  !Gh`#XB@Hh`<_FVFMFDF𴆰"^F!C^F!C^"^F(Ѓh+ h+!!@)A[h+!IF12SFDF4QF9 2SFP @(AF1? B IF"4FFFDFE YF"4B\FE!"4BB )"4B\FE!8"4B@ @(i#2F[D=~FFDFE IF"4BLFE!@F"4TEDFE QFw"4BLFE!0w"4TE"!LBD>DDDFE IF"4BLFE!@F"4TEDFE QF"4BLFEI!0"4wTE !@)/ DD>,&Б#LF 4@FIF2#`@FIFj01# CBD"@F!2SFLxFFFFG# #BBDDD>!@FIF!@FIF*"B"_FVFMFDF𴆰!F@F(*L!N@. RFKF1:;%<WE "4TELE!8"4LE<WE IF"4TELE!PF"4LE"3SB7SDFFMFfF=DFE "4BB!8"4B<B )"4BB!0"4BzF\FE "4B3FDFE!8"4{B\FE IF"4pBDFE!PF"4eB_F<B AF"4YBDFE!XF"4NB\FE )"4CBDFE!0"48B_FBF>72=FF<WE 1"4$TELE!81"4LE<WE IF"4TELE!PF"4LExFFFFGp$@(UF=LF(RFKF<>!RFKF88!2JBRDKF;Fx0#*FzVFF>F\FE "4B3F=DFE!8"4B\FE IF"4BDFE!PF"4BBxFx_FF<B AFRF4BDFE!XFRF4yB\FE )JF4nBDFE!0JF4cBBF2>_F=7FF&yx<WE *4LTELE!8*4ALE<TE IF246TELE.!PF24*LE% CBKD6F5FEVF>4TE )x"4TE5EEJF:FB#ܾ4VE )x"4TE5EE$cBSDFF4FE )x"4\EUFLF=< Mp_FVFMFDF #^F"^"^"^(Ѓh+ h*!!@)ёRh*#+чHHKxxF#SDF>FLFE 9BF4B7=<B!PFBF4BLFE ZF4B<B!ZF4vBxFyFFdFE 9BF4dB<B!HFBF4YBLFE )ZF4NB<B!0ZF4CB"JDF>=79PF2+3xFFFFGMv#Bm#kpp_FVFMFDF"^F!C^F#^"^F(Ѓh+ h*!!@)іRh*#+ьKH!xQDF>_xLFE AF:4B!D=DFE!PF:4BLFE 4BDFE!4ByFxdFE AF:4BDFE!HF:4BLFE )4BDFE!04BZFl) >"#KDDF= :AFPF+oxFFFFGJq#ZEh#fpp𵃰&N;4éh3 1!h^$*_#^$+_2389$:(!Z+ 32iB:Aj #) @(Щh3 1:#^!l^!AC`$)_09JGhpGFFDIh(." @* FG2 @+4h,@/"PB@3LoF#:³h" 30,0x-I X!0N1 1(I0j"!#D(tk,0!"#9I$@,еh-Ќj(!"#)(lk,(!"#h-Ih, !dh,JAF"@) ;hlnn_FVFMFDF𴄰F%(Ѓh+ h+" @*[h+#+%@F @("CBF!P^#^$_DF&_`M,AACF 3FF4@%%@-ѥj"QC4F FCF&@k.ђ)xYD1AF$ ^ &_22&Sr"@F*-&"^"&_hxCFލ '27@Q/Q'+xDSDNFmh(TFE +x+ 145LE?6/@F@&&@.ZFVDFF&$1_" 3^7.AF ^Fm"F^"CE)"h_FVFMFDF/ лh+ h*8!@)iRh*#+a4I"^F ;^jF"^#^(Q;$@,/HxxFFTFE IFBF49BLFE!PFBF4.BTFB )ZF4#BLFB!0ZF4BLmF*#;" 3 j!#k xFFFFG I#B#php_FVFMFDF#Z:@*l+ѵ\H@#ZBBюkl+UI @#ZBBс&#^"$(_2S+ړ;F8HDFEڈFEڸF/ڂ+E;F:B7@JF. 6$ ,^ !h^l"F)*:JE !KBD" )^&$._RFs !:$w kB Jh* D"BNh2. d&,GEhlB&h 1#!dhKB6D,GEl*(LF9QlKZF xFFFFG"1RF -h 1#'z3i!JBIh_FVFMFDF !s^$ 4^0"$1_&"^C3 FF.гh+ h*0!@)Rh*#+!F:#^8$0_1Bq< 2^ Bۡేp1 Bj4%%@-ч0p!: 4^8!p^#3<$2_F@F(s-o1 '@/h@F~8v?IFI(ۢF(o@FkQF8b (2J90 03 @((}QF((vHF! [FN!J xFFFFG(^QF( WIF !/XF% !p^p%"^#^$3_#< Ah",2x+~++KC A@) G !  ))+/+ JC  )") )<#^:%c_BJ <#^8%c_BJ A@) !)мKC )) )з !B))Ъ !" QB# YB) KC )ه KXFH,,d$:#^)Рj"BT9)#<%c_BYjB\* a !`#  !"OY" #@+0#CTjP"Bp #!:#^# !@) Сj \5*%-B0" Tj"Jpj0(<"^BX \*#+ :#^# !@) Сj \5*%-B0" Tj"Jpj8(<"^BX \*`!  " #@+0# Tj"Jp # j:"^] 2"WB'9@-O$"8\B:*$!# @(#"PBB1'#:#^j] 2"WB'9@O$"8\B):*$!# @(#"PBBї9B$!z\ U!#  !" $)#pWFFF#@+D#]B@ ) 5 -9 FRF IF l(AF:(lk,(!BF;ID Z @(еh-SF l(1:#(lk,(!2;h-I FFGnGF*,2x+`+Ѐ"P@( FG(!*J  "RBC-?jl*TFE ):4B5F=DFE!HF:4BTFB ZF4BDFB!ZF4BxFFFFGp0"+ pG0- h, dh,IC0G0-h, dh,"PB@!(0G G(G&!g^"!b^C+; m(2k-,#l+X`#l%!`A`` d`dl i"PBBBY Fd 0 ! 4*G!#lc!HB3*(#h*AhQ`Bh*h`kB"lB $! K !  Gh!dAhc  !kB Bh* KBCh+G) H@G!HB"QBG!G0 !kB Bh* KBCh+hd!(0G(@l(hGHnpk( N1@Dh) ((!"80^pG:"^j]1" QB"@KF$"aF\B,:*$ # !@)!#"QBBB$ bF\ U!K#  !": 9G$(#pp:"^(-5Сj" T-0Сj(*<"^BX \*`! -#  !" pG" #@+0# Tj"Jp # # !@)Сj \2"B0# TjJpIh(Hh+h( Bh*(Dh",, !$h,G$;<#YB@Ih(Hh+h( Bh*(Dh",, !$h,G$;<#YB@Ih(Hh+h( Bh*(Dh",, !d$h,G$;<WFFFxFVxSDFUh.TFDE +x+ 9B45DE>7.FFGL h `G< pG# B GIBJBJB JBH!pHe I# p I pH#pHVITIII<H JB G !BH7> ? JB G !BH!> ? pGh!*h+) Gh(*h(Bh*(Ah )Ch+!h!*h+ ) G@h(hCh+!"QB G!G## YB @I$ \B8($ GpGF FEE (@(<B )4YB5EEFG<B )4B_FVFMFDF𴂰 FOF?FFBFTFB )BF4B5BOF]F?B&3B )BF4B5B>B )BF4BxFFFFG30- h, dh,"PB@0G0(KjF00N 0G hp-h(Dh () @( (`h``pG*,2x((80!"dk( N1@Dh) ((!"80Q)4#"B,$$BҁB BҁBI[B@CLB\"CB"CB"C(  pG GF)AL@F#")IB(@BB,$$BҁB BҁBI[B@CLB\"CB"CB"C(  dF,@BpGo G#)bIB(@BBS$$BҁB BҁBI["B@LBF$ACcFBF$ACcFBF$ACcFF(  $$"@cF$#BcF$ABcF$ABЌcF$ABL,@BpG GpGFGFGFGFGF GF(GF0GF8GF@GFHGFPGFXGF`GFhGFpGFJhh+ "h#`h#hh+Jh+G#`H DJHJt0HImM#*h[BB,УX<, H0Gkh"+)1 h2+t@tJh+G#`@GFF(8FG@F(28( @F(@FzhChB@F(@F(8(2;h`AF{hJh0@s`8(@FCFhhhh+W+NܑB  +@m:C* B #@d1CBBFxhShB.(***!#s```hLSBسhR;H`S`Bh#3`*0}#@RC`h3`#s`SB``bcp```B%$[B?0 )chF!^!(?0G0 )IhF!D"S@!(!0GHpGqh"+"Gh"+G"h"+G"0) hF!!(f 0Gp]( pG0T(0chrhS@c` S("h3hB= Q-0A( ``0B(# #`hh`hhB;`R#!BC[R+# @@+`# @+*@1HpGqh"+"Gh"+G"h"+G"0)qhF!l(( 0G ((!h"+"GF#(!#*Ѐ#BCB HlFBS9B GH#lF?!hF C( G %( *(+ H**+Ѐ H#@+@Bh"+"Gh"+G"h"+G"(#@+ ++  G++  `GFFFFP/ч#;@ +ىFJXF8^^^^(8cx"xCxCxC4)p#;@+ qD + hCF` FGaD !&%#x2@@C*@40*cx"xC4 !&%"x3@@C+@40+(@#@+#[B@Ccx"xC4cx"xCxCxC4"RB@T0 `##ab`# J M!CIB`#!`(0Jh(ca`+LJ@0G"#G  G0 `##a#|b`"C#t J# M!CIB`#!`(Jh(ca`LJ@0G"#G  GHJh( hB(Ci2+Jh(!|+hhB@i2(ci`ha H GhBci`HLJ@@G=G( p#@ + +++ G0+P+hHhpkz, 4z+ pG  nFB1+1221", 4#xR+P+L+24x @2!3GxhhpGpFF@(@ )F(4@AF"'(6@kFAF2FpGpFF@ F($$AF i5* 0$$AF X6kF 2FpG_FVFMFDF𴄰!RhFF*3F"0QFF+hF+8kh+.RF|[+(uHE ЁF>0QFF/+4*2 AFkF f(#@X@+XF)b(O+h+xFFFFG @Bh+_FVFMFDF[F7 F8"AFF+hF+Bkh+8BF|[+(HE ЁF78AFF.8<*2QF ##0@!kF ( #@X@+[FB(+h+ xFFFFG( @Bhh*p)|+K+(1pG+[+(1D(1#+hB*|+ѓ+h!h) (2Y(4#h+ h(2K1H0Kh&-.+hBU(!.$(Hr.kh;`h{`+[+|[+0d$) 2;23 p0GJh-ki(`!xHh*h)hB SiFhSi0+hcEhja`.Jh-ѰmiLJ@@  !3G  !)GCh0pGh0pG pG pGGh(Bh32PB`G(i ./oF81(+|+h"h*(94-#h+2(9 h``+|"C+tGh(9+|+h!h) (4#h6+(i I @C *aB @*ah(h|h%B +Y3XhhB B GBM_FVFMFDFhFR&F0JFUh'FB!#@$F{\NF3XSF23^[F!3VE %B xFFFFGEg_FVFMFDF𴃰h#WhFFFE(TF^ZF3XF@F ,$ BF #2#@!(# E 7E xFFFFGE@F6Fp)Ћ4 ~(`( &F` vh`(F` pG GF F"h*ShCE33|[+&Och+092#heh[hjhCE"09*0"hch9t`hIFG093[+OO_FVFMFDFshF#FFF!MECFKB#3X*hXF(,#3P3#D5E%$FTE81"01Y+ГY5#D2Eu`|`xFFFFGY4#XP@_FVFMFDF𴂰_hFF/0[3UhF"RBDKFh?F-nBF4YRF7(AF Y3P53RFAFP/KhJhBFS`xFFFFGGFkhhF'p(Ѐ#['C/K@/K@#@.K&C@CFC,K@C0FG([(-(`($,~#h[BB($##@@+?4KB'##@+@4#@;#@+#@C('$##@7@+?4, d7##@+@4?h"+"Gh"+G"h"+G"hZP ZK`** ;`"# `C`G(Ѐ#[@+# `# `(# `K~:`B@:Bي``# `?0 Y( 0G P((U( P(`hkh(G(kh+3 >(ch++(?( :( (3( .(jhchB* hhBܙBhhB؃B* @Bh"+"Gh"+G"h"+G" ( IF0L!#hIZh(Bh*݈ (#C`"#hRh``Bh3PSC` 0G @B1X`BKFZhB/ ;@+gKZh;!@D+гRFh$[hdB#@AFXCE(XFAFjRFh[hAF#@XCE(XFK :QFh"CFCAFk`CkQF`X`XFShF @S`BFCF"Ck`hhDK``````CK`PXF#aF[B @3F;@+^#D3K8J *C*%؋ 800K?hBch"RB@BҤhBch@Bh"*ۓ"@{hC{`2*[0T* n0#[B w0KB؋ |0~ CFZ *Q*2AF 83F NcF3;hB ih#[B@CF( !IBD"HM@MT(hh``iKh"CXFK`(0~h*[2FT*BF n3#[BAF w3KBAF |3~"F!F5T0,( +C"@+#8[BBМF x8#p14`E(0G*8((8(0 *(#+@+#8[BBМF8p2`E(0G#@""C)C(8((8( pGpGFKh!3`Y`pGCF-+;`}`~[~}37}+|!(@#@+  @B#DxFFFFG l I ,I"#iD [B p6FF5x6+ ;X+JXF lttttttttt*r"B80JjDx+; #p8YF#KFh"D +,[B YF##J+#jDp!5x6*-+0;$ + "#SC[5x+0;0<6 +#[BFBFKFh#![BDFBZF#\$ "#SC[5x+0;0<6 + *J*K #@(#+`%I*F*SF3`"K(`+ MF*)RFx+SF3*#`PFSF3K @+LF#`$@s?@t2A\s'`sdsKhpG49"Hh`+hCF^hh#D.( ( @B窉GF"RF'.thЀ#%B.У JC!`m(bmKcJC ` aea.#^p(У JC磉JCjKBѢ+Cd&)K%C&)* +x `xXBCG @B iF #@)#@+#9[BBМFxB90aE G&"32^*) H OF"h`Fr@C;@+ "xB20*94) p 4B B#4[B8BМF9 x<8#p`E0pG*+3C"@+ #8[BBМF x8#p14`E2)8((8(Fpl(гh(h`#a`pG%@2 !( F`` !"d( )JhlX `lPGWFFF "IF.i(F0'FhaF @!YC #SCAD  FbF@[7BCF+ЫhBihPF1*i) 12 0V)PF%3AF6P.a(FFGGFF@F 0 !\#!B[1B8gKa# a % .! 4#x80; "54B4EE CF]#x80; "~=4-FG 4K@"+$#@+#@+#@+ (G#@2+ 222" h#@+#@+ G#@+S ` `K@ + #@+#@+#@+ #@+ `R0* 00 0    !#DaaG_FVFMFDF %i:iB<%i:iFhahE1[F1FNE#NE4FKD7FsDFEXqF h0) hF!!(0G0) hF! "S@!( 0GHpGth"+"Gh"+G"h"+G"0)O hF!J!(K0GWFNFEFഀFF !@FFp(CFTFZhch!B!EF@Fi`8FFFGPFX(!@F](PFb( PFR(@FW( ;@FO(PFJ( FFPFrhCh!B!RFPFQ`CFhih$UFh&h-i'  ;2,   ;2%+" +" !":1bABB & 5>fAB٬ Bѣ$!YALAUFDFhhHF`bhkh B JF `P`OKB#ٜFMFh3` @+ r C|'$$3ih"iBYBT1L0K!"B زBC CCAZ !CLr Ck&C+#@")`;a*р"R@$#C+3+C+#$bABطBr kC&C`HpGth"+"Gh"+G"h"+G"0 )hF!(( 0G ((!h"+"GF0 )whF!r(( 0G ((!h"+"GF0 )IhF!D(( @B0G ((!h"+"GF0 )hF!(( 0G ((!oh"+"GF0 )hF!(( 0G ((!Ah"+"GF#(,<#*%Ѐ#BCBJBFb [C8cEhFGHI#hF! D( G &( +(+ H+++Ѐ H<"C+@Bh"+"Gh"+G"h"+G"hF!'  )GCh"+B`G"p. #+ @@ @C) pG[B %@WFFFchh&iF'(:IJ4+CO&JI@1@ C KhFˆ@K9@ CÀSFy#@ CqFFG (Q (%&3+C+Рh9JB=8*"%&#)@") #$fA1KB'1* C4 *р"R+@$#C+Ѐ#$#F#@;4@+@#C+#F1(P$CFC&C#BO%&qK)#@")#$fAKBj Ct&71* C4 R*р"R+@$#C+Ѐ#$h"+"Gh"+G"h"+G"DhhjF ӈ[Y y %{`))'JB&J(`#;`3C)"M#N 4C`a#;`p k( pG b((g( b(`hkh(Y(kh+D P(ch+<(Q( L($(G( B(kh+#nhchBѪhhBܚB.б(i!iB؈B ЁB؁B hhBhhB. @Bh"+"Gh"+G"h"+G"GBAGI Build: v1.0 (2004/01/27)No AGI Game embedded in ROM!NO_NAMEGBAGI 1.0 '''BRIPRO'''Select a GameInformationAbout GBAGI GBAGI The Nintendo Game Boy Advance Sierra Adventure Game Interpreter By Brian ProvincianoHIMQPOKGhifcbadgCloseView ItemItemsSee ObjectInventoryYour inventory is empty.!"9"}"u#5#"#"]pp8||8??????            $ $ $ $ ( ( ( ( !, !, !, !, $0 $0 $0 $0 '4 '4 '4 '4 *8*8*8*8-<-<-<-<0@0@0@0@3D3D3D3D6H6H6H6H9L9L9L9L<P<P<P<P?T?T?T?TBXBXBXBXE\E\E\E\H`H`H`H`KdKdKdKdNhNhNhNhQlQlQlQlTpTpTpTpWtWtWtWtZxZxZxZx]|]|]|]|` ` ` ` c!c!c!c!f"f"f"f"i#i#i#i#l$l$l$l$o%o%o%o%r&r&r&r&u'u'u'u'Score:%d of %don Sound:%soff c c,c c-o < k-<=o< =c,c\c-c]o,l,k] .c>g?o=oo?c-c].^o-kn-^=cn>gooNmo/ooo o,o o-{ < {-<=< =kn~ , - =s w.ok=k>{=w>k-k].^{-wnw.^sNknkOsoN{n{/{o<=MosNk-]g.^=w]^cn<}k=kn]}c^~]}>~=>kNkkOg.c^c/_>o^o_=mg?go=~>so^~_w_~?ooMooN]N=]>w_>]_~ -oo/ >w{/>o?>?=mo?oo=~>w^~__~? 9`MKHPicag @P` `MKHPeval.zequalnequalvlessnlessvgreaterngreatervissetissetvhasobj.in.roomposncontrollerhave.keysaidcompare.stringsobj.in.boxcenter.posnright.posnJalJmlJlJlJmJ9mJimJmKm KmKn@KYn$Kn0Kn0mDCjf8m Cd8m C>6 xmDE7Emm$m,m4m8m@mHmtmdF4mDF4mDFJm F ``9Fm4H(nDH(nDH(nDH<nDt4LLLqPJ@M@MHMHMPMPMXMXM`M`MhMhMpMpMxMxMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMNNNNNNNN N N(N(N0N0N8N8N@N@NHNHNPNPNXNXN`N`NhNhNpNpNxNxNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNOOOOOOOO O O(O(O0O0O8O8O@O@OHOHOPOPOXOXO`O`OhOhOpOpOxOxOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOPPPPPPPP P P(P(P0P0P8P8P@P@PHPHPPPPPXPXP`P`PhPhPpPpPxPxPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPQQQQQQQQ Q Q(Q(Q0Q0Q8Q8QGBAGI 1.0 '''BRIPRO'''AGiI!Gold Rush!p`>`B`F`J`NSWXdoo4h8bkM7M?(43N5N68 9> ;:< =HPOe iiq  c  d fe   ( ) d } % +eZeBe d ~  d d | d          #  ce x     0  d e  ii )()p )()q )'239 F24356FG64253j21e!11e 1 e"1 e#,1    3  3 j  r 3      BBr kk: k  r rr)r re%r $$B r rerre&\2.r$eV+bccbcc V HZZWZaW5r+. .+bccbcce\e  .e _ + as;  = =bcc aWW .  a  N  N eR   ((((( % % (   (   ( s  s et tmt!ttt-t.t/t0t 1t 2t 9t :t ;t t }  e g 9 l    `     O ! a55g  # { $ z %  &  '  ( T ) U * u + t ,  - p . aoo / nyy 1  5  7  : Z  Z e e  0      ;11;Hu     uvu)# # eIeJ-&&&&% %& %'-''$'"k""e$k$$e#k#,1 1,,1  e1,  c  2eKn6'e' + (f 0g<Tea'a'eZa'a'eEFiee 'e]'e<'e'ee'e''e'e''e'e'e0eC' +eQeGZ'eLe-  (2<FZ.BRex@+y6Ml'2=HPXbi|   4 < v  2 C N V ^ v  J a  "%w1"%m10"%w2"%m10"%w3"%m10"%w4"%m10"%w5"%m10"%w6"%m10"%w7"%m10 is not understood. GOLD RUSH! Version 2.01 Dec. 22, 1988 Inventory TABYour house is already FOR SALE.This is one of the first adhesive stamps ever. You notice a lump under the stamp.The letter is already open.Elapsed trek time: Elapsed Time F6Score on/off F4Cancel line Ctrl-CEcho line F3Pause game F10The person interested in buying your house has been waiting there, but is now gone. Sorry!It is difficult to read, but you are able to decipher "Sutter's Fort."You peal back a corner of the stamp and find a GOLD FLAKE! Jake has found gold!!%m28%m29Slow Elapsed time: Hours: %v154 Minutes: %v153 Seconds: %v152You have already done that!There is nothing on the back of the family photo.To see how much %w2 you have, press the "TAB" key and look in your inventory!You only have one house to sell!It's way too late to do that!This is a difficult decision. Your house means a lot to you, but you put it up for sale.Jan. 25, 1848 Jerrod, This letter is of GREAT importance, as you will FIND. I live IN THE area drained by the AMERICAN RIVER. Today I came down to bury Pa. You will want to come here quickly; only you will understand. Farewell, Jake P.S. Bring something from home so I will know it's you.The letter isn't open.You carefully open the letter.It's not wise to drop anything. You never know when you might need it!File %m50"%w1."%m50"%w2."%m50"%w3."%m50"%w4."%m50"%w5."%m50"%w6."%m50"%w7."Ain't never heard of Restore F7Save F5Restart F9Quit Alt-ZSierra Action Special SpeedJoystick Ctrl-JNormal Fast Sound on/off F2Help F1 Months: %v118 Weeks: %v117 Days: %v155 %m16%m65%m28%m29Nothing important %w2 here!Time enroute: >You notice nothing unusual.FastestWe interrupt this game for a very important announcement:President Polk has confirmed the reports of the discovery of gold in California. THE RUSH IS ON!Press Enter then: Restore game Restart game That will do you no good.About GOLD RUSH!----------Slower -------Ya see nothin' unusual.They smell lovely.%m68%m65%m28%m29Now is not the time.Ouch!What do you mean?There's plenty of gold, you just need to find it!You have to do that yourself.That's the right idea! How are you going to do it?There's no one nearby. Greetings! Welcome to GOLD RUSH!Bye!%m255close it.%m255open it.That wouldn't be very nice! Get ahold of yourself, Jerrod!Yuk!!No time for that!%m255move it.%m255climb it.You don't need to 4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4b c cwMeig ,zThe dreaded disease of cholera has knocked on your door. Your misery is over.There was nothing you could do. Sometimes terrible things happen!4'f BZp ,Aq )@sdiscard.view(%v18):%m30set.view(%v18,_):%m26set.view(_,%v18):%m30set.loop(%v18,_):%m26set.loop(%v18,_): Bad loop #.%m25set.loop(%v18,_):%m31set.cel(%v18,_):%m26set.cel(%v18,_): Bad cel #.%m25sound(%v18): Sound not loaded.%m25set.cel(%v18,_):%m31Script buffer overflow. Maximum size = %v18%m25erase(%v18):%m26animate.obj(%v18):%m26print(%v18): no message%m25Bad test: %v18%m25Bad action: %v18%m25start.update(%v18):%m28draw.pic(%v18):%m32draw(%v18):%m26draw(%v18):%m31discard.pic(%v18):%m32set.scan.start() already active in logic %v18.%m25get(%v18) or put(%v18):%m26 Press ESC to quit.%m27.%m25 Bad object number%m27 or object not drawn.%m25 View not %m29loaded.%m25%m29set.%m25Picture not loaded.%m254|   v7 8!vvv$&# vօZv]ve e vv&v e & vv eh0:HVer} (2<FPZNew room:X coordinate:Y coordinate:Object number:Flag number:New value:Current room = %v0Variable number:Variable %v214 = %v215Flag %v120 setFlag %v120 not setWord not known:No response to input.%m12"%w1"%m12"%w2"%m12"%w3"%m12"%w4"%m12"%w5"%m12"%w6"%m12"%w7"%m12"%w8"%m12"%w9"New priority:400g<Te'e e  e)'e e!e"ee#e$e% e(]e']^^e(ee*e+e,<<e-e.eieeZeU eegeh+ee h3n'ETw06HasSorry! Right now that is not possible!Now is not the time.Ouch!That will not be helpful here.You'll never find yer fortune in GOLD by trying that here!Look, and you will find!To whom? Greetings! Welcome to GOLD RUSH!!Bye!You find nothing of interest under it.It doesn't need to be closed!You feel nothing out of the ordinary!It doesn't need to be opened!It won't move!There's nothing important to read!Smells typical!It won't %w1!That would serve no purpose.You find nothing of interest.What are you going to do about it?That wouldn't be very nice! Get ahold of yourself, Jerrod!Yuk!!No time for that!What do you want to %w1?What about "%w1?"What do you mean?4j ggggggg g g g  g g g gg ggggggg 2Kf/Ia%w GOLD RUSH! Lend me a hand F1 displays HELP screen. F2 turns the sound off and on. F3 retypes the last line typed. F4 toggles status line off and on. F5 saves your current game. F7 restores a saved game. F9 restarts the game. F10 pauses the game. TAB shows the status screen. ESC displays menus.Ctrl-J sets up your joystick.Ctrl-R toggles RGB monitor modes. F1 or HELP displays this screen. TAB shows status screen. (see below)Double clicking joystick button or right mouse button also shows status screen. F6 shows elapsed time.Ctrl-C Cancels last line typed. Alt-Z Quit F8 toggles trek messages.Ctrl-N go to next trek scene.4 ^^^(^ 2^ <^ F^ P^ Z^A AO#!g1?(\Z,(\(\ ((\ F(\(\ F10(\ F(\(\ 2(\ !k1R( \ Pp\Ze( \ P\ FE(\ (6(\$!1(\ < \ 4   !+6:@GMU^gr~ #,7@KT_hs| -:IYeu,6@IT_ft|'0@S`q&3<CSbot}'0;JZir   ) / 7 ; G L W ` e u incrementdecrementassignnassignvaddnaddvsubnsubvlindirectvrindirectlindirectnsetresettoggleset.vreset.vtoggle.vnew.roomnew.room.vload.logicsload.logics.vcallcall.vload.picdraw.picshow.picdiscard.picoverlay.picshow.pri.screenload.viewload.view.vdiscard.viewanimate.objunanimate.alldrawerasepositionposition.vget.posnrepositionset.viewset.view.vset.loopset.loop.vfix.looprelease.loopset.celset.cel.vlast.celcurrent.celcurrent.loopcurrent.viewnumber.of.loopsset.priorityset.priority.vrelease.priorityget.prioritystop.updatestart.updateforce.updateignore.horizonobserve.horizonset.horizonobject.on.waterobject.on.landobject.on.anythingignore.objsobserve.objsdistancestop.cyclingstart.cyclingnormal.cycleend.of.loopreverse.cyclereverse.loopcycle.timestop.motionstart.motionstep.sizestep.timemove.objmove.obj.vfollow.egowandernormal.motionset.dirget.dirignore.blocksobserve.blocksblockunblockgetget.vdropputput.vget.room.vload.soundsoundstop.soundprintprint.vdisplaydisplay.vclear.linestext.screengraphicsset.cursor.charset.text.attributeshake.screenconfigure.screenstatus.line.onstatus.line.offset.stringget.stringword.to.stringparseget.numprevent.inputaccept.inputset.keyadd.to.picadd.to.pic.vstatussave.gamerestore.gameinit.diskrestart.gameshow.objrandomprogram.controlplayer.controlobj.status.vquitshow.mempauseecho.linecancel.lineinit.joytoggle.monitorversionscript.sizeset.game.idlogset.scan.startreset.scan.startreposition.toreposition.to.vtrace.ontrace.infoprint.atprint.at.vdiscard.view.vclear.text.rectset.upper.leftset.menuset.menu.itemsubmit.menuenable.itemdisable.itemmenu.inputshow.obj.vopen.dialogueclose.dialoguemul.nmul.vdiv.ndiv.vclose.windowequalnequalvlessnlessvgreaterngreatervissetisset.vhasobj.in.roomposncontrollerhave.keysaidcompare.stringsobj.in.boxcenter.posnright.posn4?ee8888888 8 8 7 Bgg BBgg  g8=8OP8BZ )eeeZ 9)/dMId eeAA88FH H8Z[\8<<8r8>8@8B8D8v8D8 o8 q8 x8 q8 iLZZ[Z[\[8=:1;; yv.G`Maybe it's the long trip you have just endured, but your extremities feel as if they are cramping up.You have never suffered from motion sickness before, but your tummy isn't feeling well.You had a drink before you left Brooklyn, but now you seem dehydrated. messages displayed messages suppressedCtrl-n for next scene 4Z c cwMg JIt would behoove you to move yourself out of the way of these wagons!4/*  4 <j gggggg g g g g k  1R_kx Abbreviations for commonly used words: l = look g = get t = talk n = no y = yes s = slow (for speed control) f = fast ff = fastest4e December 22, 1988 Larry, Doug and I would like to thank you for support, suggestions, ideas, and encouragement through out the course of this project. Sincere thanks, Ken and Doug MacNeill 4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4M9Mn";#:2"+3 2J$+ 90> )6;@DZ^gg|~}U@ + K| %%-59988:91/%% & A 8&.2882.'')   8N{  7(17 }  ãšujfb]VTLIGA:+)"  6a 9)##"9#:!0ICA8Y{vd˰Ѳš `H?#ET+`kfp|Y0",*  : ɒɤ#!3%:#+ ! * ʒÔ k +.9 )U Ҵ’}{+ ,"+2!*";1+!$1*aa"|3:a!][binp|}Y, , ̱, ´%%$eZjaa1 * K$12a{Gx|xskgWX}sy^ Dk p |2fmmchw]fk$ZX^]O<NOgP`mPqXlYgPr[y[{dsdr[6OQ(]I)e(]-_9&/h-_M`8Q*_/alVwb%\(i'i$]$\'g3c*u,t3d,r-a?gQ>q^+\JDVLVLWJW]}_nXmccbdfnccglgncedZ%)c\\tFW>X5ce_!: gb lb9p_n`laAA1_]af`qazMX%;Z='!!!2+1+^2xN  # *" ! +"+  |X 9 )!*#+) )<"*!!@$!0;! * wT"Bu1=1!SeVFA:zHFA?=8zZ87AZd03]l rWda 1jeed ^j Xi`emga]\sYxg`dT~O158~AM~{4\f[l]m__ba)`m&dudv`LX%9a <^aadm_u )+*|*h&c'a)\+V)P&K&F)B*A+;)5)-,*,)+$*** ( *)*))q1./U) #: IUj]_>V4S,NP1M-P+L  *!"I J(I0R-+---.0-G.ⲹHGEF-K3L=MFOLPROSNLOKMNIJFIELCMBLp@fA_C[GaO(WVLUMWH:F1H+638DPLQHRE!n :5 75  ?5 ! 66 H7   W< " XA  O6 !S> 6 ) . ) .  4 )9  *- 3)/..-.//-.3*4)43223321  ++--./.. J I   K) JAU 0 S= X> Z9 #L63C3)43 0AR0 ;2:24(3(--++*+D9 F I )O4 3 2 2 1 00,,, , , . -.11153444-,**+**40480-6+M=@D8 6C2 3)9*1EGGEEGIII K L53737555;3:3BSBUDUDS K LT>T@Y?Y@Y;W:I6J8K7P6B57 5 4 2 3 /2-,+x)~({+{'%(\f^h lO {a1_ -] T;Z7CBhe TvUxXwVvYuTqQoSoTgQfRiOjMgZZVF\F^C`@\@a>`L`Mc7i:l7f9j4n3l6p4x7z6| "?I^SFr~ff!#%"$|FKMPTrvro q HjIeGbEdGnNqQvOzLO~OvTS~SPORJID~ABFIH?>9r;o=t?hAfa1f0k2n1u.z152}3y2 8*@-H)Q)Z-],l(}+-- M8!#1) 9 8 &"|z~zuz^iq}4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4~  4 #0',211A1123211q11qqq112222121212222122211A1123211q1qqq1111222212121111212121211A1123211q11qqq112222121111313343211A1123211q11q11q11q11122222121112233211A1123211q11q11q11q111223333221233211A1123211q11qq111222121212222122211A1123211q1q1112221212121111212121211A1123211q11q1122212121121313343211A1123211q11q11q11111222221211112233211A1123211q11q11q11q1112223332111233 ;e 2111A123211q11q11q11q111222121212121212121212 2111A123211q11q11q11q112222121212121212121222 2111A123211q11q11q11q1112221212121212121222 2111A123211q11q11q11q112222121212121212121214 2111A123211q11q11q11q222222121212121212121444 2111A123211q11q11q11q1122221212121212121444 ~dH211112321111111112222121212121212121q222111123211111111222221212121212121212222111123211111111122221212121212121212q12q21111232111111111112212121212121212q14421111232111111111122212121212121212144421111232111111111112212121212121212121q4q4 xt 433334543321141444444141414141414141q44 433333421 1131323234444142424242424242q3q3q3q3 3111111513112 22211333121232422334444 3112121213121 12r1q1q1132122212233343q3q3q 5411211211211311211 24r4q5q5153133111223247q7q7q 541414141515131 144555311112324777666664 i$[32B2223Q221q11q11q1q1q2q222333332222243B3334Q332q22q22q1q1q1q111344432112 87B7778Q776q55q54q44q4q4q6622221211=<B<<<=Q<;9q98q8q7q7q9q24212121?1?B????1Q=1;q99qq26q23q21q21?3?2B272242r21rqqQ?32=B261A2 21qqA4  E3aq3c2b2223Q221q1q1q1q1q1r1r2q2a2b2b3b3a3a3a3a2b2a2a2a24aq4c3b3334Q332q2q2q2q2q1r1r1q1a11b3b4b4b4a3b2c1b12 8aq8c7b7778Q776q5q5q5q4q4q4r4q4a6b6b2a2b2f21d211b=aq=c    4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4ZP ( (q ;%!);+-XC=6%@#L P* *  (p i*TQ@  Q9  Q6 ( (  )Oc2P P 8<88=88?888O@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88N885 'W W8<88=88?88@88A88B88C88D88 E88 F88 G88 H88 I88J88K88L88M88c88N88Q88R885e(@eejee~e e *ee g}Ӊ.o to return to the cemetery.What a view!!From here you have an excellent view of the East River.You see a quaint little church!A small cluster of homes surround the church, making it the hub of this little hamlet.You see the outskirts of Brooklyn.The view of New York City is breathtaking!The trees add to the greenery of the landscape.You are aboard the mighty "Sea Farer." This may be the last time you see these familiar sights of Brooklyn!The ship is not in sight.4s/z4z4z(4z<4z P4z d4# z/c  :#%08*bb )!=XC%6L #)!=XC%2#6L #$$k!)+-&$%#P*Qj9 :!)#+/6%,#C:!)8+%N:# QpN! !)Ix  %+/'234253F F!K%< "F&K%M 'F+K%]*#: ( )*c:d/<;$ : $ 3Ne;E48-W   C) / 9Ie y @dM5+)8%pN#QN+)8%N#QpN vdMk))%)0+%P#QBP+%P#QBP+%B#QBP0 QPQzPQB  $'klFGkl@  (   (  ݂߂rR ނ߂rR$$k!)+-&$%#P*Qj9 ** $&.: : je zhee(@ \ee cheeee e  G  e e*( #bke eKe e[ee*e9$$kee Qkeee)*e8Eee*e8^EE4<<.<e %e!0e"<e(Ce4;e%e0e ;e(  VEE4((.(e%%e&0e'(e)ee$e+e,]](]](]((=(==e::_ v9~Hl3]<jPLp> 0 h  + If you've seen one of these wagons, you've seen them all!This house, just like every other house in this neighborhood, is very valuable.This is the oldest bridge in town. It is very weathered.Getting around town is much easier since this bridge has been built!This is a very peaceful estuary, in a peaceful part of town.On the other side of the estuary is the downtown Brooklyn Park.Looking across the East River, you have a spectacular view of New York City.The city streets have been much safer since they installed these streetlights.You are in the heart of suburban Brooklyn. The year is 1848.Because of these maple trees, this is a very shady neighborhood.Although it's not the busiest street in town, it isn't called Main Street for nothing!These are wrought iron fences.New York City is only a ferry ride away, but you haven't been there since you moved to Brooklyn as a child.This is the East River.Just look at these beautiful yards!Water Street is very appropriately named.Sea gulls are a common sight here.Don't you wish you were on that ship destined for distant lands?The ship is not here. The CLIPPER is ready to sail! Don't miss it! First Class accomodations to CALIFORNIA!!It is difficult to read the poster from here.There is no poster to read around here.There is no wagon in sight.There is no one around.From here it looks like that handyman is carrying around a rake!Even from here it is easy to tell who that is. That is Leonard B. Huge!!From a distance it is difficult to determine who that is.There is no doubt about it, that handyman is definitely carrying a rake!It is hard to imagine anything being that huge!!You have no idea who this man is, but you know he is a real estate man.No one is close enough to hear you.This new homeowner says, "I've heard about the gold in California, but I just can't give up my house."Leonard says, "Jerrod, go to the warehouse sometime and take a look at the new poster I've put there."This real estate man says, "I'm on my way to close another real estate transaction."That man sure can handle an animal team and wagon!The man on the wagon cannot hear you over the rumble of the wagon.There is a poster on one of the trees.The railing keeps people from falling into the estuary!There is nothing but water under the bridge.Along the Brooklyn shore you see many people and wagons! This may be your last look at these familiar scenes!!You are aboard the mighty "Sea Farer!"You have more sense than that! That water is cold!!4iG/z4z4z+4z ?4z S4z g4z {4# z/:@ !%0C#F*b!)=XC%6L #!)!+=XC%86L#:! !  !)%L# !)!+0%K#:##k!)+-&#%#P*Qj9 !) DFLK%6 MFWK%W XF\K%n*#*cE VdMK)C)%+%P#QBP+%B#QBP# QPQB  $ o#dMW#)0)F+%L#QUL+%U#QUL# QLQU  $'klFGkl'FG@  (   (  ݂߂rR ނ߂rR 0KJ` ;6)s )P݂ QlZO Q{}< Q) Q Qa )QLP 8 0<       Qb) $##k!)+-&#%#P*Qj9 * $*.Ceje[eKe(@e @e  e e1e ee  EEE<((W(4Ce%e (40e!Fe"<e#ee) *e8 ~*e8EEE<< 1e?e= 2  e@eBeC r$x&RCs}:hdB|^9`@3 K + : r  < f  " 9 ^ s CuHThere goes the ship to California!The ship is just out of sight.This house on the corner is Leonard's house.These maple trees dot the Brooklyn landscape.Each house in the neighborhood has a fine yard.You see the East River.Across the East River lies New York City.At this moment you are on Washington Street.This is the intersection of Washington and Front Streets.Right now you're on Front Street which, like the other streets in town, is made of cobblestones.These wrought-iron fences add a touch of class to the neighborhood.Leonard says, "I've been getting some business from my poster in the warehouse, Jerrod, what can I help you with today?"There is no one around here listening to you.Give this poor man a chance to catch his breath. He looks exhausted!"...there is room on the ship! The routes to California are: around Cape Horn, or by way of Panama. The prices are: Panama route $900 Cape route $650 Are you interested in a ticket?""But in case you're interested, the routes to California are: around Cape Horn, or by way of Panama. The prices are: Panama route $2300 Cape route $1800 Are you interested in a ticket?"Leonard is going back in his house."Which route are you interested in, Cape Horn or Panama?""Okay Jerrod, I'll talk to you later!""The cost of a trip to California by way of Cape Horn is $650. Would you like to buy a ticket?""The cost of a trip to California via Cape Horn is $1800. Would you like to buy a ticket?""The cost of a trip to California by way of Panama is $900. Would you like to buy a ticket?""The cost of a trip to California via Panama is $2300. Would you like to buy a ticket?""That will be $650, in cash, please.""That will be $1800, in cash, please.""That will be $900, in cash, please.""That will be $2300, in cash, please.""I'm sorry, Jerrod, but there isn't enough money here to get passage on the ship.""Thanks, Jerrod. Here's your ticket. I hope you strike it rich!Fastest service to the CALIFORNIA GOLD! Inquire within!You are unable to read the poster from here.There is no poster to read around here.%g69yes or no: %g69Cape or panama %g69If you aren't talking to a man, you will be shortly!There is no one around.There is someone to talk to, but he isn't quite close enough.The new homeowner says, "If I hadn't bought that house, I'd probably be on my way to California right now!"You say, "Thanks, but no thanks. My yard looks fine."You say to Mr. Quail, "I've been missing Jake a lot lately and hoping we get back together someday."This real estate man walks by without speaking. Just murmuring and mumbling to himself about finances.That man thinks the only thing on earth of any worth is his house!Here comes that real estate man with money on his mind!There is someone walking down the street, but you can't make out the face from here.Mr. Quail has been like a father to you. He was there for you when times were tough.The sidewalks are made of rock.There is nothing unusual about this gate.The gate is already open!You can't do that from here!Here is another fine house in the residential area.You can see the number twelve on the post in front of the house!You're welcome!There is no bell here!Streetlights line Washington Street.What about a ticket?This post marks the corner of Front and Washington Streets."You'll never find a cheaper time to travel, Jerrod! And...""Everyone is doing that these days, Jerrod, so I've had to raise the cost of passage."Leonard is pacing back and forth past the window.Leonard will be outside soon.Leonard is outside for a breath of fresh air.Tell the man what's on your mind.Leonard can't hear you.This gate cannot be opened.Only the owner of this house can open this gate.Mr. Quail replies, "So have I, Jerrod. I'm sure you'll meet him again someday."Leonard says, "You already have a ticket, Jerrod. You don't need another one."The ship is not here.4 ,/z/z/z(/zje? r%x&E| =`#a3Qhma,FV[q3U, r  1 W J a { & < ^ / It makes you sad to think of it, but the house that your father built no longer belongs to you.You can't do that from here!You try to open the gate but discover it is locked.You always keep your house locked.There goes the ship. It's too late to ride THAT to California!The ship is not in sight.It is a familiar gate.There are many houses in Brooklyn, but this one has a special place in your heart.This door has kept the winter's chill outside for many years.There are two streetlights outside of the house.The wrought-iron fence protects the house.Your father planted these trees when he built the house.This is a very peaceful estuary, in a peaceful part of town.The lawn surrounds the house.This house is located at the intersection of Front Street and Main Street.The sign says, SOLD.The sign says, FOR SALE.New York City lies across the East River."I like this property and am willing to pay top dollar. Will you accept $850, in cash, for your house?""But, I like your house and would like to buy it. I have $750 in cash. Are you interested in selling?"Congratulations! Property values are at a premium. You have conducted a prime sale! You are sad that your house is gone, but you'll always have the memories.Property values dropped since the gold rush. You think to yourself, I have just sold the house my father built and I didn't get top dollar.You ponder for a moment and decide not to sell. You are too attached to this house to part with it now.The real estate man interested in buying your house says, "If you snooze, you lose. I've got to go!" To CALIFORNIA by land or sea! A small price to pay for the RICHES you'll receive!You are not close enough!yes or no: %g69%g69You are too far away.This man looks like he is interested in buying your house.Look at that experienced driver work that team!Ever since that tragic day your parents died, Mr. Quail has been like a father to you.Here comes the bank teller again!Mr. Homeowner" must be on his way to the hardware store to complete another household project.You say to Mr. Quail, "Sometimes I think something terrible may have happened to Jake. I wish I knew how he was doing."The real estate man says, "I sure did get a good deal on this house."The man on the wagon can't hear you over the rumble of the wagon.The teller says, "It has been a pleasure helping you with your account at the bank all these years."There is no one around.No one can hear you at this distance.That wagon sure puts on a few miles in a day!There is no wagon in sight.When you were a young boy, just after moving to Brooklyn, your father built this house with his own two hands. It is one of the few things he left to remind you of him.You can't read a tree!The door locks by itself!There is a poster on one of the trees.It is already open.If someone answers, you're in trouble!Just walk away from it.It is already closed.There is no doorbell here!Just a normal window!The number "ten" is on the house!The real estate man says, "Ever since folks have been rushing to the gold in California, property values have been falling."The real estate man says, "You are fortunate to own such a fine piece of property."It may not be the nicest, or best kept house in the neighborhood, but you value it more than a mansion.As you give the real estate man the keys to your house you say, "Mr. Quail will come by to pick up my personal belongings."Mr. Quail replies, "I have this feeling he's fine and someday you will be reunited. Don't give up hope."4 4z/z Y q There is a %w2 on patrol in the park.There is no %w2 in sight!"In the name of the law, DON'T TAKE ANOTHER STEP!!""You have broken the law; I have no choice but to give you a ticket. Please don't make me do this again!""Excuse me.""Pardon me."The sign says, "KEEP OFF THE GRASS"It is difficult to read any sign from here.These lawns are beautiful! It is no wonder they have those signs up!The street in the foreground is Front Street.This estuary runs all the way across town.You remember playing around the gazebo as a child. You would lose your candy through the wide cracks in the gazebo floor.The lamplighter sure has his work cut out for him!The trees shade the park.You see the sparkle of something shiny. Ah yes! A closer look reveals a gold coin under the gazebo!There is nothing under the gazebo but dried leaves and dirt.From here it is difficult to see under the gazebo. You might try that when you have a different perspective!The light is dim, but it looks like a gold coin!You strain your eyes in the dim light and see no gold coin.You stretch your arm as far as humanly possible. The gold coin is almost beyond your reach, but finally you are able to grasp it.You cannot see a gold coin, at least not from here.This lawman looks like he has mighty long arms!Someday you hope to ride on that ship!The ship is gone.The floor is made of wooden planks with wide cracks between them.You need to get closer to the gazebo to examine the floor.You already have the gold coin. There is not another one.The gazebo is surrounded by a beautiful floral arrangement.You already have some flowers.You pick a few flowers.From here you cannot get any flowers.Driving that animal team and wagon is his life.Mr. Quail has been like a father to you.The teller is out for a walk in the park.There is no one in sight.You aren't close enough to get a good look.The officer says, "It is my sworn duty to protect and to serve."The man on the wagon is too busy driving the team to listen.Mr. Quail says, "I sure do miss having your brother, Jake, around. It would be nice to know how he is doing."The bank teller says, "I remember the day I helped you open your account at the bank."There is no one to talk to.No one is close enough to hear you.There is no wagon in sight.The wagon is driving by the park.This is the downtown Brooklyn Park. The gazebo and flowers catch the eye of those that walk by.You look through the cracks carefully. There must be something under the gazebo but you can't see it right here!There's nothing up here!There is nothing but water under the bridge.The flowers add a nice aroma to the park.You reply, "Me, too. I miss Jake a lot. I hope someday we will meet again."You can't lift the planks.There is no candy here.All there is worth reading here are the signs on the lawn.4I z4z4z<4zP4z d4z x4z 4   7bbbbb b"k!)+/6&"%XC#:! ) 7+ % N# Q zN+ % zN# Q N!  !)/%B6#F:!)/%B6#F:!)/%z@#;] GsWhat is that horrendous noise? It must be the ship leaving!Bon Voyage! The ship is gone!This warehouse is huge! There is a poster attached to a large post.These boxes and crates have come from all over the world!It is a beautiful view of the East Sound.Through the windows, you have a spectacular view of New York City and the East River. Go to CALIFORNIA!! by Sea on The Modern SEA FARER! Inquire at: 12 Front St.You are looking at the back side of the poster!You need to get closer.These crates are all nailed shut.Climbing crates will get you nowhere!These crates are far too heavy to move!These crates are far too heavy to carry around!There is nothing important up here!The warehouse was built of wood.Typical warehouse walls built of wood.Sea gulls are a familiar sight around here!There is nothing important down here!The crates have nothing to read on them.Strike any key to return to warehouse!%g69You see a poster attached to a large post.You have more sense than that! That water is cold!!4m/2XYbbbb z2x!)2 -+&-r+/%6#r#!)/+/%bN6 #: !)Y%Ib# !)X%Ig#:!)%f#O#K  Q#bQIb Q/{QIb +<F  Q F$Q)G  Q){   Q/{ W %%?q6 #)  * rx$ 8 rxc 6e7F ?wH Q/gGrx&   QIg  : rx&!ree+T Onl CkNv ?wH: Onl ff ClNve5 ?wHeee&ee, ?wH  c f ;Q/g e"""^^W ?wHKe e  e Q'G  ee ZZZBZBppBq ?wHe$r\cHe e  e Q'G  ee    ; ee    e! e" eee Oqque,e.e./ CkSy W CkSye# We$e%Z.&eLe& 2  e'ee(+e+e-Ze.BB e/Z e0e1e1B e2 e3ZZZe4..e5 re9 rx&9 tF#n:c,T3nJ):Tm1A9 V  a You are not close enough to do that! You best make haste, There is no time to waste! Head West to CALIFORNIA!!You see nothing very exciting. There are just a few horses and buggies for sale. WANTED! Dead or Alive! Zack Pitts Use caution! He's dangerous!You come to the Post Office often. There is a counter between you and the mailboxes.There is a bell on the counter between you and the mailboxes.There is a small sign beside the bell that reads: RING FOR SERVICE.RING-A-LING-A-LING!!DING! DING!DING! DING! DING!"What can I do for you?"There is no one here to help you.The postmaster isn't quite here yet, but he's on the way!"Let me check. I'll be right back.""Good news, Jerrod! You have a letter!!"The postmaster says, "You have been checking your mailbox everyday for the last eleven years hoping to hear from Jake."Be patient! He's checking and he will be right back!I don't think he heard you.You see a few letters in the mailboxes.You see your letter sitting on the counter.%g69Fantastic!! %g69So sorry... %g69There are three doors here, none of them are important.If you want service, there is only one way to get it: ring the bell on the counter!The postmaster is behind the counter waiting to serve you.You notice a man occasionally walk by the door to the back room.Under the bulletin board is a counter and some cabinets.There is no one with you at the moment.Be patient!! The postmaster is on his way to the counter.I'm sure he'll talk to you when he gets back. Right now he's busy!He's not listening, he's leaving. This door is for "EMPLOYEES ONLY."Just walk up to it.You are not close enough to a door.It is just a wooden floor.You're welcome!!Buzzer?? What's a buzzer?The postmaster exclaims,He places the letter on the counter.On one of the walls there is a bulletin board.From here it is plain to see that these are false-faced cabinets! They really aren't cabinets at all!! Cheap!!!What about %w1?There is a bell on the counter if you would like some service!There are envelopes in the mailboxes, but you can't get close enough to see them.You have no need of a stamp.You would like to send a letter to Jake, but you aren't sure where he is.You aren't holding a letter!You can't see a postmark from this distance.The sign won't move! The sign says, "EMPLOYEES ONLY" "I'm real sorry, Jerrod. There's still no word. I know how close the two of you were."You reply with a sigh, "Thanks for checking. I hope I hear from Jake someday.""Nothing in your mailbox, Jerrod."You don't have a letter to read.4 z "( ^MhW rw ^MhWe9e:e;0) ) ]Z0000  ]=Ze=+eFeG<D F7z 8FWkeHeIeNZ0eReWZeSeTZDD F7z 8FWkeHeU  """ " eX"eO Re^(((((e_Ae`--Deaje''ecZ'Z'edl'eeeD 0IvEkT&@K.q/gDVu : J s  ^  b  F v >O Ny%U"7Pj1asCurrently, the desk top is open.You must get closer to do that.Currently, the desk top is closed.This is a roll top desk.There is a roll top desk in the living room.Right now you see no bank statement.Lost, for who knows how long, is a statement of your bank account at Brooklyn Bank.You retrieve the crumpled bank statement from between the slats of the roll top desk.You already have your bank statement.Crumpled, slightly faded and wedged between the slats of the roll top is what appears to be a misplaced bank statement.There is a painting on the wall above the desk. There are also a few paintings in the family album on the table.There is a painting on the wall above the desk. There is a photo in the family album on the table.This floor, in fact the entire house, is constructed of the finest lumber available in the New England region.Leonard is your neighbor.This table was handcrafted by your grandpa. Resting on the table is an old family album and a lamp.In the living room there is a desk in the corner and a table in the center of the room.This is the only bedroom in the house. The only thing in the bedroom is a bed.This is the main entryway. The living room is to your right.You never cook, but you can't forget the meals your mother prepared here.For this, you really need to get closer.There is a chair by the desk and one by the table.There's nothing special about these rugs; they just get walked on.If you want to look at the closet, you'll have to get closer.In years past, this closet was bulging with all kinds of useful things.Now, it is a place used to store things you don't need.If you want to look at the kitchen, get in the kitchen!Here is a fine example of your father's craftsmanship. You never took much interest in the family trade.If you want to see the %w2, then you will have to go into the kitchen.As a child, you and Jake slept in the attic.This is your bed.You need to be in the bedroom!This is a brick fireplace.If you want to see the %w2, you will have to go into the living room.This is a beautiful painting of your parents on their wedding day.You sure got your father's nose!Memories, memories, memories... Every time you look at this album, it brings back memories!You already have a family photo from the album!And finally, you see a photo of your entire family together. You remember the excitement of posing together in front of the camera!It is a very, very special photo to you.Here is a painting of your older brother, Jake, when he was just a baby. You often think of Jake, wondering where he is and what he is doing.And just across the page is a painting of you. You must have been about eighteen months old.The album begins with a painting of your father and his best man, Mr. Quail, the bank president, shaking hands after the wedding!You carefully remove the family photo from the album.The family photo that was once here is now carefully placed in your pocket.This is a painting of your parents' wedding. There is a photo in the album on the table.If you want to look at the living room, then you must be in the living room!You cannot look at the bedroom unless you are in the bedroom!If you want to open a door, just walk up to it!All you see is your yard.Not far away, you see Leonard's house!You are not close enough to a window to see very well!You don't need to carry around the entire album.You haven't got time for that!It isn't locked.You have looked in these drawers thousands of times before and have never seen anything interesting.The only paper visible is the bank statement that has been stuck in the roll top desk.It looks like there may be a piece of paper stuck in the desk top.Right now you don't have a bank statement.The closet is already open!The closet will open if you walk up to it.There is a painting hanging on the wall over the desk.There is nothing under the rug but the floor!You open the cabinet, but the shelves are bare!You can't do that unless you are in the kitchen.You see nothing but a dusty floor.There is nothing under the mattress.You need to be in the living room.There is nothing behind the painting but a wall.There is no need to.The counter top is bare.You don't need your coat!You haven't touched one of those boxes in years! Why do it now?The boxes are empty.You can't do that here!Your coat is hanging in the closet.Your coat pockets are as empty as your pants pockets.There is nothing under the album but the table.Be more specific!You are in a closet.The fireplace is empty.There is no reason to go into the attic.The living room is adjacent to the entryway.You never cook.You can't help but remember the help Mr. Quail was during the years after your parent's death. He raised you and your brother, Jake, until you could live on your own.It is an ordinary lamp.You have no need for this lamp.You'll have to leave with the clothes on your back and whatever you can carry in your pockets!4P y;y<y= y>y?y@yAyByCyDyy yy y yyy,y yyy  y1y2y3 y4y5y7y8y9zCw ! ) + / 6 F = !)+/6%Cw#F!)+/6C%Ow#F!)+/6C%[w#F!)+/6C%gw#F!)+/6C%sw#F!)+/6C%w#F!)+/6 %#Fw k$ % % "% (% 8% /&% y% % % ##  Q' z\ Qw OwOw$ [w[w$ gwgw$ swsw$ ww$ $z'2 4xioimlr ( %% s;gyy %"7%9**+-) 01 \ .%g69GR4^Y   wq ܿ 4W~98X4oM  wq z{zH!)+/%#FL!)+/%o6#FL!)+/%:L   G /F /FFxGF/ `g Gi vhW  G`{h "@[ h    m   [  Q          J         p   f     v  >      k        L      o    A  '  a  #]I &  #IG F//<I /< h//A;0;] 5 O " $ !BDFHJLNPRTVXZ\^`bdfhjlnprtvxWhat was James Wilson Marshall's occupation? %m173 2, %m174 first paragraph.Which route to California did some consider to be the most difficult, and popular? %m173 3, %m174 third paragraph.If someone experienced the excitement and lure of the California gold, they claimed to have seen one of these. %m173 8, %m174 second paragraph.Give the first name of a prominent journalist for the New York Tribune. %m173 9, %m174 second paragraph.No matter which route was taken to the land of gold, this disease was a deadly threat. %m173 10, %m174 fifth paragraph.On the way to riches was the first time many travelers tasted one of these. They were advised to eat only the core. %m173 11, %m174 last paragraph.What is one type of lizard wildlife you might see in the Panamanian jungle? %m173 13, %m174 last paragraph.What is the last name of the Mexican governor ruling the territory of California when Sutter arrived? %m173 15, %m174 fifth paragraph.This type of shop assisted Sutter and Marshall in ascertaining whether the gold they found was real. %m173 16, %m174 fifth paragraph.By the end of 1849, this settlement had a population of 12,000 people. %m173 18, %m174 second paragraph.At the beginning of the gold rush, Coloma had none of this. %m173 23, %m174 first paragraph.The citizens of Dry Diggins changed the cities name to this. %m173 25, %m174 last paragraph.Give the last name of a man that made his fortune in the gold country working on wheelbarrows and then returned to Indiana. %m173 27, %m174 sixth paragraph.Give the nickname given to the mailman named Thompson. %m173 27, %m174 last paragraph.The nickname of a bandit called Dick was this. %m173 31, %m174 last paragraph.What is the last name of a well known writer that spent time in Angels Camp during the 1860's? %m173 41, %m174 last paragraph.Bennager was his first name, but what was the last name of the storekeeper that made a spectacular discovery in Angels Camp? %m173 41, %m174 second paragraph.Black Bart spent some time in one of these. %m173 46, %m174 third paragraph.This Hill was the county seat of Calaveras County prior to that honor being given to San Andreas. %m173 48, %m174 first paragraph.What was the last name of the man responsible for starting one of the most famous mines in America? %m173 53, %m174 second paragraph.On selected afternoons, one of these, accompanied by a bull, provided some rather distasteful entertainment. %m173 63, %m174 second paragraph.This building in Columbia was saved by the efforts of the towns children. %m173 68, %m174 first paragraph.A steady diet of salty provisions sometimes caused this disease. %m173 62, %m174 last paragraph.What is the last name of an early frontiersman who resigned from the army in 1847 and settled in the San Fransisco bay area? %m173 70, %m174 last paragraph.This present day National Park was once an indian stronghold. %m173 72, %m174 third paragraph.Give the last name of an investor in hardrock mining that reportedly made $50,000 a month from his mining interest. %m173 56, %m174 last paragraph.These diggins comprised the biggest hydraulic mine in the world. %m173 76, %m174 fourth paragraph.Sutter Creek is the location of the only water-powered one of these in the United States. %m173 58, %m174 second paragraph.Herbert Hoover, who spent some time in Nevada City, earned his degree at this university. %m173 79, %m174 second paragraph."Hey city slicker! Any varmit that tries to cross my claim better be ready to pay the consequences! But I reckon I can let ya pass on by if ya can answer a simple question from yer miner's manual, "California Gold". Otherwise, I'll string ya up quicker than you can say Winnemucca, Nevada!"ABCDEFGHIJKLMNOPQRSTUVWXYZ Gotcha!!Here's a hint for ya! On pagetry readin' theascii value: %v238Congrats partner! Have fun now! I hope ya strike it rich! Press return to continue!4  wq z{zH!)+/%#FL!)+/%o6#FL!)+/%:L   G /F /FFxGF/ `g Gi vhW  G`{h "@[ h    >        !  "^k  #  $  %3  &  '/  (  )F  *  +  ,  -|  .  /  0   1  2&  3  4@  5  6  7r  86  #]I &  #IG F//<I /< hbJ$CA&  !  J a    "$&(1P`sMany miners rushed for gold in 1848. Almost all of these miners came from where? %m173 2, %m174 sixth paragraph.Travelers taking the route across the Isthmus of Panama disembarked at the mouth of this river. %m173 13, %m174 second paragraph.State the last name of the man who received a land grant from the Mexican government. %m173 15, %m174 fifth paragraph.John Sutter contracted James Wilson Marshall to build him one of these. %m173 16, %m174 second paragraph.What was the most prominent theater in Sacramento? %m173 20, %m174 fourth paragraph.The statue of James Wilson Marshall which now stands in Coloma is made of what kind of metal? %m173 24, %m174 first paragraph.Placerville boomed first as a result of the discovery of gold, and secondly after the discovery of this precious metal. %m173 28, %m174 first paragraph.The "Gold Bug Mine" is located in this mining community. %m173 28, %m174 last paragraph.State the first name of the founder of the mining camp which would eventually become the city of Auburn. %m173 29, %m174 fourth paragraph.Auburn, California was named by miners from a city also named Auburn in a different state. What state were they from? %m173 29, %m174 sixth paragraph.State the last name of the miner who extracted $40,000 out of a gopher hole. %m173 30, %m174 first paragraph.A typical miner just might bake some of these for breakfast. %m173 30, %m174 last paragraph.Of course Georgetown was named after George, but what was George's last name? %m173 33, %m174 fifth paragraph.The "Shannon Knox House" is the oldest building in Georgetown. It was built from materials transported around Cape Horn. What kind of material was it? %m173 33, %m174 last paragraph.Granite City later came to be known as this city. %m173 34, %m174 third paragraph.In the town of "Pilot Hill", Alonzo Bayley heard the railroad was coming through so he built one of these. %m173 34, %m174 fifth paragraph.The first wave of argonauts didn't start digging in Coloma until what month of 1848. %m173 34, %m174 sixth paragraph.California's first public library was established in this town. %m173 36, %m174 fourth paragraph.The County Jail in this town was made of logs so small that a man could cut his way out in an hour or two using only his jack knife. %m173 36, %m174 last paragraph.What was the real last name of the man who hid behind the guise of "Black Bart". %m173 38, %m174 seventh paragraph.Placerville, and many other towns, were destroyed by this. %m173 28, %m174 fourth paragraph.Phillip walked to California from New York and sold meat to the miners. What was his last name? %m173 27, %m174 fifth paragraph.Coloma is next to this river. %m173 24, %m174 last paragraph.State the last name of the man that gave Sacramento its name. %m173 17, %m174 eighth paragraph.Who helped Sutter build his fort. %m173 15, %m174 last paragraph.This mine, located in Amador City, was one of the richest in California. %m173 60, %m174 fourth paragraph.State the last name of the president in office at the time of the gold rush. %m173 2, %m174 last paragraph."Hey city slicker! Any varmit that tries to cross my claim better be ready to pay the consequences! But I reckon I can let ya pass on by if ya can answer a simple question from yer miner's manual, "California Gold". Otherwise, I'll string ya up quicker than you can say Winnemucca, Nevada!"ABCDEFGHIJKLMNOPQRSTUVWXYZ Gotcha!!Here's a hint for ya! On pagetry readin' theascii value: %v238Congrats partner! Have fun now! I hope ya strike it rich! Press return to continue!4m  wq z{zH!)+/%#FL!)+/%o6#FL!)+/%:L   G /F /FFxGF/ `g Gi vhW  G`{h "@[ h     9'  :/  ;  <k  =k  >  ?  @  Ao  B  C  D  E  F  G  H  I  J  K  L  M  Nc  Ob  P  Q  R  S  T  U  V  W  #]I &  #IG F//<I /< {hX@(W8CDn H P  x{{ [What is the first word in the name of the oldest building in Murphys today? %m173 39, %m174 second paragraph.What was the last name of the bartender at the Angels Hotel that told a tale to Mark Twain? %m173 41, %m174 last paragraph.What kind of mining replaced the earlier sluicing in Angels Camp? %m173 42, %m174 last paragraph.What was the last name of one of the Mexicans who fell victim to discrimination in San Andreas? %m173 44, %m174 last paragraph.In 1851 a Frenchman named Banque built the first ________ store. (fill in the blank) %m173 46, %m174 first paragraph.Name the state that both William A. Sampson, and Robert Bradshaw were from. %m173 47, %m174 third paragraph.Bayard was his first name, give the last name of this correspondent for the New York Tribune that wandered the mining camps during 1849. %m173 48, %m174 last paragraph.Name the man that was robbed by a Mexican named Carlos. Carlos was later hung for his crime. %m173 49, %m174 fourth paragraph.Finish this line from a popular ditty in the gold fields: "Was it Thompson, or Johnson or _________?" %m173 49, %m174 last paragraph.What kind of "mule fuel" sold for a dollar a quart? %m173 50, %m174 third paragraph.George Leger came to Mokelumne Hill in 1851. Where did he come from? %m173 51, %m174 first paragraph.A tailing wheel 68 feet in diameter was built in 1912 to take tailings from this mine, and dump it into a dam behind Jackson. %m173 54, %m174 first paragraph.Leland Stanford made a fortune in a mining venture when he sold his interest in this mine. %m173 55, %m174 last paragraph.Mr. Mills owned one of the four banks in Columbia during its heyday. What was his first name? %m173 66, %m174 third paragraph.Where was the fire engine that the town of Columbia purchased originally destined for? %m173 66, %m174 last paragraph.Some Chinese miners planted a number of trees in the city of Columbia which are called the "Trees of Heaven". What kind of trees are these? %m173 67, %m174 fifth paragraph.What was the name of the French chef who cooked a cat so well that no one could tell it from rabbit? %m173 68, %m174 fifth paragraph.What does the name Mariposa mean in Spanish? %m173 69, %m174 first paragraph.What building remains from old Coarsegold and bears the date 1852 on its cornerstone? %m173 68, %m174 last paragraph.What is the last name of the man who established a log trading post on the south fork of the Merced River? %m173 69, %m174 third paragraph.Give the last name of the man who imported the first stamp mill machinery to Mariposa. %m173 71, %m174 fifth paragraph.Where did Madame Eleanor Dumont die? %m173 79, %m174 last paragraph.Give the last name of the person for whom Red Castle was built in 1859. %m173 81, %m174 fourth paragraph.What type of architecture was found on Nabob Hill in Nevada City? %m173 81, %m174 fifth paragraph.A woman whos last name was Green became one of the richest women in the world as owner of Central Eureka. What was her first name? %m173 56, %m174 fourth paragraph.Where did Lola Montez go when she left Grass Valley? %m173 85, %m174 second paragraph.Name one of the oldest and richest gold mines in California, which is also one of the deepest in the world? %m173 85, %m174 fifth paragraph.What were an estimated 12,000 Californians doing in 1852? %m173 86, %m174 first paragraph.What is the last name of the man who took a work crew of 100 Indians and 50 Hawaiian servants with him when he went to find gold? %m173 55, %m174 first paragraph.What type of mining requires drilling, blasting, and stamping? %m173 56, %m174 second paragraph.In the city of Sutter Creek, on what street is the home of R.C. Downs, superintendent of Leland Stanford's mine, located? %m173 57, %m174 last paragraph."Hey city slicker! Any varmit that tries to cross my claim better be ready to pay the consequences! But I reckon I can let ya pass on by if ya can answer a simple question from yer miner's manual, "California Gold". Otherwise, I'll string ya up quicker than you can say Winnemucca, Nevada!"ABCDEFGHIJKLMNOPQRSTUVWXYZ Gotcha!!Here's a hint for ya! On pagetry readin' theascii value: %v238Congrats partner! Have fun now! I hope ya strike it rich! Press return to continue!4_c  wq!    )ާާ }_ani.cycle.counter.2 = %v222fastest = %v167fast = %v1654b!)+-/=%'#!)+-/%zM6F!)+-/%r6F!)+-%dC!)+-/C%r6 !)+-/%i6 !)+-/%is6 ! ) + - / % iS6 ! ) + - / % i36 !)+/%oFw  Q'   (  ( +# ( z $$z ##g(hc gz g g  g g   g g  gg  gg  gg/ /ffgg/ // /hhii/ /) +/LI /  = LI /I  /  +/LI    /LI * #QQ)+/I+/GL    :#I#I# I # I  2 zizisziSzi3$$$ $ #Iz z#$$$bV  (   (   (   ( 0  Q7 Q Q $< >Ld| $<TkJerrod WilsonA young, ambitious cityslicker born and raisedin urban America. Quitefrankly, he's perfectlyprim and proper, caughtin the trap of nine tofive. Is this all lifehas to offer? There hasto be more! This man isready for action! As ofthis moment, no longerwill he accept only... 4bcz zzGgz zz #QzGgz zz #QzGgz #Q!)+/6%Gg#Lw  4`[bcz #Q!)+/F6%Gg#!)+-6=% !)+-6%+(! ) + - / % #QF !)+-=% F#w  Q%F Q*K +/I +G# +/I  K +G* #Q02% +/I   K  +G  +/II c   )+QPKG f " !/6F#!)+-6%P4#Qh4!)+-/C%B#L!)+-/C%V?6#L !#')6 $ #+(+ F$++Qj4G Qv( F+/I2/F K  I2  L +LG.%6  ( +/LQ% Q_n $"!/6F#!)+-/6 %#LI! ) + - / 6 % l# L I ! ) + - / 6 % Q# L I 6 "!/6F#!)+/-%K8#LQ'  ( ++I  ( ).GQ4  Z%BT+/ ![6 QP! ""!/6F# 4{b!)+/6 FCX%Gg#!),6%%!)+6 %5gcw /2//2//S L>, %3%6%%%,%;#(/#$ $ $ $ $ $   QG  $!)+-/6 %Og#I 9  "!)+6 %5g!)+-/6%<#I 2#   )8GQ'  Q  +/< 4to jg0iShhj|ijY^ `/c@cKb`cyca`[_ab'c(egefh jnhg&rkJ<*ŵ N>L. Y ]#$&Kr41%=A9C%A&: 4*vpicTL=|ifh$qrsg fZ WZ UNOVZ ))f+d)c)`)`*_,R(M$T&`)`'a"'f'((d(f$T`**T)`((a(P'U(^'_(_ &Y(W+T*[(eW(L  S TWY%Y2ZPY___]5]$U XY `a_5 0 - !   $.+,+6<E_ $  .O  " #*#>1,# ;R +T9a d)!əeb UP OXl Y^ `  `Z`)!] [ T _` aP'#&   %̺ʺaABC3D44$(預(%N,,F=91-) # (/3I)"Issttssttuw x#xHMMsz x w }}|yvqr)t4u;tIrs#t+v1w.w4u vy| |wHjY:mWtTyST}VzZ~X~\|^xauarfnjveyfvj|h~j|onif`hlpmgiejgakxJ;!J,Cy|wuvx|{vqsvqbSO9B=a@l@t t w" t1x!|!M#&!>? ?OOb' yBy)z&}C}'~%D($#D($#DPDP`(c:dBeHdcerdbcg'e5g?hWgeipi}ghigmigi kp]`&#09@GM5=@.) Z[ Z&[G\WZ_`30 NQ P]dN c nsv" Rt1*XjRp:")(7d6j5mmjs{~U!-]9 1]!4]+ 7Yphpc`VTu y } zB~C !-ED($#D($#C'%$|B|'{%| x!     }#{Gy}  C3C133z3 8C ?:r! Fq :j @eMu6z10; 852//,)&#6 B9:NFN190:Y<4I HF{>_IZHW@YLd!E_)Ce QPWU!X9RUa_kql YVduN)kTqwlztyu_ponka\max)1 -5 5; )1 -4ED)o~}ZMQyd+}yJJGGDA>;852/,)&##$| yvt  # !y$JyGFyDC-*)++ C,*)+){A{-z+z.B,~+~,+ < <9<<<=?BA> gC*1),Jz;9* *"1+9!"%< <:1. +9*sK;"< P9J;, :;Ih09;)55* w ";w fhjlmnr~| }!*1)zUK j aouvy z;T;,<,>!:6"9,:-:T7"`9/0;+<#:!:,;#=#7# :%<(6ŷ/,+%)''8'A(L*Q5Ŷ.+*)*-))&$ "$#/#7!M*  % 6 A Cgou|       !$&&*.?EYhovx 2"   9T%OMMOPTT#U"X'U'X+Z2X6Z9[;UZ::B_^ a&a*f%f"j'h-g+l-p0n2o*,*~(''# `;V"%<)P,-./0 1 2 345 yI#2) iLMSSTZX W^ NSL=<:99  99<>NNCCH9 D9A? ELLD9C# OEXC)BCUYZ " ++&- ;7$#)"CQ"),6& - 9: ; 2f-V /`)g2q" ":D??BLP ?: III1 )I*"9IAMxoxk207;@0 wt11"1)191<1s1z1117 =:.8B9|5F1 +3Ro} w x &+  P Q v^|ljz]v^~^jkj_]~^?FEGC MQ!Wa[]%#^S^_`\\S{dcaINjOQj:1@+-1 :%b`AQ*Ѣɲ92Id2t{R+:BKњ[ JyK-+6OTFc~U_| |Wvahr6 $! ?-7>:@C$ lJC}>:B>)jnwxe dhhkl>!DG " %.08Ywccf c hnl3*s+iylf'_Y2Z0T)U#QSO6T?EDFBF   ; <PU SMS)Z]X \PWL[RbOkEpAs=pHlO|J@@ )%* $ (/k5_.[ ]WXztq)~|qXOHJNt[nVvSba:*ea"cg*!)dn)ho "fz)14prk)3Ip)lalkscqd7og$mj9;<hXj]ncq}rs v5J&N]qQkLkGj@;60+"-+ " < Q f k m p ux Z d louw)$*%'s #uv+u0v5v@tHxE 93ej`kh):'gfxdmb`cejx*m{k"2mrkmjUlSVsw xt]p#(+Q Tqv ,;/YOAZ0Yn9< DM5N-MOTH] ZabqhFVnHi:t Jd:cYV[U9uTQWLNM?Q=\7wiZHy:&~"){l193 s!9aT!_N102v`[`] VXU l*1so_Q 1bW9`Kz}9}{wx (669))*+8*5F1A<"<(<9<<t5~4`:`I[:[IV:VIQ:QIL:LIG:GIB:BI=:=I8:8I3:3I.:.I):)I:I:I < e6mQtQuPwQxVy[y]tOt_qOq_mOm_kLkXiFiQg?gJyhtY ymy[pmp[u[umy]p]p]sisvvsvy}y}}D!D(D;D;EBKBL,B,P1B1P6B6P8O8`5W5j2_2u/h/+r+'}'##T=T&IdIlmr`u`xloyymmrbox owwl4$'0132@@AB,* &'*+ -- ,*("'>(C'V(]%[ ZY!D"# "#! "$$ &) +)  ! ΛFI5I%I'J'H'I$(?.7/=.@)J FБFFVѺ ) ;!*Z@: + SI2R SX 2a"=131Iɤ$5< 1$  .B''/6/.7    E 8  . G)D*y!9h>SF:E>;;770P6)NKU Z S GS)F,y,<`F<P !%RUV(/ 0*0" 6 6 7 7 ; ;80*I,? C 5 * "H8#|1: .0.&...G:CC9n  6636T I(.4%9:=?BD>**IR39Q"XB%__b ecIBED(a9\^?H5=2612aBCD9a/7S@"ʱ>55=60 ¡0'Q84 32+7Ap5g(' *% 4*%J8.?.@"AB) ('!3T<7#5#6.0!#3-202 t*AInn:abj qfe``beod i aQIa`e mlq k\&p2FD84+6%  !":cx24Z0(7(oam`hSdI_@[9X4J4H4X4 Y1`9d?gEFkKoTuSxT}[a~b}aV4[AcZm9Qia)!P)iag9a1i1iaiaiaYiaY[gGe^i )dEa=Z4v[udQiNcB^DX6Y3jlzq|qZfHaK_<\>^NVPSOJRISMUEWFY@X\GẹjAZc_X^O]M^Q_UaWdTfMeIgMhEkI9J8IQ5!1j_)VᲣ2BY1Z`g]WXET5M6I< m6ljif i j[5^_(_3b0a-`acd`^]`_"{T"%1erkm|TYe)Xh pұ «p #iɓ*Z1Jb.)]41Jg1)b;)g:):gAi9v>jKٱZ^ bjr `._ n%kjq%oqpon k au "jHjwCJL@RQI#Ԓ!2ّ}u,*I2Bix~Jy9p>i=g0c2]2d<5l4)g4d8!d5g.!0 j k#i#i +qu|u,~,~.u/ ,A)yrk!w.-!++""+kj$ ~+~}!u!{k3g6j.c8b7! +@+++'y(k$kl* /k1_6`8a9d9d7mDQ~i^~[}Z|X{V,&)i&"%&'&*(i)=/A/H/J/\/S1F1=0 2 8:>=<C&\b$i^aisp %$i$%fMiVjWk]hGmOnS|v_Nd^?X;j1!)2.C/82CBchs{y;C  rbvp'N.RU`_^]or9"3 q#esuxz}`^[YV6;<=h_+uurWyzn|ld; > A 8&<&my42t;?BdnzrZ89;=?xwFMU]em[\TUMNFG?@blh5  -     uwIA}aљACEET #P$B$K$1E"yvRR SRIJ1d[;2cV1*dRJjT *^E!]A!lTcA`=$+N;e=Z>V{!w!W7Y6Z150`*`$`PXX :VPQ$UDfa U"N"G"A9:501?6<5313<000:{xuqbrlvwikI"2*lv:BA;qgwtqZo\#gg1J;2`L::Z<[>1_;qq* uҤ39w$;;13;1"Z,5 J"L1;!J+4Q,Q)9R+2 {PA%| hJQd*?,<IsXs\nVmYpV3300-9m?OAJ@HBED@_=]:,348BKLSSw}rl&&$%9&H%W&["6#I!X Y#'"$#;:%)6D8=pq-r@(:](5K(0[)*9)%9* 0+-))( AA <<77 772`-(`#`  P  PP@0#P(-P20)0a`0e`0i`0m`0q`0u`0y`mPqPuPyPksyrxqvjuiscyZz[z\wXvWUV^_[gjkoPkP-**''$$!! 3 3 0 0 - - * * ' ' $ $ ! !    R^>gOa[\b[TRB[NYODVEYBH|FHpQy5v<785V]t~u.G8K:A=;26"r.v)k\Ce^Rj~cxh=5x?,0~1y1X[E:BF CGI6 9;]b jx| w =phy^%c0O(v=5A9Fx91[mA=l!DLIC>)&!T:U:M9FCGCWJXJv*;:43)2,kikrjr%%|} wpWqXmZm[F=AM;j8c^^hh j q rxwxpl{_xYvWn`m`dI]<v v vXpky`z_4¹ɑБЩᑚɑɱ٠ P N M J H;9 1;<I J MMN P ; <9 = H I N P I H 8 L U O = G G G H H > D @A 0 wPNMJH;91;<;1?9@G?g@vAx>z)>*=)+*$+('(%!%'#,#7"8$8%7%,$(%#('+ .0/1:0C1R0T3U5Q7T6M5B654$5(#+ .012 0243. ";,:6. !&/ 5()* + ,-2- 12 36Q919! gMFD;66K?CO)A) obULD>-D:698KI#C3&"64$:&C(L+a.w0/36#$8T@lGJOSW[^_HtElBc@]6G6+:",g/0(L*Z$;6,)9$09(%)5,( - ' 0 3!#J&5+4*  #!.+," &+$"/#*,. /3+(& 1$-#*())8)&& ", "!)  *!"&!$% %"!& (F96s1Z/P,G)@&:"6+Z1))L9-gY19P%;(@/>Gust21!:NY*4+44`&4444466,=H,PR o0mCl9Q+=xx&= `Q  4u|ɱrvСsyw~йgQi1 oxm}g~ Y|drkqqr}z~.b*H/@aLIG@=88QF$9%:-=ivq{lv +hёҹ/ɲѺ)[ЪNI@!Y9%B# '555555`: H4g7z9:.L1ZNQYl 9;?4eY2Za.K*A ';%8&8?6j6Y0M'6@n89*@ ,C6`':&9G@<C YTɢ1!YT#2[d}~    y(y>o?z?zCoCo@v@ozzoop +) "_=_I_9wAL"0H'H=K'K@I;"y1y?z?zCrCx?x(x>q>Z#a#U' Z 0#YXqrY'`'a%K :H T(T9T>TI_(_4^4^Ix ^5^(I'I:J;Ix4x>w>rJPuLJJ$J>]%T%w6]vw:J1J Zst0F FFF?MIM>N7P7PIQIQ6S3OM+MI rDz0.:*&"2INWZyi#b+=|;P/IP a)f&g#PNqP|LL1 {a/bBS7SBNB  [tu$r@[5U/UCKF Qbyqprongh_bWfOЙgUiZЙh\g`W70bn?8&/4 73)7$.&.#CA+@#id%%E,AD"A  D?@-%#!Is+[)132@A^1+\AJʚE:vrQ<:1:<=JjUHa"YK1Nə*9B/=78@4:E3A41Т6AA+-406,:I 48RSj^}ozrYqRgQTGL9GD6@093+6/;ofao ,-/hVQqCVnFC00A9B39?d0>.7xsJIiV8(.( eN_NXNfRББfT`TgXБcZPaZ"+B*. >//6(D&EB>#&ehc])6%8/> A C!'*,QI O1MA@ ///@/P/0/`&/*/022222'2,2=NPO:@ 1 R2d!pK:I :::kI9)I9YTUU RK)L~xha Y[nML KC. ...& ( *!#!'"&&),*&"'$)".$01564 6>E) !!%%))--115599>>BBFFKKOOSSWW[[__ccggllppttxx|| {hhfwfw{w{b|bzZzWz[xbybyvzwz]ya{aza ~f~wfwfwfwfwfw dwdbebc[cWc[abbbbvcwc]bbdaahMh_f_w[f[wWfWwSfSwOfOw`s`^a^_V_S_W]^^^^r_s_Y^]`]aeakalad usu^v^tWtStWr^s^srtstYs]u]wdwtve"rm rcLhHhATHfHwLfLwF_FrD[DmBUBe@`@W9D9A9N7>7K08'3*20/6/?-5+4&1,1p pQ>:4ɰnn:HALIVTb _ p2B2>6K6322246=>?2:9C.C:@/@<878@.//1,8-7-./:gFgSd>L=[>p?w@x;wNXY/ M9!qE~EE0@;@6@1@,,~1~6~;~@QEPEQ@P@Q;P;Q6S1S,S'`,L LLLLGGG(G,G0G4G8G= 8i$xr1T0"P!M"hA*&@+ e1'_\!C$GKi)!4* aMaz2oLnOlRhOhRhLnMnNlKlJlPlQmGE G46gc_[WTQiqrP<=ijp} K[I]JmQdGIBNBDE=@?XawTKS<57gD!  # !  # &$#%$K{wTW$Z\]bZm]jmV#.lZXgY`WeXlUeS`R]RXTZYcZeXdmYlVp_qZvjxlxmvnvmkXkYk^k\k`yrtrpjbh\fM^J^2T2TMXN[b`q`tfGGDy:y7x;vCv?f8U3U0T1R6R/D*>?U u qrar]JUJkekreref4`¹ɑБЩᑚɑɱ٠ VkVwVa(,4<=KUcoqxzxwoP8-%  $ #,( ;+ʳ  ,< ,  Sb`YbYjXjWh PNMJH:91;<9.- 08808H*A3752 8"8"9'9)8=8H*7$# 9 9 "   # & * . 2 6 +6% ; kkj<:;:j9k7k7<<kkj;);)k+k,j,=?:?_>a>< g\ V*`-T6T;S @SPF1FSF1FT9l l sFUlz%zl)l)rHk/ CZ?b?h ;<<););,=7<1>< >=*>9>NL*J8G ZZbddf)l?b000GX*"Gl,+!:"9!))+ @" yɡ : +) t)1*9v3uK^#b&q<^BW2`go1o(sBhDbEY[`beWA_A_Ica_^]!_/^@^JʢX@W"UTSTVUWXZXYb` ^\ ]\ ]\ZXSONOQ S [Z \ # ' * 0 < R T UTVRNG@.& !'   ]JZN[:a bZZZTOPR S] TM !&3*#9)C Z1:" 3.+I>[_*&, `[WVRQdaKG^[\WR WBZDpuw+w6v>x?z?{-yz{y wts oEz/uts w+u u qs#s8t9u8tt&566%t2ts$%*"rvnrlp v GLWL_LpLqYkYiWaY`[YZT[R]QZOY;R,ELslim`n]pXtZu[vWxV{X|^}`f~vslL0 LLL L0"T [f}}xLqqLd`Zdrd {5Ld dd~'I1I9 kk4L-L(LskWkUkJkqZrc${GX*"vxLL^Rcv y^YoQs}h]`]ZV S/O>=QDPMRiz!ORWk maaam]ZV S/O/}Xv9Q|j9v6v4v8;;6r4`4W4G4E4|444@>)7)<18C44 WKFCN+B)?B|66}?+: 5"KPW4DHQA{@7%L^E7q}ɑйɩЙɡѹٙɱ@Iaw)1)01Eq{>|Av7K??}9DJIKGAO#-BU]lvZH~E}CJ67A;9;=@ @?%B1@N=g=v5~555Nhg1{BD*)(&&{|}%~&~(})~*~E~ ~ $~)~`/r/V/G//v/|/}//`/P/0/ ROP)LL1?)2112}1v2q2S2D31NMN

d51>&>BBFFKKOOSSWW[[__ccggllppttxx||pp^]lnnf|`v[pN>;8=NATHZ9C7F4I8:113AC23@4A5C0}00P000 r0p/r/v0}//////////2լ |4|?|22`1A1;19m4 a4 U4 H4 4 00!H0J0B09a0c0B 9r pp*p6p6ri=kd9& d91&-cQ)&=bAT@T_c;^';c;f=S>R EGDOENDVEV %E7'E#E(P#I(T#M7$T;E;Is=tB}pvvm8q9o6=AYIpPI¹Y1&01|AI"{Lg1]eQnjIwd9wY{HmGAHG gj9!4H)HI! JE >$.VvuszZsalejfdjm5H6Q:T=U;IeNOEAC @kAm=q?vJmRp]mR^l?!b`YzTO}vy~uPhJ mICT@bDlD4C&A@DBB?V78X]paNbow~cM`ZU}7w+u uCt;@By{{ !m n CkBo?m?r=v8u+wxvy xMZI_IcK)$I<,4":2:D 42,tx L"1 "-! "9]enuv yz ~  }|ys} | { ~%afax^g bg0egepdp`p]p]h_kcm [@i[`ZcllZlcllnbb^l_ 5}=}=9{99<55~8 `5#% _ W U :,  +BUZ`! `UD   !;A = 13 1 9! Aˢ &  V) U)!#T *1#/T<42MT ”_V 93oU *)3P*13TɒTUsUdWLT8U$UVTS"R4SJRcTqRQPH:6;IJ:yGx;v6t;sIwJv:[HZ:X6V;UIYJX:=H<::68;7I;J::H:6;IJ:H:F9FWEuEFJ* I91IAJ)i1@I!9w=Y<;>@MC A?>89<8i HD B7==;P6?3P6Q5S=7(&#"(1'7<%=(2.9/=(@/$4164596;5;6B7;4$3$)%,1+7:%:&1(152/"52@>4'*2'3%4"5 661:/;-<+95 $, 1+ 42 92 $4Q5S==4;%7?/$:aR=>D2HID>2D+7G=7%*'*)*+)-)/)%/'/)/+/-/<3 <05171//4) 9& E C?=97+.$N6P>J7L?E8GA>9@D3=5G,>.H%@D @?"<-:39C3G3K4(5-616666$/.2384:3>13*0 0#0@0000<;j;4H86 %K9KI©tJVKɱ6JJKJ0&%~C5j) 2;;;Y;w;;v}+* : *xwek԰yomoS^qPdWlo\oToJc022 wQT?a5a.a dgjnnjNwlW0 VaiRi1b!ʣbxvbv`vSvPxMzP}PRWZX\`b_YX[dmn*jJ}hP@Rb*XYIlmБ`;32:c c}}yY}JddjihmYgY]YxkkZXmfxv UkJb]SRvRmRQSES;S.S&SSS TU vvL{4' ksl=8 \nmc kcV VWZbv~jdVe lUJcc0g(i!knptwz|#}/|:zBwGsJoIkFi@g9f1gr!a%w,w5v>sBpCmBl q2"2J1)!:1**9 .pu$v,v5u;s>rBmI II"J/J>IDILIOJaIjIpI|IHHJIovsoEr|zv) $9=%$iwP _"2F.Qcqx-8$'5A\` dq`q 4NMwMcrjhiCNP`rhp,l &r*,,$9+"2*1!r*9q5sUze~ozciYsl}n~i\_ZV\g\[ch"aG)G\,{ -Z&UEWRbfZve_e@%* kl[RlCcRWsMj @{hM=c(70AA\ hjRSA   0 zpo'f 6c I\WQjNnLPM>M,PN RLLLQ!"P#4O2KM#aO!rO"P"#)#tw{!i!s tI~ zq!pstqlsZu\a^Wk%* 70>I CBCA F!@$>)>.<0=4<E7H6C5@6$-(*%XZ^bil mpnn Sz 5n 0p gxac[{J %q +s 3t ?p ?l,n 9l1l .s)p=Y=w==;=706:70j]0j_m_ja0] _ax0x:zwp$#{,y ~    WzyurpoWi[n`te{jpv}}xuponm~<<:Itzwr`_qqqllggbvv}}~xsrJ HP 7F09 UFP sF@* EJIIW) TP*T10)/TRYET!i^TQ+nT!@T1@)TTil`]xex5=k _29@l+l'm$n!p r#u(v.v8t>rApBmAm_1gtvwwvwyyz{^sq{v?7 ?3Q6Q8C8?7v}} 4  6KJ KJKJKJ%K(K. #$/ )H)b&kkqqkT T LLGLTTK!K!T&T'LLpG,! 0&i&U#+PO"O!  L __K_ _  )+TK-"&T&L)* :XY_([(Z rro o p rroor&r'o+o,r6r7o:n;q:u9uus UUON V ^V^ ZZ#-+/5/T.X,1&.5-0.4/"3808-X-70UdU}=q4,V} s{)%x~{ld 0pgrzfT"jTlcfS SS CS6SfT16A,4R3277*o+o:n/|0!0  /%/&0.0/2627wxwx##&&(v(uvnjiY//.&1707yu1}0-},  |~xu..-,/x/u xt xt6v6w33// S0O0K SO"S $O.:.6.2-3-.PQ $L  0 :ANIdImA U]]hs={ Lr0 UsK[)2h1=]/\)'l r\^ibX\W3X*[$n/n0mfQ@Q5Q'ooo o ormxhezzJKBQSQ9; =v 5 HQIHI H&IE DEC(D@ ?@?#?(@);#<;;< 6a76$7)6*0%1121 2 ,-,#++,,%%&' ( $-!.91 IAPPP--=+LZIQR345%&~amam\|\|X{UzQm\lYyMxIvEtCkVjRq@o>l[AbR_SYDWGULTPXSv@p8m7g5b5_6[8X;SCSDODOREREDADBB0BBCxCBCb|hqh01u2n2j.f*a)])X,T0Q6N>NAM>O5S.X)]'b'h*k/Q1E1D3:333CCCA;A;=F88?w@L=D=D>:@0@N8AJP6u>{4`4>{>4i3==>3`3==3P2<=O3D=D3J3J;E;:5350656>1>AEAQAAA??$?*??+?%???== ? BC= B B@>;; ==-?-B,C+<, B-B>@?>?<>;=;-=?A1A8A=AAA A1D6DC>MDMDMCL[Ef=g?p^SL[?e9p=|QSQ|czf][\Z[PWWVVf6 101010100/_'_&_%W' + + + + + ! ! ! ! ! S) Z [ ]OAT*Z T'S(\ V)""""",,,,,**********   22 2 9BABAg5g4W7 _  < < 2 4  ` bW93==35;;;^W6V7a`Y7f4Z$1;rrk(k(c(iiV-V-X.X0TETERCRCNN@C@D=N=OAvAw@??MNRNRROROTfTCG;GGFRNRNSFSt!W!hhWWhhWWh h WWh4 Q?ƓLMK^J`JfD+FHGOFbP=GCF9E)G9J)G@;HJ:HsEVH9LC;?u;pHSJEKHI7B ;@u= = xHH{O[M:=;Bu:u>{kj"h(y'{}&(y..(.{|&,4j)j4k,x+x4x*z//|'/{1@o*{/{" n!}+k*m*o*q- s- u- w- k/m/o/q/s/u/w/{2 }2 3 y({' i422n^qV`a]_fi9hAiCjIk1!2wTQC#RY1|x`IYYS^\ebhfjem[oXvvzammapJSL&dg\_XKwMHIJaVgJbJ[J!, "%3 "$?GJLMM L/' #ѹF>-48 9 &&ii7e'w2j2^+d+q{ 7XՐtz ))d&g&C&/&ItxM3 ;1^1k,p,o1j5Y2\2<4;4Y4*42'2{ hE-[-=+\Pxx zwN&g g E # $&985 0 * #    77 " 2 '&-&,/+""! "%")1"4:5  1u/k53'Loy!d!h!j#'l 'g'B'e   !(/49 @  @ 0 ! 0( 0/ 4 6*)%('2""!+0/& !$+Y4n/f4a/]/W3U5S5)#\$lyqR 72,% $h3) " ',3  1 4 3k3s!\@!N@Zl1F1S .   & . !+4 %6|$>3F<F|H9@zE^Rp3`5`7809:@<@}> q 674489BC; P6]:_"!VVT\] a+ @$N%)WT;Y<[9^-b0\!YTX V?<? E?=@>=>!@&C%E'G$J&OSQTQOU?IU^v@gP{O|C};w?s6w>kUsZ|Kubfkk[dZ R]%T \2]*X#_c `\Z[ YZ?P>X6[-R3U.=#?)= :C?CIKBBEO ]=_:`9_4 3> L3"%:CJ ,5B ,$"0#8$B!, "$.',,+:/'0-1;.'1#4058l8l8n'   BwBAJxCwU[p[p`lmjnhn`eZbU_U\7JP TGPqEPC```WWX``X4i  ± RRSSMUKWKXMYPXQZP[QZOYKWIUIRMQTQTKVJXKYNYQ# ZU b [ YY]`a`a`[XW W Y] ] YX[a!, g %%r$o"n r!r!q"p#p$u$$r"o   SR4#RR T T Q QTT99 TU%9'UUT81-('&K0 0 +*!".C!/IBCB?@>@?0C.BA6/:.:-;.H@H^OROMHYH]_!_4`4`@\EZIYJ_CUPTPTMTTITT9%#$?>0B@xPXTP.&#w ss# y y}}kFV`_JFF019<<10<1%5BMTWZ{^nb^fRkGmBm>j=g?:@6A2Bg)j( n9!2u0PU w2v5h6d755 ^"]W` \ ]#Zc + ,!:2,1* *:29*1*+88:;::$s%s9s*s ssg!f.e@gAg5h*i(*').9==KKbbKK== " ":EP)"#y| xx~#x ttg.f;! o808@??OOt8?8iit::EWm@JS>.:78;3802.s.?A;A:.>Q I@IVLjLYN1@184<(= `O&L9; b8j8x5y377>Mf>L7^#])]4^@BijMN=c7m6u5 5555M;>E;_^0a`E96=JMQcG4H|(-" Z9W[) !,6CMP{Sw_VgFl )3H|PjScWY[PaEMPV]\VV: E0eellsrxwj>W W1Z!Z/ ) ) W2Z0Z8e"c*f*i**t, j!e'i%t+d+i-j-u-t.f+i+t-d.d3k3l3o30e5j4p4e0j0p0l2o2t/t1r2e,e-e/e0i/i0i-i,k0k/o0o/q0q/t. ......v.c. ba'qj u+,/1330//3/102/~021a1a5zbZR ! !!!!"#"("-"2"7";!@DGJMP! %)  -  1 3 5 7  ;&A   E I&M O  82 3"2 4 9"9%3)4 3 ,3+5F 6#6,66@1>;> @= !AG!f1@~Ie1tr ]u!\Yy)R2t9hbbBpf ~hI\xZ1jTP qJ1}H$J@56P^_|tu}F?y:~8q@n=ddfgMi:FH5ffii`o_plXmYkLl" *;'(;*T &"'+'"B$G!LX X.\+\ PPSS/W/Q/L/\/b/g/m/r/w/|I;I5J6J2UU U UU(U2UAE@??CGjkk\C?v?p?l?g?a?\?XF>G:c:G?G?E1>:19>5 _a dA iA nas#vS P P  O G ? #0',I1I7J<96320//2D0DEGJNQSTTHOHMIYYYZ\_cfhiiWnFnoqtx{}~~EoF,2,-,,,-/1E~|q$rq# jGFYMJIQIXI,.0}I!'UJJ #-v jk.6{ll( " %HKkOZBoh !# 0K #%?%"() )5 nYD/(9 9 +c~lXC/)#:!(7W@Cn46Iz{||AoBMH iHFF03221"-I! ' =ZYhXfZZUhThcVLH@!<(6)ZB3J3L0,3>ccc#\fgg[[c[;K?*5: . 0AEFVRF2l(yC|---.-B50*-dUjl3$JiG$9i1[$YAo#YauaN8 -~vvomkkmymxkvkwpwvjvjpkmjkhkhm`m_k]k^q^vSvStPtOwOxPxPOST^^``sapdogphshijjwwyyszp}ops|g|FFHHQs QrJrFUu G&Y@3)cB7B4A3WYWLXJUJTLUMQskXkKjImInKmKnWoWpZnZocpcqfpgprnrngmfmcncmZlZlXmXkKm_o[WLSsWY  Uh Uf Ql@ TqogjXjTXYXUoSRjoWVqLZPLVP)p_Rm TiUZn[LWVNUUTaSfSkSmQnRrommRlMlVnYpfOXXVjVrU TtLxW{[S,Z)W<:>8?6@5Q"R 3^39w9Q;K2`21;J;?3[3L5Y1t!v .\GFMl &E &I'K(L'Y&L&E?'@'A(@))G@*@-?5>0 *=,64'I'O+K/E3@7;;4{:ɲS=gKѩcMg?ѹS@o=19A[<i2cM.%O3P@{:eNgFfH PB]Dr?f.e=M0M:_Ox;sR>d:e3s2c2Q0<1=/9)P31 Q4[50Z*[4**   o2QI:o1* "  ) g:N< qqPqoPqh`0`0`0 qj`yl `j`r xikp}pspf mi _jPXRQQ ;1%+ xlE<7G`/+,##1:pL\aRcIXZkZlbbcddlfmrmpgr)psir~soXyY}a~dPqIs1P\Qd@1kdgYxXr}rqrNecpfqkql:j++ r#u|krmud}wssfuNa YpCOJNGfuT)N-J1D5?9:=4D22<4C678=<8-@m3Dm9M[?EEHKMQSWX]]^cciionut{y+,.D081:##1.1;5E7FG{9{ !-:uKqP[Oq Pm Va WuZZQg[u]Z`l`[c[clcpc{gu gYgllukljZpu tu sn rgq^p[uesXvgzg{k{l~{|sz{ ydvX}gyWt ~l uu:vHvav`a{`z{`zv`:rIrVr]rarP>nOnUn]nlnHjPjVjmjIfQfVflfrf0{fJbRbVbjbqb}bM^PV^l^p^z^qZyZHTTHHVbbVVdppddr~~rrHTTHHVbbVVdppddr~~rrQxQS~^~^w]xSxjwjwwwkxwxw~k~xx~~wq yq hq `q GGUUccqqPO[[fgtu)/48tHaKV$llhfg%h$g$fa"a#c#bdbaa8v7y6|54/.KYJ\I`HbGfAa! !,A V k   !!)) M [ i w JJXXRR``ffnnttN\jx|| fqa|agsgwf~gge~c~qz|zs}~?{zx?zt|~~~ax?at8x8L=C=f]>`G`Gc>c>fFfFi=i,&L&M'L(B(=(,(+'L'I(E[G\K(M'E]E`FlG`F_G]0(6(7/ <(H(B(,'>'A'J'J(F[0)0*6*6)<)<*H)H*H,H-B)B*B,B-B.F]F`6,0,F[FZ[1g0g/[0a/a`]\!\WZWb!ef!fVhVZhZ Z(h'h(Z)bf`\oD|C|{zuuCo8|7|6o7oC|Bo,|+{*o+o{{ o tvONNFF0F%FGHSGG M M)K/rktkvn{k{l}k}lkL)L,S8БPN,P O>M>22 : 99%9)121%123584:>2, :,*SEi Qs FHGHJUU]]kkvwrrzrnrkXiXiVgVgUhUhRP\WVYUkTlSqR}P}PpOoOl=lGHJKJ H J.a,b![%Z.aVQPTV N: LS%["R*i<]N JDcOLOM^8U.QH.e O= ww{}}zz ~NGM~VcPOXQ T~lU~bVye{d~e~\X Pc~ ~ ~050QP  Rk`\XTQQSX1bb_]]__G=3fuctbn`g^ji=9j GGXEEXC CWG E C GqGyEzCyCnEoEyFDDFFtDt  *  ^   *n (n &J&(K(*L*'#)")m'm FF~BDv@c=95A6b9b+=A8BBE8>BAHBRHGQUF\HUK\McJvPcPvV+:A% 4Q+!+8AB)>*>=B>H) J)J6L7L$M#H?QU# W#W3[5[;U=\;:FqFZB<9$6"9-<:AIDXIgN,9.:I@W9K:A6-.,&$*d sppm~nsvulvltvttylvtyvxv_pcompsrcAkccoksoqjtjcojQjljdobkeBf{jpljneshubp}u~ypxk{rv Hx!\tfmf]c^f]\]Z^Zk\nYiWbVWUUMVMXUZ[bc]ddLkIvD,")+K) )`f8FR"?P@FIHJXBq/.."@)@::3=3MII(\XX3\8~>~=goo;g:gSmijgigRoUoaXMXcYd:D.?P{~RP "+9HUd<@JJW k &u^,Cch!j7t@ue]WQZ{eWhkYf\:gj9D =HOBL#F-LBp1n1\1K1;1 K2KL[4ZSk5l]4e~W<2q>G/A )k)Z)K&>&/ nu{zuLQcXd`dh oq xy #KkCLZQZN9CO)C<5/)# ~)#,/$+/+|%~DA,#&{H `"4m _%,#;E }()&~+@8@88k>>88C),2"%#*%52 E s?ss lou u?sVs_uW=9<8:\DEG+"/&.&/.=@,9(/+#+I*|D" z$1.noxhkd*+s6ky~11y~} 5nIlGiRw5OdR 8 H ? = E?, )1&47H=G-B28 ; : /+ ( on"-+#,3@3I4U-%F.J9OHVMZMkHtXn\gdifxmpmkodsbriltpvn|v}xvpc]Bp~tBv~svt|vzw nyBr{rnnyes2huheesgo2)rdqlrstdsnttvevuv{vuvlm !oB)vNcH\FUDc?vB~DF~L\=MBB?8*AB.@-@;BJ?J>N@EJ'K'K,K1K6Y%Y*55 6DE6RxySEFyzhipqa`YX?>760/))!!_O@@5--) xmj b&g&i'j&k&n(o*n+m>rGrGwCxCyFzLxMwXw^tstqx]_cjqtzGKK/h4g7kQ`N_NYIAZ>*+5??#3 !!  %.:&(898030 3 03//////0BObr}yznAw}|x?w?HvHBvB =P @PG0(;(D(7 >M(7&a QA01# 0$    QX_fmt{AxC|CCCCCCXJbQmXu_fmt{ btnitr rr-o- l -l-nqqrt!tvx)xz}1}$$9..9#:2]fox}}}~y}vp}ng}e^.%$&).&''''()$ (%M~{u y  #%16*"*$+  *p;"e.:5oGoqW -k.k.7:7:]/i/8=DkFkFjRjRkVkVqnq|~xszlc]0^:^:\0\==>>88w@L@^E^>/77w?LDh8@^;y;j>g>YM%6'50*5*_._*_*5QFkF7R7RiD]D5N5R5 T5TjVkV`U`URnRnOVOV5p5p9?@A}BvEfEW;N4]9{?Z49h:c;^>x b\xq||o9 o6W6WNnNnMWMW7n7?JEyh a@hxbtd}k~htnunw]y _uCeuh~lvn~]xny-k1`7PQW`n`V^n^UY VVnVnTVTVYnYWcncXeXn_n_eYeaeanhnhebenejejnnnYiYjbibjkjkiR:RMR`)`)8Q'<'e%@%j"D"rIyN)>Y)Da)Ji)Or)Uz)[VUnUV_n_-`HTHSISITIUIVHNHMP-9.f.rDWWnWnXWXEnUnDsnsyxCx]xC}h}n}x}0Bnx@Anx@0`9`0b8b0d8d0g7g/j6j5n-n4s,s3x*x2})}0'/%#0Anx@"0@lx 0?g,@>]GIyh%To%4k/zVKEHIgfklzXXUTIJ{HySqRo"#&%--/2lSOO15:5mID`X@!YHZ@Y@XHYD {?{?z>zaB0dDd;c;cCbCbB ` _ ^#R#Q Q P$n#m$m#l={>|?|@{6?6H8H8?7?7H9H9?XA`:i"<3<@EOW]bfjotwzvrnifa]XTB=<:u0226:B4"4$=<#>#?@`NN~UTA0B31 7 9 < D:k;7"!! $&),/13.=!=$<*;2B!C  =>?ABHSegiknprx{9753 J$3938$!;!9497$7Q$9$yMHE B!?";#8*55., *!'"$#")0*$#$2]"L"@I "N"$y&y&H'@(=*:-8388;9A#<&<99 U "$y'y'v'u'w$w!%x&x'y"!'t'H(@)=*;%8 !qFFwE??#C= E#E>>C=:=5=?= N 2TU(P10uT#T((KT*@m|ATeZ vH r1eiiAT)U,,QT.U0UkWkW/X.ThLhLWM=N=`RDM=7=*=G7T7(N9NGN@if_\YXXY\biimrvy{{{ywtnjZB^fpvxygl!omf jjjdox os}UXFCM?7630/,*V3HPsvy|lJzWXkX8d8d7 Ji2#%w;vDwIgIgYehe[gZejekkXk kjMvzv:v?fY.h' MmvwPmstU ^enn} M+* *MUuu}|uU#M&"5Cp=b=Vz{/ 11!k |M&$b>cAoAp>p>{E{Ew>w>sEsEo>o>kEkEg>g>cEcE_>_>[E[EW>W>SESEO>O>KEKEG>G>CECE?>?>;E;E7>7>3E3E/>/>+E+E'E#F F%F)F-F1F5F9F=FAFEFIFMFQFUFYF]FaFeFiFmFqFuFy>)>k}nysyuxzz}{r{k{TJT/YMfMfPYPKO9O(O(R9RGR@YSfSfVYVKV9V(V(Z9ZGZ@YZdZd_Y_K_9_(_(d9dGd@YddddiYiTiGi9i(i(o9oGoouGu9u(u%{9{G{j{{{`F%@=W{Y=z" =LG?#11"9tz}{x{s{n{P X IZ,Z,z & &S fztnnKt 6n_caS ')LK 3% _ ggOCC eeOyW V __XPP VV_PO.PCNUIPISjn }~}wnji jx|rjqf_[XTPKMSX[aZomgW[^bfh ibPptsn yu5k4mV}Z]b`agwQRLs,YNNMYUYUWMWL?8?)?MZTZTfMfTgL@8@)@*J`0J0A2J`8J8AKAKJGJKL9L(Lhkkk i*A*I2A2ISX4E4E,E,E,EGE! "$y'y'ww NMNMhUhUkWkVLgLgIqIu]]ififlgkjuu<<::334tkthjj\v\eKVKLM M&xx!u|||}xvxu|><q1M Q-H2F/3H]/b5ai7M4'("'G'R)X(x'~((xxywaucsbq^qYrWuVwWv/u"wwvvW~}z{wvvuYXVW9867'rrs'ww '~~{ {w wrr v v ;;YYWW997788XXy*MXWW778sZszzz t{}}1+ ,*-s,-+,/FQhpqrpSq pobT<4C*tq`tTE{t#h1 1 11111`43@@a`]^KH33 !!$%''  z'z}&}&&%% us w z&%"q"#n@(f"_)_)W"W"O'O'G"G"?'?'7"7"/(/('"'"((""''""'xxxxxxzzrxrxjjbwbvZZRwRwJJBvBv::2v2v**"v"vww wzzcz#$%$ $ %$%$%!$%$)$- 5 V n  %1$5$:%=$A%E%I$L$Q$U$Z$]%a$d$l%h$p5Qr}|d|gxh}m|o}x}t}|}}}||}`|\}Y}T}P|L}H}D~@~<}8~4}0~,|(~&{$x'x$~ }~~}~ ~~ uvvt&u,vNwg$xqwwvww()+(8(M*a)i(}')(~A  K))0) l!+C/;EokcVMF,+9 *mq pTrqp<@ D H % L T UX \ <6  8:;=:??BD EEFDHHKIJM  SSVWWUTVWWYY^^` aa`bdfgifg/L 3L 8P ;P $ @L EP IL MLOLQL XLZL _P aP eP jP lP jNbN_NCP?P:V !?]<]TA]CTDTF]M]MTPTQ]STTTV]X]XT[T\V\WZX[X\[\]a]^]^T`Tc]cTfTgVgWeXfXg[g]dX`X_XYXTYSYOXNXDYCY>X=X8N7e 4 B 4 G K O dd[H;35 < @ D H 4 M V"X \ a d f da=stsr+sGuQuUsQqTudthutv{trpspj f ^+@+I,\,i*+,+,007=>>DDR4V 6KJ KJKJKJ%K(K. #$/ )H)b&kkqqkT T LLGLTTK!K!T&T'LLpG,! 0&i&U#+PO"O!  L __K_ _  )+TK-"&T&L)* :XY_([(Z rro o p rroor&r'o+o,r6r7o:n;q:u9uus UUON V ^V^ ZZ#-+/5/T.X,1&.5-0.4/"3808-X-70UdU}=q4,V} s{)%x~{ld 0pgrzfT"jTlcfS SS CS6SfT16A,4R3277*o+o:n/|0!0  /%/&0.0/2627wxwx##&&(v(uvnjiY//.&1707yu1}0-},  |~xu..-,/x/u xt xt6v6w33// S0O0K SO"S $O.:.6.2-3-.PQ $L  0 :ANIdImA U]]hs={ Lr0 UsK[)2h1=]/\)'l r\^ibX\W3X*[$n/n0mSQfQ@QBQ5Q'ooo o ormxhezzJK9; =v 5 HQIHI H&IE DEC(D@ ?@?#?(@);#<;;< 6a76$7)6*0%1121 2 ,-,#++,,%%&' ( $-!.91 IAP1;rrk(k(c(iiV-V-X.X0TeT!W!hhWWhhWWh h WWh4  * @    9!0& ( (&&++*))-11//44322 4 4 0 -* & 70" +9 : +B!    EGG E E I NN L L Q Q P O ONH HJJES#0* P ZS@ [[YY]]\\Z_`` _ _ a abb_dee d d f fhhd) )1679:6:>CC?GH I JKLMNO RSWW[[a` e e: 9" [ lmmln! )sttst+  u|#0+  !  0"0    !!!!!      1  $$$   !8To}V#&`##, **/. /P0 "! *E` IIN PP R R M ;  Q"0*Yiigg c bb ^ ]]Z Y T P T 33 5 5 & 5*9A)C JJME F     `;$   + &J MM=<<;nn l`r vvwx* | z"0* "0*  0 * %'' P''''   %      , 0- +Q6 D S ] ^ h v aB h r x   6 F4F7 P o {olhAllllow1yY QAYY44450+0/.-BAFFJJKLJF5QRXWMM LK B=YZZZWUV^__^^__^_^c zsddddddpp~~~ x{ C  z a) (((*,,575"99755,,*(277644.. **+.367,-,,D+q+,/p._+L+D-#0/13>1\0o125n3a5N4>3&565>60n6 Z2a4,1,43 )"1$4$,(4(,+2   ./<,!=4   D/E0 H/K/ ! T4 )W4 ! `4`+c+d-d3c4a4f0!j/!! x/{4   40 /c,5 0,4,10!1%/%,$),)4-1/11-3-:,=0<+:2?0A1D-D0H-L/N1P1R0T/V0\0Z2d+i0k/m1p/s,u0w1y0y5z/}3 4 ///,04 4"4#3#1"0,0+1+3.404244453//93<4>4B0@/ 0 @csz qqff*;# y/&8("404wo"oprr""rrp"z!9} !$+/5?hqx|}zwt{swrqqgq>r4s.u(w$z!jjkNw2opop(| $+/59mpy{}zvs{rxqqqmq9>Lmmnkk llmmlo%o(o-o2o7o=p"rruz}!"&+0:GTeoIoVolqfqkrorsswt{vwy{~{wrkiiiiim#$oii pSS4,k #0qoqonqksks>q>o;o8080;.>,>,jP9PAJACB=D:F7I5N4Q4S-SI9I:B<:<1;F<F>=?==->I >> 59E9/I;CA3<.?6J.I-H3B09Ba5E#1Jd/ON= ;>G9.Q0P1P.L-M-Q-P/Q/P/L1O1N/M.M!)rSkSkWj\gadd_f[gVhPhPp Tp mpri! QiQpSpnplei`kilohpkeljmorjrgqUqTmTmZnmnX Xp ;]p ,cq %ZkYo^o jh\kXkSiTl\nandh Zhbfcefi9af^hah]j^g]hiiig lb r\sefci_mfjgRjXihfrWlWpfoXoTph-S4S4W5\8a;d@fDgJhPhPp4q* .3p6c7`3TOj-^2" Bl3\4o2l7d6j5m-]9 1]!4]Ip:j EjLj 5k.Y-^3U4\3b0l0m5\5j2f2pP9PAVA`CeFhIjNkRkSrSeE  f9R90 S:g;f;dDkM [rNb9*kOqPrIi,>,k.k0n0qoqonqksks>q>o;o8 NS4 0 x"x${$~{~{{}xx0}0{-{*$*$-"0 0 xP+PAJACB=D:F7I5N4Q4S!S)1)11@!IQIAI+C3B+I1I:B<);)2F<F>=?==+<Y ,<>> D3I F. E+F+58/7:D+8,BEA G@ H=C@)>Z):U-9*A1? C41483&#"A%E*I#1Jd-M(O0R%8#/!8"6"8#2#8$6$8K6K-L+ "EK0+M,J-#8 N= G4 A8 64/7 ;>+=SkSkWj\gadd_f[gVhPhP}t~vsvjuYuVtT{T|\|c}p~w zT~TxW QtPq'>TnWwYt\q[v^wauardvgxkuiwjzn{pvoqlppqrsswtpsjpgtiuotmuq[s Qi*ownplei`kilolq%hvkeljmolvjsss rgqUqTmTmZnmnXot WuYj\gZn[q\t!^u]k_g^m`scs bjereufvZkYoRu^o]s\u^vdrev`u jh\kXkSiTlTs\nandh Zhbfcefi9af^hah]j^g]hii }g.~jig lb r\setYfci_udmfjgRjXihf~^sVlWyTzi{pzv{{{||tx} pfoXoTphqq2(R|%^{g{Mq{X|ad{Zz gcyypw|%vUxet`sh}T .Ty b}4S53RAa`)~)f+d)c)`)`*_+W,T$T&`)`'a"'f'}(d(f$T`*T)`({(a'U(^'_(_ &Y(W+T*[(e3} +* ./~2r3p6c7`3TOj!\ +]22"<}1C}JQ31I{>} =t#S"W3\2z4o !w"%z!vY&w*t@!,z%}"p2l7d6j5m-]9 1]!4]:r! Fq :j Mu6z1z;g=n: .?RQGA97GD<535!8 ; 4<EGE>IQS7 0-)1'&'(()2jBIAi)11@!IQIAH#J"I,H2C3B+B$CEGI1I:B<);)2F<F>=?==+<Y ,<>> D3IF2G)F$E(E0F*58/DP1N1L7:D+8,BEA G@ H=C@)>Z):U-9*A1? C41483193&<=<';mH F (D$%H#<M;"<-32$1/*?#:#5#.$!5F%J!KQ%RhL-4OBO># A%E*I#1Jd-M(O0RA I9B@9K6L#K 3 $"%LL MM#L'K,%8#/!8"6"8#2#8$6$8#8 N= G4 A8 64/7 ;>+==SkSkWj\gadd_f[gVhPhP|pfp|a T Q;3}2 Q!1+Z22,T+BA,[5YaS-3X{Qs t~vsvjuYuVtT{T|X|c~y} zT~T^TSXTTTVxW QtPq'>TnWwYt\q[v^wauardvgxkuiwjzn{pvoqlppqrsswtpsjpgtiuo~+,q "bW UTb_pn~tmuq[s Qi*ownplei`kilolq%hvkeljmolvjsss rgqUqTmTmZnmnXot WuYj\gZn[q\t!^u]k_g^m`scs bjereufvZkYoRu^o]s\u^vdrev`u jh\kXkSiTlTs\nandh Zhbfcefi9af^hah]j^g]hii qtʣ2su<")#j kw*3d%gon}ym }g.&/$eleoig lb r\setYfci_udmfjgRjXihf]sVlWyTzi{pzv{{{|t|}w wx{pfoXoTphqq2(Q%^}iMpX~ VY[Ea+gn t|aae}Zz J^gcyypv~%vUxeZbYTYU_t`sh} }T .TyeFqj}R q c h a e-c klvYZ^\opig~bb}4S53RAa`))f+d)c)`)`*_+W,T$T&`)`'a"'f'(d(f$T`*T)`((a'U(^'_(_ &Y(W+T*[(e .* , , +* .+2r3p6c7`3TOjwsngc_]#\$\+]22"rmic`fnmq}~pem2K1L1JJQ31< =t0S#SX.hmyos3\2z4o {;I)1"´ * *9) J!vY&w*t@!,z%}y q2l 7d6j5mU!-]9 1]!4]phpc`:r! Fq :j Mu6z1z;g=nIQSKA97;=)1'&'(()2jBIAi)11@!IQIAH#J"I,H2C3B+B$CEGI1I:B<);)2F<F>=?==+<Y ,<>> D3IF2G)F$E(E0F*58/ O RS&R 7  N%," !%6J.I+G*E'D)D3B09BaF%H(K'ORPYF5ECMJP1N1L7:D+8,BEA G@ H=C@)>Z):U-9*A1? C414831936@A&<=<';mH F (D$+"J-m%H#<M;"<-32$1/*,$,,.,1, 2,2$3$1$5,!8,8$7$9$?%!" M+ @ 1" "5F%J!KQbQ%RhL-4OBO># A%E*I#1Jd-M(O0RM>>LK 9B@9 3i,%"Fj  / g h% $J' J4;GBh8f1589i62B=EKL'K6")L&#L#LLLlL JJBN(L-IK2 L.M(N"MKL KJ,J*D F.F@$>N= <(> N-%8#/!8"6"8#2#8$6$8#8 N= ;>+=64/4A5E5 9AD=#7?G1"" "ML#SkSkWj\gadd_f[gVhPhPSsddTZdjs{|pfp|~] ;%>:aZXTQTWXUQSWXU L}>oYWVUSZ[^_`} X]1D5-+6a#;B:.$5DaSUT bQkrpecAjrqmdbgQ;3<_,32jKez+ +2!; 1oecTWWQ Q!1+Z22,T+BA,[5YaS-3Xsqg{Qs t~vsvjuYuVtT{T|X|c~y} zT~T^TSXTTTVxW QtPq'>TnWwYt\q[v^wauardvgxkuiwjzn{pvoqlppqrsswtpsjpgtiuo~+,q "bW Ub_pntmuq[s Qi*ownplei`kilolq%hvkeljmolvjsss rgqUqTmTmZnmnXot WuYj\gZn[q\t!^u]k_g^m`scs bjereufvZkYoRu^o]s\u^vdrev`u jh\kXkSiTlTs\nandh Zhbfcefi9af^hah]j^g]hii 2) fjtʣ2swu<")#j kw*3d%gonym }g.&/$e\_eb[d]`lfgig lb r\setYfci_TY !"udmfjgRjXihf]UsVlWyTzi{pzv{{{|t|}w wx{pfoXoTphqq2IU~˓ UGUme l(Q%^}iMpX~ VY[Ea+gn tR"aimmIs̖jʎr|Ip,nŔe̗gƔlSuGayiae}Zz vJ^gcyypv~%vUxeTbYTYW`[U_t`sh}~<}T .TyeiFqj}Ry/sgp mkmkhlnmrqfecehinlgea7aab b  e-c klwYZ^\opig~bb}4S53RAa`PhPT))f+d)c)`)`*_+W,T$T&`)`'a"'f'((d(f$T`*T)`((a'U(^'_(_ &Y(W+T*[(e _TT_`V %̺ʺaABC3D44$(預(%) *** )* , , +* .Si*2r3p6c7`3TOjVwsngc_]#\$\+]22"rmic` fnmq}}+ ~pemSP  YZd 0FѺ;¼2K1L1JJQ31<a [ UXd 0@=t0h!&$Sy#Si h.WiSTSTiVjvhmyos3\} '2z4o {;I)1"´³1:+: * *9) J!vY&w*t@!,z%} y q2l#&!>? ?OO`UT" (7d6j5mmjs{~U!-]9 1]!4]phpc`:r! Fq :j Mu6z1e: SU.S/Q/U?a;aC*v%}$ Q3e3e4RR4S?`@e: Q2g2g,b,V-^/ V&l&V?` AAI Y<` V9a9Z)g3} [8ZA^:R70`: bCV(X(``(`f3h(@k@s>z;\0c/W0hH0jqFxB{@g=n>C??B@@BAABBBACCADDAEEAFFAGG@HH@II@JJ@KK@LL@MM@NN@OO@R H .  " )  .C R.LLSSSK+ " $"&" " 1!(%*!(#+  )9 ))"5;); -7DDC6DC566-(%$GHH : 6AKQSRQGA97HGD<535I4 " ## 2!.8 ; 4<EGEH>IQSKA97;=)1'&'(*-37;?E)11@!IQIAH#J"I,H2C3B+B$CEGI1I:B<);)2F<F>=?==+<Y ,<>> D3IF2G)F$E(E0<5 "9F:J7J@BB ,6" +)4<;60:F *70$ I;CA3<.?3/12;29 :<?<;&<231223),(&*1#?=!=*2! 3).4/,$+#N*( +/5  > O RS&6J.I+G*E'D)D3B09BaF%H(K'ORPYF9'9K=QH=8P1N1L7:D+8,BEA G@ H=C@)>Z):U-9*A1? C414831936@A&<=<';mH F (D$+"J-m%H#<M;"<-32$1/*,$,,.,1, 2,2$3$1$5,!8,8$7$9$?%!" M+ @ 1" "5F%J!KQbQ%RhL-4OBO># A%E*I#1Jd-M(O0RM>>LK 9B@93i,%"Fj  / g h% $J' J4;GBh8f1589i62B=EKL'K6")L&#L#LLLlL JJBN(L-IK2L.M(N"MKL KJ,J*D F.F@$>N= <(> N-%8#/!8#8 N= ;>+=64/4A5E5 9AD=#7?G1"" "ML#' /! 024G:975"M5(;C@A C F.0J<$ RO4R:FOA@C?CBB4  R R R RRRRRRRRRRRRRRRRRRRRRRRRRRRRR~~R}}R||R{{RzzRyyRxxRwwRvvRuuRttRssRrrRqqRppRooRnnRmmRllRkkOjjLiiJhhHggGffFeeEddDccDbbCaaC``B__B^^B]]A\\A[[AZZAYYAXX@WW@VV@UU@TT@SS@RR@QQ@eE  -)*m&m.k1h3f9ez;2\0c/W0hH0jqFxB{@g=n:aZXTQTWXUQSWXU L}>X]1D5-+6a#;B:.$5DbQkrcAjrqQ;3<_,32jKez+ +2!; 1Q!1+Z22,T+BA,[5YaS-3s t~vsvjuYuVtT{T|X|c~y}zT~T^TSXTTQtPq'>TnWwYt\q[v^wauardvgxkuiwjzn{pvoqlppqrsswtpsjpgtiuo~+,q "bW Qi*ownplei`kilolq%hvss rgqUqTmTmZnmWuYj\gZn[q\t!^u]k_g^m`scs bjereufvjh\kXkSiZhbffi9af^h 2)fjtʣ2u<")#j kw*3d%}g.&/$e\_eb[d]`ig lb r\setYfci_TY !"yTzi{pzv{{{|t|}w wx{pfoXoTphqq2IU~˓ UGUme l(Q%^}iMpX~VY[Ea+gn tR"aimmIs̖jʎr|Ip,nŔe̗gƔlSuGayiae}ZzvJ^gcyypv~%vUxeTbYTYW`[U_t`sh}~<}T.TyeiFqj}Ry/sgpmkmkhlnmrqfecehinlgea7aab b e-c klwYZ^\opig~bb}TQ\g4_TTTTTTTT T T T T TTTTTTTTTTTTTTTTTTT T!!T""T##T$$T%%T&&T''T((T))T**T++T,,T--T..T//T00T11T22T33T44Z55]66_77a88b99c::d;;e<>f??g@@gAAgBBhCChDDhEEhFFhGGiHHiIIiJJiKKiLLiMMiNNiOOi))f+d)c)`)`*_+W,T$T&`)`'a"'f'((d(f$T`*T)`'U(^'_(__TT_`%̺ʺaABC3D44$(預(%) *** )* , , +* .Si*2r3p6c6b7a3TOjVwsngc_]#\$\+]22"rmic` fnmq}}+ ~pO YZd 0FѺ;¼2K1L1JJQ310h!&$Sy#SiiSTSTiV{;I)1"´³1:+: * *9) J!vY&w*t@!#&!>? ?OO`UT" (7d6j5mmjs{~U!-]9 1]!4]phpc`:r! Fq :j Mu6z13>113a>113>113a433w3a3ru32quq3a1qtrA31r3a3OH3a2A32OD3a2AOA332OD2a2a2A53A1a2ab1BB2aacD1q1d1A4cbaA41a1bB4bfB3b2a1B3aabB442A1ec1A542A2 1A57Bz qAAqA AqqA  qA  qAAqA AqAAqAq4 A C!2q1s1rA1q1r2q2A2B2qA1qBq1B1CA1BqA1ABq1BAA1BAA1CA1BaA1A223322221121aq21a31b2q2a2b!2q1s1rA1q1r2q2A2B2qA1qBq1BA1CA1BAq1ABqA1BAA1BAA1CaA1BA1223333322211aq11b12a1q4b!2q1s1rA1q1r2q2A2B2qA1qBq1BA1CA1BAq1ABqA1BAA1BAA1CaA1BA12233333333q3a3b3q1a3b!2q1s1rA1q1r2q2A2B2qA1qBq1B1CA1BqA1ABq1BAA1BAA1CA1BaA1A22333333212122a2q2qa2b1a a !2qq2qq1qq1qAAq2a2321AqqA1qAAqACAACAAAAAACAAqAAqAAaCaAAAAAACA11122121212121212q1q2a1a21!2qq2qq1qq1qAAq2a2321AqqA1qAAqACAACAAAAAACAAqAAqAAaCaAAAAAACA111221212121212q12a121q4a4!2qq2qq1qq1qAAq2a2321AqqA1qAAqACAACAAAAAACAAqAAqAAaCaAAAAAACA11122121212121212q1q2a1a21!2qq2qq1qq1qAAq2a2321AqqA1qAAqACAACAAAAAACAAqAAqAAaCaAAAAAACA1112212121212121q21a2q12a2 7!2qq2qq1u1u2s2q32A1AqAqA1AqAqABqAqBCCCCBqqBBqAqBBqAqBBAB1AA11122121212121212q1q2a1a21!2qq2qq1u1u2s2q32A1AqAqA1AqAqABqAqBCCCCBqqBBqAqBBqAqBBAB1AA111221212121212q12a121q4a4!2qq2qq1u1u2s2q32A1AqAqA1AqAqABqAqBCCCCBqqBBqAqBBqAqBBAB1AA11122121212121212q1q2a1a21!2qq2qq1u1u2s2q32A1AqAqA1AqAqABqAqBCCCCBqqBBqAqBBqAqBBAB1AA1112212121212121q21a2q12a24s h 6!2q1s1ra1q1r2q2221111q1q1q1q1a1ra1sa2t2t3s3r2s2t2t2r1q1r2q1aq2q1a3q1b2q2a2b!2q1s1ra1q1r2q2221111q1q1q1q1aa1ra1sq2t2t3r3r3r3r3r2s2s2q1q1aq1q1b1q2a1q4b!2q1s1ra1q1r2q2221111q1q1q1q1aa1ra1sq2t2t3r3r3s3s3s3r3r3r3qa3qb3q1a3b!2q1s1ra1q1r2q2221111q1q1q1q1a1ra1sa2t2t3s3r3s3s3s3s2r1q2r1q2q2qa2q2qa2b1ax-S !4qq4qq3qq3qaaq4a45433222222aa2aa2qq3qq3u3u4s4q1q4q1q4q1q4q1q4q1q4q1q4q1q4a1a4q1q !4qq4qq3qq3qaaq4a45433222221aa1aa11qq3rq3u3u4s4q1q4q1q4q1q4q1q4q1q4q1q4q1q4a1a4q1q !4qq4qq3qq3qaaq4a45433211112aa3aa3qq3rq3u3u4s4q1q4q1q4q1q4q1q4q1q4q1q4q1q4a1a4q1q !4qq4qq3qq3qaaq12a121212111122333aa3aa3qq3rq3u3u4s4q1q4q1q4q1q4q1q4q1q4q1q4q1q4a1a4q1q !4qq4qq3qq3qaaq3a24211223333aa3aa3qq3rq3u3u4s4q1q4q1q4q1q4q1q4q1q4q1q4q1q4a1a4q1q !4qq4qq3qq3qaaq12a121212111122333aa3aa3qq3rq3u3u4s4q1q4q1q4q1q4q1q4q1q4q1q4q1q4a1a4q1q !4qq4qq3qq3qaaq21a21211111223333aa3aa3qq3rq3u3u4s4q1q4q1q4q1q4q1q4q1q4q1q4q1q4a1a4q1q4. 11111111-qqqqqq1q11q11111qq႑qqqq1q1q11111qqqqqq11q21q111 =n yqqquqqxAqvqAqvqAzAFqB y r  qqqqq JII  r      qqqqq  q  r      qqqqq4G  =+ 3333334qsqqqBC111122211133133433334q4AAqqqqqqCC111122211133133433331212qqqqqqqqCC111122211133133433334q4qsqqqBC111122211133133 w 5s4qas4qbq4qAAq5aq56544q433q33AqBAqqqqsq 5s4qas4qbq4qAAq5aq56544q333q2121AqEqtqBrqAsq 5s4qas4qbq4qAAq5aq56544q333qq211r1q12qAqGqAuBrAsq 5s4qas4qbq4qAAq5aq56544q333q2121AqCqqsBqtAw qK1:19Á19AA1qq9a8Á=>>===<:94AABA3Av3ru2qu1qt1OD22OB2AO2OB2A51b1BB2abaAa1A4bbaAbB4bcaA 17a8‚15A15Á15Á1qq5489941145q719:4BCB3uq3ru2qu1qt1OC22OA2AN2OA2A13b1BAbaaa1A4ebbB4bcb"77‚15Aa6Á13Á13131qq32214q58888q884BB3t3rq2qq1qr1N2 2L2AJ2L2A12b1BAba1A4dbB4bb #76c11AAa11a21Á2qq211111a1q213445177774B3q3r2q1q1K2 2I2AG2I2A1b1BA1a1A4abB4b %5555qq4a121AAa3141421a11131a34566777774B3q3r2q1q1K2 2I2AG2I2A1b1BA2a1A4abB4b '777A7qq67aA15a68821a5116qa567777777q7!4B3s3r2q1qq1M2 2K2AI2K2A1b1BA3ba1A4cbB4ba4 ) .o "3333333333333333q333q4qq444qq3q3q3q3q3q4q4q4445"3333333333333333333q444q43333344444"33333333333333333q334q4q4q4q3q3q3q3q34q44" Y 52222222222222222221222212222222222222222122221222222222222222252222222221222122112211221222122221222112211122112212221222222221522152282;;75115114114111511511511511411411511511511151115111151171711711911911;1;;;98887788887788888999::;;<<<6BABAAaAAABAABAAaAAAAAAABAABAAAABAAABACAABAABB66666666666667BAABAAaAAAaABAAAAAAAAAAABAaAAAaABABB7777777777777 "q3sq3sq3sq3sq3sq3sq3sq3sq3sq3s3s3sa3ca3ca3ca3ca3ca3ca3c4c4d4e4a3a3a3a3a3a4a4a4a4a4da5c4  @} 2q1s1ra1q1r2q222111 2q1s1ra1q1r2q2221111q 2q1s1ra1q1r2q2221111q 2q1s1ra1q1r2q2221114 7j7g!311A111A2332q222q2q212qq!22r21222333222111q233q3"311A111A2332q222q2q222q2!2q2q2222333321q122q3"311A111A2332q2222q222q2q2q!22q22233133222q22q12"311A111A2332q222q1q1q11q1q1qq211!22222121222212113q1q311!311A111A23322q11qrq1q1qqqq!!12222221212133q4q2!311A111A23322q21q1r1q111q1q1q1!1!2222212111q233q3"311A111A23322q22q1q1q1q11q1q!22q222333321q122q3"311A111A23322q22q2q2222q!22q22222212212122q22q12"311A111A23322q2q22212q1!22q2r22222222121222212113q1q311!311A111A2332q2222q2121!2q2q2r2222222111121334q4q24 4qqqqqq4 pw -. qqqqqqqqqqqqqqqq gqa1a1a1aqaaaaBBcAA AAqBBq1111 AqaqAwB AAAAAqCAqCqCqDAAGODAAAEqODAAAE -. qqqqqqqqqqqqqqqqqqqqqqq񒂖qqq hqb1a1a1aqbaaaBBcAA AAqBBq1111 AqaqAwB AAAAAqCAqCqCqDAAGOBAAAADqqOqqAABqqqqqqq-. qqqqqqq񁘁qqqqqqqqqqqqqqqq񒂖qq hqb1a1a1aqbaaaBBcAA AAqBBq1111 AqaqAwB AAAABqCAqCqCqBAAAEOBqAAAACqqOqqAACqqqqqq4; @P \8`%(rrrrrrrrrrrrrrrrrqqq&#q#sqqrss"-onomA AAAAAAaaaaaaAA AAbccbAAaaaaaaaaaaaaAAaaa aaaAA AAaccaAAaaahaaaAAaaaiaaaAAi AEiEAA AEjDAaAk AAogAAoiAaojolccbebccccbebccH H  hhhcchecccceH!cce !heh!h cc!h&cc"H'H" ( ")#h*h" + !!!!!!!!!!!!!!!!!!!aqqAqAqAqBBC $#!"!!!"!!!"!!!"!!!"!!!"!!!"!!!"!!!"!!!!!AAAAAAA!AA!C#D$$$$#!!!!#"""$'######1###1##1#1#r##2#"b!qaaqrbrqs!qs"t g!22a!22a"1a"a2a"A1a#2a#2a$2a$1a$1a$1a$a$a#2a#q## ((''''!'!'!'!'!&!&!&!&!&!&!!!! !!!!#!!!!!!#!!""%"%"%5qholol,olololol!a-aa!-olAolAAolAolAAom!! !!aaa!olAolAAolAolAAomAAolAolAAA AolAolAAolAolAAomAAolAolAAolAolAA AolAolAAolAolAAomAAolAolAAolAolAAolAolAAAolAolAAolAolAAomAAolAolAAolAolAAolAolAAolAol c  2FKKJJJJJKKKKKKKKKKKKKKJJJJGAHAHBKKKKKKKKKKJJJJJKKKK 2CFHGGGGGHHHHHHHHHHHHHHGFaFaFGHHHHHHHHHHHHGGGGGHFDB2ABCCCCCCDDDDDDDDDDDDDDaCaCCCCDDDDDDDDDDDDCCCCCDCBA2AAAAABBCCCCCCCCCCCCBBBBBBBCCCCCCCCCCCCBBBBABAA g"'t#z!{{q{1{1{2{1a{1a{1aA{b{a{a{aq{1qq{1q{1qq{1q{a{{rrrss't#z!{{q{1{1z2!y1a!y1a#w1aA#wb$va$va$vaq$v1qq$v1q$v1qq%u1q%ua%u&t&z&z&z&{%|'t#z!{!q#uq&t1's1's2(r1a(r1a(r1aA(rb)qa)qa*aq*1qq*1q*1qq+1q+a++*v*v*v*w*w't%x&u'rq)q1*1+2+1a+1a+1aA,b,a,a,aq-1qq-1q-1qq-1q-...r.r.r-t-t P="a"a"a!b!b!b!bcccccccccccccccccccccccccccccccccccccccccbbbbaaaaa="a"a"a!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!b!qa!qa!qa!qa!b!b!b!b!b!b!b!b!b!b!b!b!b!a!a!a!a!!!!!="a"a"a"a"a"a"a"a"a"a"a"a"a"a"a"a"a"a"a"a"a"a"a"a"a"a"a"q"q"q"q"a"a"a"a"a"a"a"a"a"a"a"a"a"a"a"a"a""""0Y qqq qqqqq!qqq"qqq" !!qqq"qqq"qq#qq#qqq# ""qqq#qqq#qq#qqq#qq#-x $qv!uqu!qrq"qq#qr$r &q&q&q%q%q%qq$rq"tqq!q"qq#qr$r '%q$qq"qqqqr!qr"qq#qr$r M '%q$qq"qqqqr!qr"qq#qr$r "#!%$rq"sqqrr!qrr"qq#qr$r %%%&&q&r$s"sqqr!qqr"qq#qr$r ((''&$qq"qrqr!qr"qq#qr$r4 Z W ,43r2s2rAA3A3q4q4A4A332222222q2222222q33333444444444444144 +43r2s2rAA3A3q4q4A4A3322222q1111q11111113333333131313131212222222322 *43r2s2rAA3A3q4q4A4A33222222q22222222333333313121231313144555 +43r2s2rAA3A3q4q4A4A33222222q2222q22q223333333332221112q3445 ,43r2s2rAA3A3q4q4A4A33222222222q22q2q2q22333444443322223444 ,43r2s2rAA3A3q4q4A4A33222221q1q1q1qq1q1q1111A3333444443333212122232 +43r2s2rAA3A3q4q4A4A33222221q1q1q1qq222222333333212222222212133454 *43r2s2rAA3A3q4q4A4A3322222222q222q22q2233333131222223231344667 +43r2s2rAA3A3q4q4A4A33222222222q2222223334455443221213131326  .432qq2qBAq2A3r33AA4B33qq2qq22q2222q22q22qq22q2233331313131313131313131313131333 .432qq2qBAq2A3r33AA4B33qq2qq2q22q22q2q2222qq22333333131313131313131313131333333 .432qq2qBAq2A3r33AA4B32qqq2qq2222222222q2q22A23333131313131313131313133333 .432qq2qBAq2A3r33AA4B32qqq2qqq22222q22q222q22q3333331313131313131313131313131666 .432qq2qBAq2A3r33AA4B33qq2qqq222q22q2q2223q33A333333131313131313131313131666666 .432qq2qBAq2A3r33AA4B33qq2qqq222222q2222q333A33333131313131313131313166666 ^4 .432rr2v2t3ArA3B3AA432111111111223r3333333131313131313131313131r3333 .432rr2v2t3ArA3B3AA432111111111113r3333333131313131313131313131333333 .432rr2v2t3ArA3B3AA4321111111111111r11113333313131313131313131313131313r3r3r .432rr2v2t3ArA3B3AA4321111111111111r1133333313131313131313131313r16666 .432rr2v2t3ArA3B3AA4321111111111111r111133333131313131313131313131666666 .432rr2v2t3ArA3B3AA4321111111111111r333333313131313131313131313131316r6r6r4 =i)Y"2211A11A12A2211qq11111111112333222121q2q2q3q3#2211A11A12A2211qq1111111111222233321q11q2q2q3#2211A11A12A2211qq111111111122222122212q2q2q2q12#2211A11A12A2211qq11111222222121222q22q211q31q312"2211A11A12A2211qq111122222212121q3r3q43"2211A11A12A2211qq1111122222212q11r1q2333#2211A11A12A2211qq111111111122233332q1q11223#2211A11A12A2211qq11111111112222212221q2r2q2212#2211A11A12A2211qq111111111122222212122q22q22q113q1312"2211A11A12A2211qq1111111111222221111213q13q4q4q34R  P)   ?   X U 4  #754 4 4 3A 3AA2AB2A2BB2A3A3A3AAA3AA3AA3A3BA4A4AA5DA5AA5A5A6AA6A7C7CÁ6Bq5qC4qCq4qB2Bq1qAqrAr#876 6 5 4 A4AA3BA3A3BB3A3A3A3AAA3AA3AA4A4AB4A4AA4AD4AA5A5A6BA7C7F7D6Cq5qC4qCq4qB2Bq1qAqrAr#986 5 5 4 4AA4BA3A33BB3A3A3A3AAA4AA4AA4AA4AB4A4AA4AD5AA5A7A7BA7D7F6Dq5qD4qCq4qB2Bq1qAqrAr#754 4 4 4 3AA3AB2A22BB2A3A3A3AAA3AA3AA3AA3BA4A4AA5DA5AA5A5A6AA6B7Bā6Cq5qC4qCq4qB2Bq1qAqrAr#754 4 4 4 3AA3AB2AC22AA2BA3AAA3BA3AAAAA3AA3AA3AA3BA4A4A5BA5CA5A5AA6A6B7CÁ6Bq5qC4qCq4qB2Bq1qAqrAr4b y]q%m33~~3yUUy2xRRx2wQQwwQQwwQ្QwvQ។QvvQ។QvuQ៖QuuQ៖QutQ៘QttQ៘QtsQ៚QssQ៚QssQ៚QsrQQrrQQrrQ QrrQ QrrQ QrqQ QqqQAAQqqQABQqqQAQqqQQqqQBBQqqQAQqqQAQqqAqqAAAqqAAqqAAqqAAqqBAqqAqqAAqqDAqqAAqqAqqAqqAAqqBœqqCÁqqᜁBqqqᛁqCqqqCqqqqBqqᘁBqqqᗂqAqqqᖂrArqqqAqqqqqqqqqqᔁqqᔄqqqqᔂqqqqᔂqqqᔂrqqᔂqqqᔂqqqqᓃqqqqᓃqqqqᓃqqqᓃqqqᓃqqqᓃrqqrqqᓃrqqᓃrqqᓃqqqqᒄrqqqᒄrqqqᒄrqqqᒄrqqqqqqqᒄqqqqᒄqqqᒄqqqᒄqqqQᒃqqQqqQᒄqqQqqQᒄqqQqqQqqQqqQᒄqqQqqQqqQqqQᒄrqQqqQᒄrqQqrQrrQrrQᒃqrQrrQᒃqrQrrQᒄrqQrrQᒄBqQrsQAQssQᒃAQssQᒃAQstQQttQᑃAQtuQAQuuQBQuvQA QvvQA QvwQA QwwQA Qw2wQ Qw2xRRx3yUUy3~~3%G33~~3wSSw2vRRv2uQQuuQ។QuuQ៖QuuQ៖QutQ៘QtsQ៚QssQ៚QssQ៚QsrQៜQrrQQrrQQrrQ QrqQ QqqQ QqqQ QqqQAAQqqQABQqqAqqqqBBqqAqqAqqAqqAAAqqAAqqAAqqAAqqBAqqAqqAAqqDAqAAqAqqAqqAAqqBœqqCÁqqᜁBqqqᛁqCqqqCqqqqBqqᘁBqqqᗂqAqqqᖂrArqqqAqqqqqqqQqqQqqQᓁqQqqQᓄqqQqqQᓂqqQqqQᓂqQqrQrQrrQᒂqQrrQᒂqqQrrQᑃqqQrsQqqQssQqQssQqQstQqQtuQrQuuQrQuuQrQu2uQrQu2vRqqRv3wSSw3~~3/133tt3yTTy2wSSw2uR㟖RuuQ⟜QuuQ៟QutQ៑QtsQ៑QssQ QsrQ QrrQ QrrQ QrqQAAQqqQBAQqqQAQqqQQqqQBBQqqAqqAqqAqqAAAqqAAqqAAqAAqABqqAɞqqAAƞqqADžqq៑AAŸqq៑AǟqqQ្AǞQqqQBAQqqQ្DßQqqQ្FQqqQ៑DqQqrQqDQrrQqCqQrrQqBQrsQBqQssQᙂqAqQstQrArQtuQqAqQuuQqqQu2uRqqRu2wSqSw3yTTy3tt33,33vv3xUUx2wR埒Rw2uR⟜RuuQ⟟QuuQ៑QutQ៑QtsQ៑ QssQ៑ QsrQ៑ QrrQ AQrqQ៑AAQqqQBAQqqQAQqqQBBQqq៑Aqq៑Aqq៑Aqq៑AAAqq៑AAqq៑AAqq្Aq្ABq្Aɟqq្AAƟqq្ADqq្AAŸqqQ្AǟQqqQ្AǟQqqQ៓BAQqqQ។CğQqrQ៓FQrrQ៓DQrsQ៑CqQssQេqCQstQqCqQtuQqBQuuQ☁BqQu2uR╂qAqRu2wRrArRw3xUUx3vv3<,33{z3Bt2zS埓Sz2xR㟝Rx$"⟟tqwQ⟒QwvQ្Qv#"្ vtQ៓ QtsQ។ Qs$៓A rQ។AAQrrQ៓ABQr។AqqQ។BBQqqQ។AQq៖Aq៖Aqq៖AAAq៖AAq៖AAqq៖Aq៖BAqៗAqqៗAAqq៘DA!qQៗAAQqqQៗAQqqៗA"rQៗAAQrrQៗAŸQrqqៗCß"sQៗCÁQstQ៕BqQtqr៓qC񁟑!vQ៑qCqQvwQqBQwq⚁BqQ!q2xR㖂qAqRx2zSrArSz3qq"3{z3<,33!ft3Bt2zS埓Sz2!!"!㟝at$"⟟tqwQ⟒Qw!!"្w#"្ vtQ៓ Qt"!។ $។ rQ។AAQr។ABq។AqqQ។Qq។BB៕Aq៖Aq៖A៖AAAq៖AAq៖AA!៖AAq៖BAqqៗA!qៗAA!qQៗDAQqrៗAA"qៗA"rQ៖AQrៗAA#qq៖BŸ"sQៗCÁQsqq៕Bq!qr៓qC񁟑!vQ៑qCqQvqqBq⚁BqQ!q2xR㖂qAqRx2rrArq"3qq"3{z3<,33!ft3Bt2""埓t2!!"!㟝at$"⟟tq$!⟔w!!"៕w#"។ v%។ "!៕ $។ ៕AA៕BAq៕Aq៕៕BB៖A!៖A៖A៖AAAៗAA!ៗAA!ៗAAqៗAB!qៗAɟ!qៗAAƟ!r៖ADŸ"rៗAAŸ"qៗAǟ"q៘Aǟ#៘BA#qqៗDß"qៗF!qq៕Dq!qr៓qD񁟑!qr៑qCqqqBq⚁Bq1!12r㖂qAqぱ"2rrArq"3qq"3q##r344(  3A2A7A2AD22AB2ABA2A2A1AAA1AA1AA2A2BA2A2A3DA3A3A3A4AA4B5C5C5B5C6B7A 3A2A7A2AD22AB2ABA2A2A1AAA1AA1AA2A2BA2A2A3DA3A3A3A4AA4B5C5C5B5C6B7A /A 3A6A2A4B2AC22AB2ABA2A2A11AAA1AA1AA2AA2BA2A2A3DA3A3A3A4AA4B5C5B5C6B7A 3A6A2A4B2AC22AB2ABA2A2A11AAA1AA1AA2AA2BA2A2A3DA3A3A3A4AA4B5C5B5C6B7A 4A5A3A5A3AC33AB3ABA3A2AA2AAA2AA2A3A3AA3A34D4A4A4A5AA5A5D5C5C6B7A 4A5A3A5A3AC33AB3ABA3A2AA2AAA2AA2A3A3AA3A34D4A4A4A5AA5A5D5C5C6B7A 4A5A3A5A3AC33AB3ABA3A2AA2AAA2AA2A3A3AA3A34D4A4A4A5AA5A5D5C5C6B7A:i 3A6A2A4B2AC22AB2CA2A2A11AAA1AA1AA2AA2BA2A2AA3DA3AA3A3A4AA4B5C5B5C6B7A 3A6A2A4B2AC22BC2B2A2A11AAA1AA1AA2AA2BA2A2AA3DA3AA3A3A4AA4B5C5B5C6B7A 3A6A2A4B2AC22BC2B2A2A11AAA1AA1AA2AA2BA2A2AA3DA3AA3A3A4AA4B5C5B5C6B7A 3A6A2A4B2AC2BB2A2A2A2A11AAA1AA1AA2AA2BA2A2AA3DA3AA3A3A4AA4B5C5B5C6B7A 3A6A2A4B2AC22BC2B2A2A11AAA1AA1AA2AA2BA2A2AA3DA3AA3A3A4AA4B5C5B5C6B7A 3A6A2A4B2AC22BC2B2A2A11AAA1AA1AA2AA2BA2A2AA3DA3AA3A3A4AA4B5C5B5C6B7A 3A6A2A4B2A2BB22A2A2A11AAA1AA1AA2AA2BA2A2AA3DA3AA3A3A4AA4B5C5B5C6B7A!532 2 2 2 1AA1ABABBA1A1A1AAA1AA1AA1AA1BA2A2AA3DA3AA3A3A4AA4B5C5B5C5C6B7A!532 2 2 2 1AA1ABABBA1A1A1AAA1AA1AA1AA1BA2A2AA3DA3AA3A3A4AA4B5C5B5C5C6B7A KIe831136e853211112346e:865432221111111122234466:e:866544332222111111111111222233445668:e:876655443332222211111111111111112222233344556678: L21 1 1 1 4c   ud>?4<6q;q6:q5q:q481q7q6qq5qq5q5qq4q4qq4q4q4q4q4qqq3qquq3qrt3qqqt3qrw3qqv3qrv3qru3qqru3qrrv3qqsv2qqsu2qrru2qst2qss2rw2qqs2q2A2A3A3A3AA3Ar3AAq3qBq3q3q 4q 4q4q4q4555555A5B6A6A7A 8A : >?4<6q;q6:q5q9q471q6q5qq5qq4q4qq4q4qq4q3q3q3q3qqq3qquq2qrt2qqqt2qrw2qqv2qrv2qru2qqru1qrrv1qqsv1qqsu1qrru1qst1qss1rw1qqs1q1A2A2A2A2AA2Ar3AAq3qBq3q3q 3q 3q4Bqq4Aqq4Ã4Ã5Ă5AA6Aƒ7ƒ7AA8‚889 9 : >?4<6q;q6:q5q9q471q6q5qq5qq4q4qq4q4qq3q3q3q2q2qqq2qquq2qrt1qqqt1qrw1qqv1qrv1qruqqruqrrvqqsvqqsuqrru1qst1qssrwqqsqA1A1A2‚A2AAAA3AAr3AAAAq4qAAqBq5qABq6q 8q 8q8q8q88888888889 9 : >?4<6q;q6:q5q8q471q6q5qq4qq4q4qq3q3qq3q3q2q2q2q2qq1qr1quq1qrt1rv1rqu1qyqqrvqqrvqrrvārsvAqsvABqsuBCqsuBArttrAAqtrqrqqrq1 A22A7A7A7A7AB7Br7qAq7qq8q8q 8q 88888888889 9 : >?4<6q;q6:q5q:q481q7q6qq5qq5q4qq4q4qq3qq3sr3rv3rv3qw2qy2qqw2qqw2qqw2qquq1rqtq1qrqq1rur1rsqqrqsAvABuABBDrrAqqq1q1q1q1qA1 qAq11Aq22B33B7AAq8Aq8Br8AA 8A 8A888888889 9 : >?4<6q;q6:q5q:q491q8q6qq6qq5q5qq4q4qq4q4q3q3q3q3qq3q3q2q222qq1sr1rv1rv1qw1qy1qqw1qqw1qqw11qquq11rqtq1qrqq2rur2rsq2rr2Aqs3AAt3ABs3AB4Bq4qCr5rrB6qrB7qA8qA8Ar8AAq8AA8B8A8 88889 9 : >?4<6q;q6:q5q:q491q8q6qq6qq5q5qq4q4qq4q4q3q3q3q3qq3q3q2q222q2q1q1q1r1r1r1r1r1r1tq1v1v11qt11sqq1vq1wq1xq1xq1qvqq2rvqr2ruB2rsrB2qqA2AqsA2AArrqr2ABuAAq3ABAA3qB4q A451 8889 9 : >?4<6q;q6:q5q:q491q8q6qq6qq5q5qq4q4qq4q4q3q3q3q3qq3q3q2q222q2q2q2q1r1r1r1r1r1r1q1q1q1q1q1q1q11q1q11rq11rr11rB11rB1q1qA2Aq1qA2Aq1Ar2qA1AAq2q1AA22B2A1A3B1 2B12C12B112A32A3 2A4 36 g 3qqq2w2qqqq2sq2y2vr2wq2vr1wrrvqrtqqrtr1rr1tr2tt4w 3tq2w2w2qt2sqqq2wq2vr1xqxrrusqvqqrtq1rrr1rr2ss3wq5v4S C~ ( '>?4<6q;q6:q5q:q481q7q6rq5qq5q4qq4q3qq3q2q2q2q1q1qq1qqqqq1q1q1‚AAAqArqqq1q1q2BÁq3BBq 5AÁq6Aq7qq7qr7r7qq7rq7rq7qq7q7777778999 9 9 : >?4<6q;q69q5q8q461q5qq4rr4qÁ3qq3qƁ2qBÁ2qA1qAAqqqAqqAqqqqqqqqqAqƂAAqAƁBq2qtrtqqqq2 qq6qq6qq6qq6q6q6r6qr6qr6qr6r6r6r6qr6qq6qq6qq6qq666667 7 8 8 8 8 9 9 : >?4<6q;q69q5q7q451q4qq4rr3r2rqrrAāqAŁAAqABAqBAqAAqAqqArAsqrqrqq1qqq6qq6qq6t6t6qq6qq6qq6qq6qq6qq6q6q6r6qr6qr6qr6r6r6r6qr6qq6qq6qq6qq666667 7 8 8 8 8 9 9 : >?4<6q;q69q5q7q451q4qq4rr3rq3r3r22B1DŁAAAAAABBAAqqBAsAAsqqrqqqqqqqqqqqq1t13t6qq6qq6qq6qq6qq6qq6q6q6r6qr6qr6qr6r6r6r6qr6qq6qq6qq6qq666667 7 8 8 8 8 9 9 : >?4<6q;q69q5q8q46A1q5qq5rr4sq4s4rq3rq3qqB2qq1qrAA1rAA1rCqBqABqAĂăAAqABqAArAtqt1qrq2rq11rq6rq6qq6qq6q6q6q6qq6qq6qq6q6q6q6qq6qq6qq6qq6qq6q666677 8 8 8 8 9 9 : >?4<6q;q6:q5q9q47A1q6qq5rr5qqr4qq4rq4qqq3q3r2q2qB1qƁ1qrAAqrAAqrCqBqAqqqqqqqqqrqAqAŁqA1qADŽ12rB1t3t7rq7qq7qq7qq7qq7qq7qq7rq7rq7t7qq7qq7q777777888 8 9 9 : >?4<6q;q6:q5q9q47A1q6qq5rr5qr5qqq4q4q4qq3qq3q3q3q2qq2qq2qq2q2q1q11q11q11qA1q1qqA1rqAA1rqC1rqB1rqA1qqq1qqq2q2q2q3qqq3q4q5q6qq6q7q7rA7rq7qq7qq7q777777888 8 9 9 : >?4<6q;q6:q5q:q48A1q7qAq6rAr5qAq5qqq4qq4q4qq4qq4q3r3q3qq3qq2qq2q2q2q2q2q2q22q12r11r11r11r11qq11qq1112q2qq2qq2qqA2qqAq2qqAq2rqq2rq 3rq 3qq3qqq3qAq4qAƒ4AÂ4AÁ5q5q6q888 8 9 9 : >?4<6q;q6:q5q:q48A1q7qAq6rAr5qAq5qq5qq4q4qq4qq4q4r4q4qq3qq3qq3q3q3q3r3r3r3r3qq2rq2rq12rq12rq12qq12qq12q12q12q13qq3qq3qq3qq3qq3qq3rq3rq4rr4qrA4qrA4r4555A5B5B5A5B6A 116A 117A 118A 11: 41>?4<6q;q6:q5q:q48A1q7qAq6rAr5qAq5qq5qq4q4qq4qq4q4r4q4qq3qq3qq3q3q3q3r3r3r3r3qq2rq2rq2rq2rq2qq2qq2q2q2q3qq3qq3qq3qq3qq3qq3rq3rq4rr4qr4qr4rq4Bq5A5A5A55A5A5B6A 6A 7A 8A : 4 y6S \        CBBEEBDCBB CBBEFBFCBB AAAAAAAAAAACAAAAAECCBBBBBBECBEDDBBBBBBEDB k         4F oo GQA 1A1B1qBBqA1Bq2A1q35q26q27q8q9:; 1A1B1qBBqA31Bq32A1q35q26q17q18q9:;(AA22112(8q>qq?6q5q4q?5q8qA11A1AB11(:q52q1q8q61q8qq1q21q1q9q1q3q3q6111q12q1q6221q15q2q1q11q4q1q41q2q1q1q4q3qq1q1q511qqt1q5q222q4q7q2q4q1Aq1q1q51A1s511A11qq3q1q1Aq141qAqq1q1q2q21AA2s51q11q2q1B11q14rAA1141q2q21q1AAq13qAA121AAA2qBAA421q1A11BqBq11AB1ABAA1AAB2A124q4q5(>2r1q1q91q2q2q7q113q4q7q52r7q21q1r2q:1q1q1q6q11q2q6q512722s16111q12q9q1qr271q1128111q3q111q22q7qAqq1421q6A1q2311rA11q15qq1r11q3q11A1qq1q2q21A1q11q2q1B113AA21qAA1A3AAAAA21qAqAAA421A2B1AqBq11AqA1B1A1AA2BA1A123155(:q52q1q32q8q61q21q2q2q8qq1q21s13q9q1q3q1q1q32r6111q12q1q1q1q6221q131q2q5q2q1q11q11q4q1q41q2s1q24q3qq1q12511qqtq115q222q4q1q17q2q11q4q1Aq1q1q1311A1r11511A11qqqA13q1q1Aq12141qAqq1A12q21AA2qsA124q1q2q11B1q11A4rAAq11A1211q1q1B1q11AAqA3qAA1qA1211AAAAAA21qBAA1qAqAA22q21A211A12B11A2A1q1AqBq112AB1AqA1A11BBA1AA111AA21A1BAB11A2A111A121114q1414q535(>2r1s7q;q2q2r8q7q33q3qq1q4q1q7q52r2q1q3q7q21q1r111q:1q1q1q21q6q11q2q1q2q1q6q51q1q41q722s11qq1q6111q11rqr9q1qr1q1271q112q2q811qAq13q111q21A17qAqq11A1421q1q1Aq6A1q1qAq311rA1q11AA5qq1rq3q11A1rB2q21A1q1rAA2q1B1q3AqAAA21qAA1qAA3AAAAAAA21qAqAAAqBA21A11q2B1A11AqBq1BqA1q1AqA22AB1B1A11A1B1AA21A1BÂ1AA1AB1A1121A1211131311q58q5 )B211A1123211a1q1a1c1qc1aa1aa11a1112222121111313343211A1123211a1q1a1c1qc1aa1aa11a11122222121112233211A1123211a1q1a1c1qc1aa1aa11a111223333221233211A1123211a1q1a1c1qc1aa1aa11a1112222121212222122211A1123211a1q1a1c1qc1aa1aa11a11122221212121111212121 , 211qq1A123211qeaccbaab1q22222212121222222222222211qq1A123211q1eaccbaab1q22111121212121222222111qq1A22AA2A11q11q1eaccbaab1q1122121122212111qq1A22AA2A21q11q11q11abacbccabq1212112112111qq1A22AA2A21q11q11q11111212112112111qq1A22AA2A21q11q11q11aaaa11a1b1a11Aa1a12111qq1A22AA2A11q1q1q1aaaaaa1b1b111A11a112111qq1A22AA2A11q11q11q11qa11a11aa1aa1a1aa1212112221 211A11121a32a2b1a1qa1b1qa121212qa2a2a2a2a2212121222222222222 P^Y#2111qq1A22AA2A11q11q11q1111q11a1a1a1aab11a11a11a2121 2111qq1A22AA211qqa1q1111qaa1aa1aa1a1aa1a1a11121222222222222 32a12a1a2aqq1a2aA1a1a12a1a1AA2a21a1aq21q113q33q3333131212122222222222222 3222qq2A33AA322q21q1111q1122q222221a3a1a2b12ab112a313a313a314a3143131313 4333qq3A44AA433q32q221q12112q13131341424233333434343434a21b3a1e 3222qq2A33AA211q11q22q1212q121313131313132323232313131a111b33a1e 4333qq3A44AA311q212q2323q2424q24232212313141414141414466 4333qq3A44AA332q22q221q2121q1212344141414131323232323231 544A4456544q44q33q3131q3113131562626263636363636366 4333qq3A44AA444q43q33q1313q12121444141414141424242424231 444A3444444q44q33q312q1211312122212121313131441465 3222qq2A33AA221q11q111q1111q1111233131313121222222222221 9j7q1q1q6qaaq6qgq6gq6bqaq7qqq7q1q1a6e6qacq6caq6qaq7qqq=a=b7q1q1q1c6qaaq2c6qadq1b6baq2a6bqaq27qqq43a3a3b2q1q1q3b1qaaq3a4bqgq1a4agq5bqaq7qqq7q1q1q6qaaq3ac3qgq1ad1gq2b1bqaq7qqq4_ \(;Naex      #'+/ 2211A1123211q11qqq11222222232313141211A1123211q11qq1q111222222232313141211A11232121q2121q1q1111111222222232313141211A11213222111q111q11211111222222232313141 211A111213212211112141qq1q111222222232313141 211A111A221311211111qq1q111222222232313141 433A313A241511413333q33q33q333441413132323222232"766A616A271811716666q55r55q556665544131314166"877A717A281911817777q66r66q666522111141466666 +&<<<:99992:1;1:19998q8q7r7q6q514132231777666667'::::999A99444352567q8q8q7r7q6q762311124177666667 #988A88899865q4q4q6r6q5q662311124166666667#988A88899987q7q766q5q662311124166666667 6g;::A::;754q3333q6r65q16163545352434332231314q1516199178521522312311333244q6qqA4qq121122211;<1161514q132332434352535463615q166r33q334q57;:::A:; 33q344343q42525152626155313q3q44q21221q212q33417666A67993:2:2;1;1<2;2;1542431332323313q445q632424252A526239876776246241612121222qAqq11qq34123112212234  211A1123211q11qqq112222121212222122211A1123211q1qqq1111222212121111212121211A1123211q11qqq112222121111313343211A1123211q11q11q11q11122222121112233211A1123211q11q11q11q111223333221233211A1123211q11qq111222121212222122211A1123211q1q1112221212121111212121211A1123211q11q1122212121121313343211A1123211q11q11q11111222221211112233211A1123211q11q11q11q11122233321112332111A123211q11q11q11q111222121212121212121214  $ 9D9192322333A13111 2 3qq227192;<7333326342122A31122q2q4t6q7181291:2:;;.8752141A411111q2334q41536q26q77717788899:;;;;#215q21q1252q54231314455688 21213111233433 v[HKOSWG=>??1?3?4G9::;<=>??1?1?2?3?4?4?4?4G55677889::;<<==>???1?1?1?2?2?2A?1?2?2?2?4?4qG223344455667788999::;;<<===>>>A=>>>2??1q?1?1q?2?2q?3?3q?4?4?3?3?3?3?3?3?4A1112223334444555666777888999A8999:14:2:1:1:999q82q722642642<2;1;1:1::;;;;;:/111122222333A23332332214131q32q14r5q6q677788818191:3:2:2922323141111222 !%)-1vXA?9?9?:?:?:?:?:?;?;?;?;?;=?5?5?5?5?5?6?6?6?6?6?7?7?7?7?7?7?8?8?8?8?8?8?9?9?62?61?71?7?7?7A?6?7?7?7?8?8?8?8q?8q?8q?8r?9q?:q?:?:?:?:?:?;?;?;:??????????1?1?1?1?1?1?1?1?1?1?1?1?2?2?27?26?4?2?A1>??4?3?12?1?1?1q?1q?1q?1r?2q?3q?3?4?43?41?4?41?51?5?5?5?6?6?6?6?59999999999999999999999:::::1:181828A4748485859999q9q9q19r:q;q;::::2:11:1:2:22;;:9 833333333333333333333333333311111A111111122223232q22q22q221111111112221181111112122111124 5HP 222A12221443q313q21211q24q33222222222232323q323258q7 444A343342q13q43q334321112123324455q4 !33313131A3333444q44q4444443333221q222222222q1 666A566665131212554433212222121414151q5q566 444A1112112121q23415555543221222221313q4131677q6 !55333A233344q44q44q444443333313131q4241455q4 33323A1213131344q44q44q433344333312223242424q242q31 dI$Aq$1111A11111111111q$3333A33333332222221111111111q $7777A766666555444313132323232222211111q3324 ZQ$:1<<52?652?6?13937251>6?13937251=52;419251253265222124123222212521552111141111111252154211114111111125211442111114111111111125111144211141111111112511114411143112111252111441124311211125222151433243211232212??=??=??=??>:"???6??7=3342331212145211121121112511111112111151111111111121111111115111113111311111111115111311311111111115113113111111111152243141111111111262;?=9;?=9;?=;?==??5252=3937251=3937251=192512532612322221252151111111252151111111252115111111111125111151111111112511115311211125211153112111252221532112322122"?6?26>3=5233232362141121211511411211115114111211111151114132111111151141311111151513111111524141121123724:?:4:?:4:5?139372?1393722;4192512222124123222212211114111111122111141111111221111141111111111221114111111111211143112111211243112111233243211232212===>V*3??8?3?13??8?3?1222322222132262122321521111311111111511112141111111111111151111214111111111111111111116111131114111111221111111111111411111111411112211111111114111111141113311111111114211111142224422221122126223321152?:?=?;?:?=?<?:?1636?15141;?15141;?12211141132242332?11125221121111?11126121111111?111271311111111111=211362111111111111111=1136111111111111=1136111111111111>3237332212212321???1???1???1?;2?13?:1783?:13225222?:212115211?:41115211?:41111521111?:211131521111?:1113141111?:1113141111?;2113252221J?2?653?22>3?231113=1233232361121112236211121211511211121151111211115112111211511111211111151131113115111132111111151111111111151113111111511111111511131111115111111115214112112373211222372:???<:???<:186?4285?4285;727825;725182223326221213381111161112128111116111212811111111721113111218111111315211111111218211113521111111118211113521111111118222324622222112111,???5961212226216111115116111115116111111115111611111111511611111151611111152611232272??4??42?729;93271;931221361232212112521121121126111211113711111311111152111111111111141111311111411113111231533334   <$ <<;;A;;;<<<;;A;;;<<<==>>q>q>;;::A:::;;;<<==q=q==q=====<<1<1<1<1 #999A899::5352q67889:q:::::99191919192:1:192; %666A5667777q77q64466q7777661616161627171628"333A2334444q44q44q32q2144433131312122232313235222A1223333q33q33q33q32221111112121313132 2111A123211q11q11q11q1112221212121212121212111s+V?5?5?5A?4?5?5?6?6?6?6q?6?7q?7?7q?7?7q?7?6?6?51?5?51?51?52?52?52?62?62?51]?3?3?3A?2?3?3?4?4>3>2q??1?2?2?3?4q?4?4?4?4?4?3?31?31?31?31?32?41?41?41?42?33?33d>>>;2;2;2;1;1<1<<==>???q??q????>>>1>1>2>2>2?2?2?2?12?12?12?4?4]97171A6616616116778::q::q:::::99191919192:1:1:1:29393 P64141A331331311344577q77q7777766161616162717171726363 ;42121A111111111122355q55q5555544141414142515151524343)333A2334444q33q32q2444433131313132323232222231333A2334444q44q44q44q4333221212222232323126&?3=:8654332211111122334568:=?34-.?:a??8a?8a1b?7aa5?6a1a6865aa7866aa6863aa88244a834233a:33323:423124441435355q36265q3626q6371235382a2538q2q3q539q2a3529q1cqa252:1bqaq26q2:3aqa262:4aq262:5a262:5a352:952;q:52;::52;9:52;852;74i424464aAaAaAaAa422354aqaqaqaqa422bb331d421aa211aa1bbs1AAAAAsa1qqqqata2|wb2AaAaAaAaAaqc3aqcqcqdAaAaAg3obaAaAaAaAd3oAAaAaAb1=111AA24 O5Wdafmbacbqcagqaaceqacbgqamqnqaaeerc cqbqrbafqaarrhraqcsaqnrcqobnqkaacaahqebbaabbeqfeaaqggqeaaqqEqqqqacqgaqrAAqqqefqIrAqffqqqBCrfbcrqABAAqbabqbcqCAqacbaBAAqbbaqBCEsbbaqqCCCAArbcAqBAqAqbaqAqAAAAqAbbqBBBAqaaaABAqaaqAABqaqqBAAqqABAAArAqqAqCBAqArCCAABsqqBABABArqqqBAqqqBrqCqqqBsqqBqrArBsqqrAqEqqArqqqABrsqqqADAvqqAqqArrAAqrBqsqqBqsqqqqqqqqrsrqsqrrqqrqrqrqqqrqtqqqqrqrqqqqrqqqqqsqqqsqAqqqqqqAqaqqCAqaArCqbaAAGqbaDGqaqaaEFqbqaaDFqarabqDEqaraabDCAqbbraabqqGAqbqeaaaadrEArcdqadqCABrbdaqaadBAAqcdaqacqAAqbdaqsaccqBArbeaqsbacqAAqqbdbtccqqAqqdfqqraddqqBqqecbqrsadesBrrecaqqraaberAqrdcaqqraaceqqedaqqsafdrredaqqsacbeqrsddbqsacbeqqdebrqsabcdrrchqqrqbcbdqrrdiqqqrbccdqrdfbrqqraccdqqcgbrqrabddqqcgaqrqracecqqbhaqr%k] ?e%u] f|%] }%]  mPoP v3+ 2E ?uEe 2E ?uEee*`EE<<;<4ރeRe<4DeSeee  `EE((;(4ރe Re (4De Se eeee",",,",e"e(DDDeDe)e*"> MFn FL* MFne#ee"ee'eYe e.> ' gUue* '#eeeee.3 dFxl x3 dFxle #eee x3#e e!e!Z x3#e#e!e!.>#6e( ' gUue 'e'e&e%e$*V?~(qVS-W?f PZ}I Get your goods here and then get going!! CALIFORNIA GOLD won't wait!! You can't see the poster from here.There isn't a poster around here.This part of town is full of seafaring men when the ship is at the dock.Whenever the ship is at the dock, seaman are seen around town.This man takes pride in his heritage as a sailor!There is no one around.The man isn't close enough.This ship worker says, "Uhhhhh, I'm waiting for the ship to leave."This ship worker says, "Uhhhhh, I'm ready to get back on the high seas."This crewman says, "After being at sea for so long, I'm having to get my land legs back!"This sailor says, "I have been riding the high seas all my life and I love it!"The grocery and hardware stores make up this part of town.The boardwalk is just outside of these stores.Everyone in town loves these streetlights.Here, in front of these stores, Water Street turns and heads toward Fulton Street.This hardware store is one of the most prominent businesses in all of Brooklyn.The grocery store is a booming business in this part of Brooklyn.The most prominent businesses in Brooklyn are located here in this part of town.Through the hardware store windows you can see all kinds of hardware.Just look at all that good food in there!The grocery and hardware stores have windows.Just walk up to it.What a pretty magenta canopy!There is no door close enough.This is the door to the hardware store.This is the door to the grocery store and there is a note on it.This is the door to the grocery store.This door is locked and there is a note on it..The door is already open. The note says, "GONE TO CALIFORNIA!"What note?The shelves inside the store are bare!The note is securely attached to the door and you cannot remove it.For what?What good will that do right here?This door isn't locked!You have no key for this door!If you want to look at the hardware, you ought to go in the hardware store.If you want to see the groceries, you need to go into the grocery store.As you look around you can read "Fast Grocery" and "Rand's Hardware."4s li5:bb b$ z4z4z(4z<4zP4zd4zx4z4z5HE!)5%]Y6 $++/#:$,!)5+/6 % s#:!)5+/6%A3#:7 x!):+-CX%#FQ!):+-CX%N6 #!):+-CX%f6 #!):+/-CX%}6 #&!) ]q%r%q+6# Q"q Qe QW $ Q:v Qk QZ $ QR{ Q8v Q"h Q]$$(7  V #Pwx6 1E6 l}8 l} 6 l} 8_PeF ekyy6 1E6 ekyy 1E)ޥ6XR2e e8c c wMgS//ee(@eScSce  c S Sc eee Z e   ^ ^ ^   cc ^ c^c (ee\eSS$e e eee\ee]SSSZS=SS $ee]](]](]((=(==e>C&6u~ WNpThis is the dock that the ferry to New York uses. You see a man guarding the dock.As you look across the East River, you see the city of New York. It amazes you that you have never had time to travel as far as New York!This is another view of the East River.Stationed here at the gate is a man whose job is to guide the huge ferries into the dock.The guard says, "Hi, Jerrod. I haven't had any ferries to guide into the dock today."These gates are kept locked until a ferry arrives.Well, here it is! This is the ferry that will take you to across the East River for the first time since you moved to Brooklyn!You see no ferry. However, one will show up sooner or later!There are two small booths on either side of the gate that house the ferry guards.This is where Fulton Street comes to an abrupt and watery end. Maybe. This gate is to keep people, such as yourself, from getting hurt when ferries are coming and going from this dock.New York City is on the far side of the river.One false step and your life is over. Watch your step!The guard says, "I don't sell tickets. Sorry, Jerrod."It won't be long and you will be headed for New York City!The guard says, "The ferry comes to Brooklyn when a stage needs it."The guard says, "I can't do anything with your ticket, Jerrod."You say to the guard, "Good day!"You don't have a ticket."The ferry only comes to Brooklyn when the stage company requests it."You have more sense than that! That water is cold!!4x p 678:FVZbb b!b"z4z4z(4z<4zP4zd4zx4z4z6GYz6=]!)6+//6 %=]C#:z6' 74!)8+%#Qp+%p#Q! 7Z!):+-CX%N#!):+-CX%f#!):+/-CX%}#Q1GQIGQaG7!)% %B]# $ 3e1EW   C) / 9Ie y :dM/+%p#Q+%#Qp cdMX)V)F)Z+%#Q +%#Q    $'klFGkl 6[@c c!;I 6[@c;K  :c" QQQ07  P\Z\% [\m\%: n\}\%R ~\\%o \\% 4UG_}+-X~EThis is your boss. He's the number one man at the Brooklyn Evening Star.This young man works at the grocery store.This short man works at the livery.The short man says, "Hi, Jerrod. Stop by the livery sometime."This man and wagon are flying down Fulton Street!There is no one around.There is no one close enough.The young man says, "Have a nice day, Jerrod!"Your boss, as usual, says, "Keep up the good work, Jerrod."The man on the wagon cannot hear you over the rumble of the wagon.You see the stage travel building, the grocery store, the hardware store and a portion of the livery.This is where Water Street and Fulton Street intersect.There is no wagon here.That is a smooth-running team!You are outside the "Stage Travel" building.You notice nothing unusual about the door on the left, but there is a small note on the other door.To get a good look you need to be closer.The note says... PLEASE USE OTHER DOOR You are unable to open the door on the right.The stage travel building has inscribed on its wall, "Stage Travel."You are not close enough to any door!This light shines brightly when it is dark.You don't need the note.You are riding on a stage!You can't do that now!This is a nice-looking stage!The grocery and hardware stores are not far away.The livery is close by.4 y/# z/rn z4zx4z4 / (:Vbbb z(3N z(W z(3 z(tH 7z( ާ!)(+ +0L6&# !)(+/%=tCX#F!)V%,jX#77{!):+-CX!):+-CX!):+/-CX!)(+/-6 7%N%f%~%t7%4%L%d%{t#:#:#:#:!)% n%#Y( ݂0LR+( ݂ R+K#@ +/I +/I +/Id0 +/z(=tdc w Mg ;t>teE 9eM)(+/2;2<2=2> ( I( QJjQ,j (f5k ߗ (f5k wP Q;jZvQ Q6x [ wP  Q;j  Q,j  ['FG7#Q4GQKGQcGQ{tG77 7::::;;;;//<77 7 !7;;;QGQGQ0G7FFF79 M! ) + - / 6 % mX C # ! ) + 6 % mX C # I $ F ) +-/ ( 6I 9 K 6  $$$ $ 977" - X - Y7" -F X -F Y777"  X  Y>2 f}& f}z ee {}ee]]%]$]x]$ZZ$$      $$ $ $Z $ $ $Z       Z Z Z Z Z $    ^^^    $AE4 # ,10  e!        ^ ^ ^ ^ ^ ^ qEdP   < .^# / c;;;;7"  e!=.=]]...ZsA7e 777e 7 mzcX6Qveee+re  xE7) [  eD778 Se [  ee *E [  e  ; ; ,7e 77 SeeeEE7ee)e77 veeeEee;;,7e 77 veee)7ee# e$Ke%"e&rZre'e(0Le)re*1d@b~ 8<Z =`<]r<T> The stage is set, You best get on it!! CALIFORNIA GOLD!!You are not able to read the poster from here. The sign says " EMPLOYEES ONLY! ""Hi, Jerrod. Please wait outside. I will be right out to help you.""What may I help you with today?"There is no stage here now.The midget says, "So the gold in California is luring you away from Brooklyn. You surprise me, Jerrod!"This door is open only when the stage is ready to leave.The stage driver lets you know, in no uncertain terms, that you had better not do that just yet!Now what? %g69Yes?No?Get closer!!Sorry! The midget says, "So you've made up your mind to go for the gold! I hope you strike it rich!""Hey! Harry! Bring that stage on over here!"The short man says, "You cannot use that ticket here, Jerrod. You need to go to the ship dock!"You have determined that walking behind a horse is hazardous to your health.This is the Brooklyn livery.You are at the livery. You are going to see a few horses!There is no one close enough.This man is so short it is unbelievable!There is a man sitting on the stage.Just outside of the livery, there is a man sitting on the stage.You are in the stage by yourself!The midget isn't close enough to get a good look.There is no stage driver in sight!The stage driver has nothing to say!The stage driver cannot hear you from there.The midget cannot hear you at this distance.The stage driver says, "You need to show it to the short man."You don't even have a ticket!This stage is state of the art!!What about a ticket?This fence keeps the horses from wandering all over Brooklyn.It is just a typical window.These horses are not for sale!This is Fulton Street!Around these stables you really need to watch your step!The horse is not yours!There is usually a midget around the livery.The midget says, "So you believe those rumors about gold, Jerrod. You are a courageous young man!"The midget says, "So you believe those rumors about the gold. I hope you strike it rich!""But anyway, Jerrod. I can't help you yet, I don't sell tickets""I am thinking about heading West, but all I am giving up is a life of shoveling manure. You have something to lose!"4 ,z 4z,&> "FVz".c!)"+C/ /%.c6#:! )!  #J(%` K#(%`%Y%1f J(%# .[;[6  ;:I ;K :;G 0P;[  }#dMe#))V)F+%u#Q\+%#Q\ Qu Q  $  $'klFGkl d^^ 0P;[D+YD+YD+DYDYD+Y+Y++D+YD+YD+D++Y+Y++Ye"eeee.e e IED >/E 0>GC H>_F `>E >E Tj R+j ,R/] 0O5] ,^C^ hRv] wR] R\ k u ,p6t Qpau wn~o nv p qe ESe F/Qe 0DGNe HG_Ne `FsQRc Re tFQSc Se FQe Tie 6ON]e OO_Q ORg]e je k+te ,_Coe D^_oe `^voe w^me ]me u6e 7pDe EpPe Qvde bpou evoe pp~e we e ,e -Ce D[e! \pe" qe%^NNNNN`NN`6NN00NN00N> 6 `FQ'# @^c /01Q Qe#e$NNN  Qe2e3ZN e;e<KK++e& e'[e(e)e4`w e5e6<z5h @ 4 o W V V!ts=cThere are tombstones of every size and shape. Some graves have flowers on them.You need to get closer to a tombstone to read one! Bathsheba James, wife of Capt. William James. She was killed instantaneously in a thunder storm by the electric fluid of lightening on the sixth day of July, 1830, aged 36 yrs & 26 dys. In Memory of Sarah Prudden who with a happier world in view departed this mortal state July 27, 1788 in the 80th year of her age. Serene and calm the mind in peace, His virtues shone, with mild increase. In memory of Benjamin Rowe, Esq. In Memory of Miss Lucina Willcox, who Died May 7th 1800 aged 20 years. Death is a debt by nature due; I've paid my shot, and so must you. In Loving Memory of Martha Wilson 1839 Age 31 May she rest in Peace. Survived by her sons Jake and Jerrod. In respect for our father Marshall Wilson Taken away 1839 Age 33 A man whose steps are worthy to walk in. This great name to be carried on by Jake and Jerrod. Here lies William Deering 1838 Age 49 For me the world hath had its charms And I've embraced them in my arms, Courted its joys and sought its bliss Although I knew the end was this. In memory of Capt. Thomas Stetson Who was killed by the fall of a tree Nov. 28, 1820 Nearly 30 years he was master of a vessel and left that employment at the age of 48 for the less hazardous one of cultivating his farm. Man is never secure from the arrest of death. Charles Henry Gilson son of Xenophon & Mary Gilson, Died April 18, 1845 Age 6 yrs 3 mo 20 dys He was instantly killed by a stagecoach passing over him. In Memory of Samuel Barns, Son of Mr. Samuel Barns & Mrs. Welthy Barns whose Death was Occasion'd by a Scald from a Tea pot March 27th 1794 aged 7 months Here lie the remains of Humphrey York 1790 - 1839 I don't know how to die Resting in a Dreamless Sleep Clay J. Wright Died Jan 21, 1829 Going, but know not where. Sacred to the Memory of Della S. Angell July 20, 1840 46 yrs 3 mos 21 dys Those who cared for him while living, will know whose body is buried here. To others, it does not matter. In Memory of Elvira Wood Departed this life Nov 2, 1837 Here lies one Wood enclosed in wood. One Wood within another. The outer wood is very good, We cannot praise the other. This stone stands in Honor of Augustus R. Huge Mary Lefavour 1797 Age 74 Reader pass on and ne'er waste your time, On bad biography and bitter rhyme. For what I am this crumb'rous clay insures, And what I was, is no matter of yours. Now at Rest Dwight Hosokins A neighbor to the neighborless A friend to the friendless An enemy to those with no enemies Constance Marie daughter of Mr Jonathan Bellum & Luella Bellum Age 1 day Norma Sue daughter of Mr Jonathan Bellum & Luella Bellum Age 1 day In Loving Memory of my wife Luella C. Bellum Who, while attempting to give life to others, gave her own. Died 1838 Age 32 Mary Ann daughter of Mr Jonathan Bellum & Luella Bellum Age 1 day Bryan James The only son of Mr Jonathan Bellum & Luella Bellum Age 3 days Here lies the body of Josh Young Born Aug 19, 1802 Died Sept 29, 1839 Thirty-seven years of misery have finally ended. Here lies Wanda Shadow wife of Mr. Shadow Died Nov 6th 1827 Having had 13 children 109 grandchildren 281 great grandchildren 56 great great grandchildren Samuel Severe Born 1776 Died 1825 Life's a blessing that can't be sold, It can't be bought with all this world's gold. Buried in a grave ten feet deep lies Franklin D. Jordan Born August 10, 1771 Died September 1, 1831 Here lies the precious dust of Jarrett Dorman A desirable neighbor A tender husband A careful father A faithful friend This stone was erected in memory of Jeremiah Thorne Who resigned his life on the 23rd day of April 1837 A very nice thought, but get closer to a special grave.You don't have any flowers to give. In Memory of Colin MacKenzie A native of Scotland by accident, but a citizen of the U.S. by choice. Died June 23, 1839, Aged 61 Years A brick wall surrounds the cemetery.Trees surround the cemetery.The grass is well clipped.It is a dirt path.Although it is painful, you visit the cemetery occasionally. You have loved ones buried here.When you visit your parents graves, you bring a bouquet of flowers in their memory.It was a dark, damp, dreary, cold, rainy, windy, winter night many years ago that your mother and father were suddenly taken in an unfortunate horse-drawn buggy accident.How quickly and tragically they were taken. You never have, and most likely never will, understood why.There is a bouquet of flowers on your parents' graves.Flowers have been placed on a few graves.Many tombstones have crosses on them.Hmmmmm. An interesting idea, but it won't work here!You don't have a letter!You are near your parents' graves.You already have some flowers.These flowers are not yours.41 =$ 3>bbz4z4z(4z<4zP4zd4zx4z4z=- z= z=* z=r z= $z=Y !)=$ +/+/6 %E#:!$)3+%D )>+%aT6 =XC#PL7 !)%O#QSb+- QNh.+- QFw.+- QD.+- QD.+-  ;IL  $ MNc  ;IL 6   < !  QD+-c QFw+- QNh+- QSb+- QaT+-  U 8<88=88?88@88B88E88F88G88 H88 I88 J88 K88 N88< $eereS $ee(@e//S/ $ee>Dp@You have %v3 points out of the 60 points possible so far! Keep trying!!You have %v3 points out of the 60 points possible so far! Be careful in the parks!You have 60 points of the possible 60!! WELL DONE!The animal team and stage are waiting for the ferry.The ferry is approaching the Brooklyn dock.The ferry is pulling away from Brooklyn. You are on your way!The view of the East River and New York City is very impressive!You still lack something small, but valuable, that you will need in California.The ferry is pulling away from the Brooklyn dock. You are on your way!The ferry is inbound to the Brooklyn dock.You are now on board the ferry headed for New York City, the first stop on your way to California!4$A AZbb zAzLzAz zAWzAzA zA@r !)A+//6 %Fo#FL!)A+% G6XC#F!)A+/%X#F !)A+/% X#F!!)%P#)()GI)  /KF* F  ( )ZQ  Q)F PS  Q  Q   ( )A+/K F'FG IG# KG F4 ,06 1;6 X>]$ Z-Z0 $ 8 >->0 $ 8 W%Z/%>/#QL/ %Z[%>[#QL[ "#GIK F   &s -dm H z IVS -dme Hei z# eoeee IVee#eeee   -dme e   Heie&` -dm H z IV@ -dmeeef Heh z #eue IVeweeeefeh  e z ev x% e tx ee d*r e odr e IV e zIV eee'e >&D e s=E e 4+: e n4{: eeTeUeV2w  e 3ik e0e1 zIV e- z x% d*r odr IV >&D s=D 4+: n4{: e.e299 2 9^ 3ik  z x% d*r odr IV >&D s=D 4+: n4{:e zIVees  eOe "1 z tx odr zIV s=E n4{:e9e )4  z odr s=Ee. zIVee. txeAe!ZZede zIVe@e"Z zIVee" zIVeGe",,,,,,? zIV3c eHeJeKeLe eerreNeMT Te#Z,Z,Z, zIVe e#) )eLe%& e e)e+ ce(Z"'Z""'"ZG'ZGG'Ge/^,^axZ]x(Q+#E6! : 7 b & \ C l  B (k?u@Fo,h;=W id\uThere's no time for that!This is your boss' desk. He has a very nice desk.You are not close enough to a desk.You are so busy you don't even have a chair!When he left Brooklyn you wanted to go with him. Jake told you to stay because it may be dangerous.But he did promise that he would contact you if something important happened.This is not your desk!You lift the blotter, only to see those old newspaper clippings about your brother, Jake. Not needing the blotter, you put it back on the desk.You don't need the clippings. You read them so often you know them word for word.Jake's only alternative was to leave town and never come back.You have already quit your job.She can't hear you from here!With a sweet voice Lois says, "It is so nice to see you again, Jerrod. Don't be such a stranger! You work so much I worry about you!"This is your boss' office.When there is work to do, this man is eager to help. Lately, there haven't been any big stories.This room is full of office supplies.Mr. Weest, Jr. can't hear you from here.There is nothing important in your desk.This is the office of the company economist. He keeps you updated on the current conditions of the economy.This is your office and it is a nice office. The company likes to take care of its best performing employees.You have moved up steadily in the company since you started working here as a paper boy.You don't need to read a newspaper.Anyone else in town would love to have your job, but at times you wonder if you want to do this for the rest of your life.You reply, "I'm ready, go ahead!"...now as you look around, you see only a few familiar faces. Very few.As a result of a series of fast-moving events, the business has changed hands. Unfortunately, the boss you worked so hard for, and respected so much, is no longer here.But now, as a lowly paper-filer, you see a lovely lady who has been trying to get through to you. But you were too busy climbing the corporate ladder.This is where all the newspapers are stacked before they are filed in the basement.Now this is your office.It is a small, windowless, dimly lit room with a door leading to the basement. There is a small desk in the corner where you are expected to work.You are not close enough.There are no supplies right here.There is not an important blotter right here.You are not close enough to the clippings.Perhaps you let a good thing get away.Nothing special down here!At least when the boss is around.If you work like a dog for the next twenty years, you MIGHT be one of the top dogs around here!You better talk to your boss face to face about that!Your boss is shocked by your decision! He says, "But Jerrod, you are one of the best!"You don't need the %w2.He continues, "But a man has to do what a man has to do. I wish you the very best, Jerrod. We'll miss you around here."It is a plain desk with a blotter on it.It is very nice, but nothing special.You have already been paid. There is no paycheck here.This is, by far, the largest desk of any in the building.But she does, by far, the most work of anyone in the building!There are newspapers around here, of course, but not right here!What a view!!Around the edge of your blotter you see a corner of the newspaper clippings you keep under it.There is nothing very interesting about these supplies!Beneath the blotter you find the newspaper clippings you treasure.These clippings are very important to you. You find yourself reading them often, wondering where your brother is and what he is doing.These clippings describe the complicated episode of your only brother, Jake.Jake was falsely accused of a crime he didn't commit.Although Jake was promised a "fair" trial, the townspeople weren't interested in justice. The result would have been a foregone conclusion.He left eleven years ago and you haven't heard from him since.He left eleven years ago. You know something very important must have happened or he wouldn't have written to you.You look at the books in the bookshelf, but see nothing of interest."Lois, is that report done yet?!!""Cancel all my appointments for the day!!""I'm not to be interrupted. By anyone!!""I could sure use some fresh coffee!!!"This is the Brooklyn Evening Star business office. The family trade was carpentry, but this is the business that has always been interesting to you.You have your own office, make a descent wage, the boss is pleased with your work and you like the people you work with.What more could a person want?You don't need a newspaper.This is Lois, and she is a sweetheart. You sense that she is attracted to you, but you're not sure why. It's NOT because of your money!This is the kind of lady you'd like to settle down with. But on your salary, you couldn't take care of her the way she deserves.Your boss is a great guy to work for. You've never had a single problem with him.The boss says, "You are a very ambitious young man, Jerrod. You are going to go places in this company!"You were making fast-track progress in the company; you were the envy of the office; you were top-notch; you were one of the best; you were number one!!Then one day it happened.Mr. Weest, Sr. bought the company, which started a complete upheaval in the lives of its employees. Mr. Weest, Jr., being Daddy's pet, got the luxurious duty of managing the office.This man has been spoiled to the core. All of his life whatever he has asked for, he has received. It is just about to make you sick!And with Mr. Weest, Jr., came an almost entirely new staff! To add injury to insult, he offered you a job as a paper filer.The man says, "I've got stories coming out of my ears about the gold rush in California!"Ever since the gold rush, this man has been working furiously.This office is kept very tidy.This man is an expert on the Brooklyn economy.There is no one close enough.The man says, "Good day, Mr. Wilson. Are you ready for today's economy update?""The Brooklyn economy is strong. Property is holding its value. If nothing out of the ordinary happens, this will continue.""However, there have been rumors of the discovery of gold in California. If there is any truth to these rumors, it could have a profound effect on the local economy.""Since the discovery of gold in California has become a fact of life on the east coast, property values have fallen and the cost of transportation has skyrocketed! A few local businesses have ceased operations."This is not your office!"These stories are exciting! People are finding more gold in one day than I make in one year!""If I had any guts at all, I'd head west myself!"The man says, "Things have been hum-drum around here lately. I haven't had much to do."4 Bbbz?IzI zx z3x ztx z{ z{T zmzz-zTy !)B%UT6# !)+/%f6 #:!)+/%T6 #:!)+ '//%"6CX#:!)%L#O dM QeT Qe\ 6-V\R Qe\ 6QeT QUT  E ,ana +<M: ,anaN;Qe\ IP Ze=Ze  ZZZZZ{ZzZZ,ZZyZKZZZZp{z,yKp;m*m Z  m !$\Z  m !$\Z  m !$\Z # m !$\#Z{{ $ m !$\$Zzz % m  !$\%$Z & m !$\&Z,,m#Z) ' m !$\'W( WcZyyZKKm$ZZ ( m  !$\($Z  m !$\Zpp . m !$\. "   e%""g} b)| *bK Lbk lb x { `z :  }$ ,ana b)|e *bKe Lbke lb e e xe {e `ze :e e }$ ee ,anae;e b)|ee b)| *bKee Lbk lbee lbee{ lbeeze lbee x {ee, { `zee :eeyK eee {$eep ,anae<e,")e)_e*Pe+De,   , "8,e-e.e/e,ZgZ ZFZEg FEe0e11e2e3"e4+++e5e6&e7 2  e8L0e9e=X |Je; @x2iz] #a q-\8 i ? k } : "Is there something I can do for you?"Tell the man if you see something you want to buy.This is the best hardware store in town. Walk around and look!There is pipe against the wall and nails in the bin.This bin is full of nails.Without even looking, you detect a stack of fertilizer near by!The items close by are fertilizer, lumber, and rope.The items close by are fertilizer, lumber, rope and a bucket.Hanging on the wall is some chain.In the window is a wheelbarrow and hanging on the wall is some chain.By the window is a wheelbarrow.You're not sure why, but you see some mosquito net on display. Mosquitos aren't a problem in Brooklyn!This is a butter churn.There is a lantern on the wall.There is pipe of every diameter, thickness, and length!You need to get closer!What a selection of nails. This is hammer's heaven!You are looking at a stack of 100 \% pure, top-grade bull manure.There is small stack of top quality lumber.There's some rough and ready rope hanging on the wall.The %w2 is gone.This is a nicely painted bucket. It's rust proof!This is very heavy-duty chain.This is a beauty of a wheelbarrow, but it is already sold.For use in tropical climates, the net is worn over the head to prevent mosquito bites.This is a mighty fine butter churn.The lantern is gone.This is the most modern, and highest-quality lantern available anywhere.We may be the best, but we don't have %w2!"You already have that!""Your account balance is adequate. I'll charge your account.""Sorry! Our accounts are even now!""Sorry, that is the last wheelbarrow I have and it is sold!""That butter churn was damaged during shipping. You don't really want it."You are about to lay down the cash when you change your mind and decide to save it for a rainy day.If you don't see the man now, you will shortly!This man has been working behind that counter since before you were born.The man just walked into the back room.The man will be out soon!Wait just a few seconds and he will be closer!Just get close enough and he'll talk to you!Too late! He just walked into the back room!You need to be more specific!There is no bell here!Great!Just walk up to the counter. When the man shows up, he will help you.The man will tell you when your account is even.As you look at the walls you see a calendar, pipe, lumber, rope, chain, picks, shovels and other items.The picture on the calendar is of a majestic rock formation in a beautiful California valley called Yosemite.The hardware man works behind this counter."You're welcome!"Nothing interesting down here!It smells of fertilizer in here!There are picks and shovels on the back wall.You see high quality picks and shovels hanging on the wall behind the counter.The calendar is not for sale.4">??@bbbz?j z?s !)@%$q# !)%c#O# #+Q$iGqZhRG QZ3  Q$i Q$q F Q$qG!EU F+<:  2|Z ;Q$qGr x&  iir x&]]%]$]x]$ZZ$$            $$ $ $Z Z Z Z Z Z $    ^^^    $% `#53 4 5 6 ( 7 8  r x%% & ' (  r x #HF1     ( g\c7   c X D(3      (g\ c7    c e1, ##   e    e  e  "eU F+<: ee!e&e+e+eLe.e "e"e#e* 2  e+$e,e-e.   ^ ^ ^    e/e0e1S ZS S e2 r x&8 rQw UZjL#+m LLm$a A R "How may I help you, Jerrod?""Now it will cost you $950. Are you interested in a ticket?""The cost of a ticket to Independence is $200. Are you interested in a ticket?"Until now, you never realized how busy this man is!"That will be $950, in cash, please.""That will be $200, in cash, please.""To get started, show this ticket to the man at the livery stable. Have a safe trip!""Thanks for dropping by. Come back anytime!""I'm sorry, Jerrod. There is not enough money here."%g69yes or no: %g69If you want to talk to this man, walk up to the counter and wait. He'll get to you when he gets time!"I wish you would do that more often, Jerrod. Go right ahead!""Jerrod, you already have a ticket. You don't need another."The walls are covered with posters describing exciting places!"This ticket will get you to Independence, Missouri, Jerrod.""Now, I'm about to give you some information you might find helpful later, so listen up!""I have enlisted you as a member of the Long Island Joint Mining and Stock Company. You should be able to locate the company once you arrive in Independence.""Good luck, Jerrod."There is sure a lot of activity behind that counter. And you thought you were busy!Colorful posters cover the walls. Look at all those places to go!Looking at these posters makes you want to go somewhere! All you need is a ticket!It looks like some knotty old pine.There is nothing unusual about the door.He has his business done and is ready to be of service to you.This is some of the finest, smoothest glass you've seen. I guess the glassmaking methods improve every day!That man has sure put a few miles on those stairs! Those boards must be getting thin!!"I knew it the instant you walked through the door, Jerrod.""You have decided to head West!""The furthest West I can get you is Independence, Missouri.""There you will join a wagon team heading West."There is no bell here!You're welcome!!What about California?To where?You've got the right idea, but you need to be more specific!"I see your ticket, Jerrod. But there is nothing I can do with it."You don't have a ticket!The stage schedule varies with the demand.This is a stage travel office!"You're going to be just like the rest of them, Jerrod.""You should have come to see me sooner. It seems that everyone is heading West to California!""Personally, I think you're all crazy to think there's gold for the taking there!""But I can see you've made up your mind. I can get you as far West as Independence, Missouri.""Just a short while ago a ticket to Independence was cheap.""But, ever since the discovery of gold in California, prices have gone sky high."4 nEbbzQGz\IzgMzrPz|SzTz4v zl z(i zazQ<zsB!)E%iX#!)%k#O sy{} 6 sy{} 8 Qi Q1V QCV QKZ +<: 3aYs 3aYs3n% <e=># eABe?@ {{ g}DK K7[? \7kC l?}E ~?I K@[E \DkI lFuM vF}I vJO Y)f g#s $k0y 1tM K7[? \7kCe l?}E ~?Ie vF}I vJOe lFuMe \DkI K@[Ee Y)fe g#se $k0ye 1tMeeT K7[? \7kCe"e l?}E ~?Ie#et vF}I vJOeeu lFuMe eU \DkI K@[Eee4VV Y)fee4e)x g#s $k0yee4[w $k0y 1tMeevvss 1tMeeZDDeCTZZZe  ZTZZtZuZUZ4VZVZxZ4Z[ZwZvZsZvsTtuU4VVx4[wvsvsnn ZTT9e6 ) n !\)(X XcZ#e - n !\-Ztt#e , n !\,Zuu#e + n !\+ZUU#eL * n !\*Z4VZV4VVenZxxenZ4Z[Zw4[wenZvZsZvsvsvse`neJ    ee  eIZIIe*ZgZ ZFZEZDg FEDe^De+& g#s $k0y 1tMe:e,+e."e4 2  e8e9C 0Nn4XJL 1o/s]y3jz  &  y ' Q You need to get closer!There are two barrels full of nutritious beans!This is the best grocery store in town! There is a lot to look at, so feel free to look around!These bins are full of fruit.What a selection of vegetables!The last two barrels are full of beans.This barrel is full of peas.These peas sure would make a great split pea soup!There are three barrels full of various types of flour.This is a dress form.On the counter are rolls of ribbon.There are rolls of ribbon on the counter.There's a pattern book on the counter.People must use a lot of flour; there are three barrels full of flour here!The ladies in town use this dress form to size their dresses so they fit just right!It looks like the manager of this department needs to order some more ribbon! The supply seems to be dwindling!!This yardstick is used to measure the ribbon.You can find every style and fashion in this pattern book, but you have no use for a pattern book.Tell the young man at the counter if you see something you want to buy."I'm sorry, sir. That is not my department.""Sorry, sir. We don't have %w2.""Sorry sir. Your account is now even.""Good day, sir. What can I do for you?"You decide to save your cash, just in case you need it later.This young man is anxious to help you, but you can tell just by looking at him, he'd rather be doing something else.Just get close enough and he'll talk to you!You need to be more specific!Let the young man get behind the counter before you start ordering!"You already have some of that.""Very well, sir. I see that your account has a positive balance, I'll put that on your account!"The bins are full of oranges.There is a wonderful selection of vegetables, and they are all so fresh!!There is no dress in sight!Sorry! There is no candy!Tell the young man at the counter what you want.The young man works behind the counter in the center of the store.There is nothing unusual about these walls.The young man will tell you when your account is even.You're welcome!The stairs are for employees only!On this counter is a pattern book, yardstick and ribbon. You have no need for these kinds of things."Excuse me, sir."You reply, "Yes?"The young man continues, "I've heard rumors about gold in California. I figured, since you work at the newspaper office, you might know if they were true."You answer to the best of your knowledge, "At this time, the rumors are just that, rumors.""That's what I thought. But if they're true, and I hope they are, I'd be on my way today!""You better believe it!" you exclaim. "It's the ablsolute truth! In California there is gold lying on the ground, just waiting for someone to go over there and pick it up!!""In that case, you are my last customer!"You need to be more specific. Look around and see what there is to buy.4k  !%%^&]%\%U&T%R'Q(S'T(U(\'](^(&OO[PZOYORPQOOQNRPQQRRRYQZR[RPyyXzWyVyOzNyL{K|M{N|O|V{W|X|zZ%X%Z\)WOUOW)YRTyRyTSV}RPR}T$)NSx}))](\)[)T(S)R)Q'PxxWyVxUxNyMxLxKzJPM$N?goq{dzuStK!zzRQSRNONOQRQRZOZxS)X[Z Y-X8WJVVUsSyKzM{QyWzZyNQOQTQ_'f(]&Y(T(Q&S}SSO*)$# ~{qrec[\ROJ@=34))(XB, ]0Y?>=9865789=>?YY>=<7 ++& &34::<<;:5 )5687<;C`;>' & ) -.138+//S.U+U+R,R,N+M+I,H,D+C+?,>,:+9+5,4,0+/++,*,&+%+!, ,++,,0'\5#5*UXX$UW+2 6 7.+77/,* 1 )/198E3.P,TbdcS]c\TO5$5G7C78C :CDUEYBgEfIgLfNeSe01J0!9AIi!)}bI!9A)3IѹٱwɱN¹ɡNh Nh Aj78n$k*j5i*$g$d*^,*aOe$bSg1)BJ1IIQ:A}d1:2i! /V/U3&3G5G3H0QEYFec`a]YEb64)Y..S--- -&-*-0-4-:->-D-H-N-R4C4>4:45414,6A6<68636/6*6&6!6664%9K;`!hXcwepecfUgMgdcEYBf +rFr\qq*[,V#V#]d_f ed c*`+^,\-Z  ""&&**..19800y;J_W^] t"7E 9EAUCY@g2*7g*h7TTOOJJEE@@??D: 55 : 5 1 1$il$9gi*c ,c0Z.b?`1\A[0S?R3Lp745{pcZH=3|qd[I>2*)":KKK::JS%Q)P N*LI+GD*B ?+= :*8 5+3 1*/ ,+*#*!+*'*%~rsf\SJ?40$K0J0J41 )  ѲD` &5  $&,0258;>@CEIKOUV[[aaggmlsry}w!b=d\ d\d\c[c![_;d_XWXWXWX W$W+V!VW XYfe eedd!c86!:7DGDUBZNYSXwV}VUTTcTcUcUcvUverUrdnVndjVjefVffbVbf^V^eZWZfVWVfMXMfIXIhFXFgBYBh$$)N)NSx}Sx}}{}}$)NSx~}~|x~CaCYDYD^959D<80Xj1n{uiw~1t91f' mq${<~BwCvN3 33"1#1"1 WwYxZxVTvqwrnjiddcBgCYX$U.U/S*S)T'S%U$S S D3D3GV=W*j**o)n*m*f)e*d*c(ba`_YXVUWXY_`aZ0Z0q[W\\0b(l'e(s)o)f)c ] n~NNKC>7657>CNN~0>Q*CQ)9L 9&DLY7 <:=AEIHAK ?0=K J545IH Wy~z[YV` ]^\c Z: &IYz㱙WIZ<m"RWO  X  Q } : 2 $%9$7J +UR!WX ?NAPPBQCQDAS:T(>(;):;PW>T?O=Q?RAQ3IOAC+*:+<+?,>/@0B0E2D4G4I6J7L8N9N=;w=S? QMQFRGQAR?Q=R=!919!91*9!{<" )!*9:A I!:2S>O?B6EE*EPE_Ac;j+z"Y"#%$M M*M&C >   ! ( )&+.34256YIK?!8 7>EHB+">"=A+ =>M*C MMKKL LF``L"C*CGI  I!?W D*DA:##9":"9..3'7'6-399-21208-AA)<,<+@)C B D#9.&&79111A;;,"< 0=,?+B(B>%B?<74/, 7".8'7Y C+N?N@,:=N{(y7 de"$6Y-%I7$9:0$*#*"6>;44+ opqqju`wZxV{RNI;-Rojjih  -Qmhhgf +,RoE_N^T^d]fWvV{U|ZYXXW~}vsollnqv~yrkkn  # ,-0678:%&'<<;#O |-/138:<>@BDFKxMuOrQo~jiihg%%%%;2+;5};uNkEiAnTglevg{cbbaa +1~/w#$+-/05wGd\b}_^Y_XH::#.,~9zFq\ifdc4z;;rCi HfPTd YdI`ciic`rb@ |ai```Y_ H DQC @ J)WF,ur=o>(?(a&J&cF!>$N$j$m$&f&g&oMIM]MD d[dCfVfB|T|Ad?|=*eBXAY;`:a6d5e-E*G*b+o;a+l;_AZ*AX BN 8b3f(?(a/u.m)C4lB^HX*DDLFJHHKF,lF$`F'` -i +O-b+`,j2U8_ h> l>lVlBvUvAonm 8KTzZvprojkll~mkoZqTsL}2Y 31:9a?aDaI~bPtUYo&colnum~lkk;>ADGJT{^veultrsxrqppo     " ( . 4 : A G M S Y _ e k q w } } w q k e _ Y S M G A :A@CBDD DDDDD#D(BBBB B&8;;;; ;&;+10010+1*1&0'1!0"1010&%&"%#&'%(&-%.&2%3&7%8!"'(-.3489$*/4;B    " ( .eNc\9: c @:79;:Y\NUgNwC{L~KV]WiSTROGNCb?g>k>{=;ZKiIIZ>U@i>`?O<=QQ P  YY Z [ \ \dd e g goo qr rzz {} }  R ` ] ` h ` s ` ~ ` ` n)L LT_lw-F-b1J1^5O5Z9T9\5`1d-h+X6QiMiHiCTT_STO_NTJ_ITE_DKKKYPOKJKEF YA Y7Q+Y.a.F.g2K2]2c6P6Y6_:[`C`TTUAQP@PO@FOLKFGA]S]CZTZCWTWDTTTDiQiLiGiB]?Z?Z>W@SF:U<<= 'JI"I2 -)I6I$I e!I9m0I:u0Y)} I:664'3'='=&)1)0 {i:L,s0Y)<+k Y:J-c!Y:K,]Z]VzIJ<=Y[N,\Y~]eY9K<l{lil+t0Z9=|Y:K+I9^,|_ ;XX * &0*   #9lE_d]gWlWlEvEvV|U|ZX)<0Ol0wh0 "Ġ pW4 +S,V,00T1Q+S3.++,G+K+T#*m0G3G<*F+_+bvwG2*;*F(F)J)S*S)T*W*^q*c*+"l'l0H;*+w+Z*N,F/E2D5C8B;A>@A?D>F=i2l1o0s/v.x-{,++Bm+*_r+E+;F3m/m'~#-B -=4;6? 6;=9?< jo- Iu+ 9z) 9X=-[0R*`4<=:E7s)x'}& IHHNHDDLCKCCLBKG[BLBC|tjdg;jqi )mpjs 12".!0042423(JCE(MGL(TNcj)1lI(P'O77RB!1259O8Q1S7R7m1Z25\5n$<bY(g(y7)i~i~'' ~M(T54~$8O5Q%N$V*1#I"O q:p>prmtm?l<k<l@lsoF `2ْqbap!r!r ]A]b`c`@j=k>khhghAe?c?kgv9v_qc47g}i}7|6a \0r"qgl \b1 ggA[dIpIs[gAu8{8Ay~{)~ !!   Yf@w{6|7|hvbij^eb-~ x7fi_ZgXb[i[rYi\3~;v8s9v:vMtNt>q=aaa@Z3!xc1gqutt}v{ywytx]n]nI|AlIC"GP0;+)"A8K\Iv^h_nlejkr{g9I~^o]oI}@AMvfjkn{e* Xy0mh>}ltxoSm=dn m 000111111111jc{`c\{Z ]WwTAy\ahwUx`dXn,}i:mt:H>G{J{MJA\OJI[cRTIPShRgIbA^8YAN\`SRINAL\QJKKLMMNO0RP1WU)YY \RZRZWZXVSVTVU\[[T!:6!2 -!) % !  !      f_{\w]Bbi0 E(M_1c b2e!e1h!h0k!k/k/m&a p"V\wSAG2KDBCFK1@:damkqptwvyv~rqr|ti{g!mm ![) " 1q)rOqK2j%r#X 3v"i#`qT' hAhggX_Zf[gZ`YaaX0dYff e^bVKfSfAbT:eRe@bTb@dLeScTbUfV$X$`$f$~!wc!oc!gc!_! %`-1[1}3u2v2n3m3e2frQqRrKqLrEqFdLcMdFcGd@cAgDgDgLqBgT+ +++++''$$!! 3] A88AA}8w8vA|??x;;t999CC:<>CCwmwxsxspnt 4;,212 -0;<9;PR]^]\]q Q_4Vr /197RS[Z3V RyT^V\V,U,U*S"SVVWXX[[$Y,X,X\Y]\uZySyZyX^U^W&Y!X*V*Z"ZW]WHYcZkVkX]V]W( X$XVXYZZ$Y(Y)X! V#UVWXW&W'ّdee ^`_54587[\eAU;:9poolla6brMTSA@#""#4"" D820y-t*q#ohRS_~tOJFnLe\e\Y[\@RhLpJsFr6o5i5ica]UWYSRZ` *]7c\}QxLo @#!""NnBTS~PtC^[[\S١0QhR pub/m6kJnSb5h0 0 ;`DYN[N^P\R_S`Bd=n6gS\NbOiSdQlYEZ\\HKRUZ*ZQYR>HKMT/I15/=`i-o/++*"""i#_G&l'`'e[ eZmLnKE[Q]`LhFzDzBAB@YW+ zAz/A-@.o0oDo"o!,?hEh-dYޢ ]SdLbKeY]SfLmGBAmJG DcW^SeLfMhHBnFwEBAaR^WjLoIFDq1q>x=x0q1.;:..|A|/.@s8~96 :b:0NZN1LZL6E5EXC1CYAZA5 A5<6<^ooo{11/p1m2}.1ojjjn10v [P[&h!h``[[X\ g]\ gh H K SY[ZY] Z1 ] 1 1 1 1 0 0 0 0 0 0   TT !*A8Q Q  BU ;BMFDV QX'Z'SQ+T+[5]5V+T4U41,0,S&R&0/P&W 4X/+','0+0+,5-5150404/&/&.805@:AO1QDNFR0ROQPQVURULRQRR <5 YKYLYJU.T+>3G3PCYT#Q :Q ? ( SRRS ;;89@6@PFQF6 YU!+-8BDT P MS ; $ N1NE@Q@[FR 0P%R%Q P Q-1-S3U3T.S.T:0:A/=T8=&RBXDXMRQGTO\H\ i kp T,B@9+)"_Q2P=<&%S SRY4YOK8=8 ,-.53;S.Y T g GI/5-I/S-aj,i#p.,~#*")=6-LS-;4}1v.r+o%mfe_c[sNIZckt|UX0d]\ncoUzPFRmPlZ`??DCDDHGHIMLMNRQRU/Z^`_`cedehjijmonortstwxwx|}|} Nt=Qw\ {~Qu@l@e@^0K IG HB D= 6 2 4- /(" N KQ U W[bY] dZYX[UfW[RgT^OiQ`LkNdJlLfHmJlFDpE4tE$xD{C~B%ABBBBAd\YZ@ #1#P121S383?3F3M%6%=%D%K& = T0TLUKSMUDSFU>S@S:U8U2S4R>YVTQLOKHCFA?;=8624/-)+$&!    !$),149<ADIMRUZ]] \[&VTU&W&Y4Y*W+X4ZRR<3/+.&.-4Z IKVWZ4Y /14964R1W 1~f4IKVY!%)-159=AEIKKKMMOOOQQSUZIKNORUY'[+\5^01&1&2,1,2424353Wt9z')@ ozjAcw{O/{Nv`gRmskkAVldv0wllrrqvvwxx||}~~\ g\ st uz { {utzsytzmmkk ##&&)--004488<<<,-ttzz0/3 ff cc``]]g!g\\gddaa^^\\\) ! `*`E`E \_be^;b.bCdBb0cAb. Af,f@dBb+d1`+`D^*^E\*\F_+` b*]*]1_2_8]8_?]@b7b F-k/+,MVZzzUxTwMSzUQ}W}}zzq~m|k|j|NyNzJzJyHyHS3R,{j}S\T,2p,2rd,') L[ ] mHE B~j2R1R1->9VDpF`'V \^0#(p3-q0X"p,f-.IEO 0-0u)Q)t(u(RTy4S4t3u1u0v,u,t'twxyxwHKK5n:8l8S6S6b5c5bW X,Q2X7X5tGwBY5[U YY%% # " ! XUU$!!X#&3'3&:>G)Z*k+)l6AYv~`d,s,-JxJ.NxN.3t3Sg0g{TvTwR_R\D%6$5)E*HO2N3R4RGSHO&C&10BEB281`G`4U3k2=HxHS-(.(FE-S0SIbJb1S06/6GDHD/6.+>2<:P;t.\(Y $`GUFU3BE8D81&CB0X$9`?`F Z9YB>B;7#6#>#(16AFc\:(16AFQBT_ex+z2vGzAI~hswz| 5qYJJ`)!-..#! 1v K <     ,6FILNTVY\^>^6fm'k'UWlmnX W bY U U!U"p%Y%h!ikj Z e$Y Z[W?[9V 5W \j![!h$bXbf e` _!_9!e9OtfwfrOoOjfmOefhfcO`O[f^fYOVOQfTOLfOOG0OB0O=0O80O30fIfDf?f:f5IxHxIsHsInHnIiHiIdHdI_H_IZHZIUHU2T1T1Y2Y1]2]2b1b1f2f2k1k1o2o2t1tIPHP2O1OIK1JIFI+0+5+:+?+D+IHC >9 4/ 'p rs'l no'T UVVUtpoTXXY Y ]] aZZ^^bbffjj'X'\'`'d'hkfa]Y)NPNOQ)N#0$8@I&k'%GQ3P 0#T 0#e6? 8@Ge~ F ((()\\\]"&,2+>9FPI>=0'zgh}~MML.Ly.-.tTIaJ7GCH'FEf0\/P/O.V<`=9:A;B;8%9&95*E+3-+-,,I.>?@ABC#D'm0n/~-,! !UUU  !  ]\) ( `T ` mjmnR@TSS'R[i\j"1"B>2>D[4[F%%YY%\%b^ ]d c!0!C=1=DZ3ZF#Y#i_ ^e d%]%c`>U=8;B<9&:Y%Zj[jNONO O P O POPPQPQPQ P Q#O#P&O&P)N)O#$#$$##$"$"%&%&$*$*%.%.$1#1"33557 7 99<<??A A CCEEG!G"I&I'M'M&Q&Q'U'U&Y'Y&](]'a'a(e(e'i'i(m'm(p(p's's&v'v&y&y'|'|&%&&%3P3Q6Q6P9P9QA<;9688;;@?>0/++**.""qmmhd!`1\AZQ/412|wAto!lhhd~!{v!sn!fjja] ]>T:e9e:[9[-.))#61?:X9Y:W9WC\B\BYCYCVBVB_  F`FTD^DTG_GT]fh hf_^gjh]#j$J#e RJR G C RHERIG5 +  3+2*0)/!!:|9@{!1zI~")}ZF9{!})  ; B - 29/'       ) " *!*'0 (0?1 9D1 D<E < D ; DAE@ A((6) )4WdDCB82-,BW  C@CI N T X _ _ ]\HIHDB\VZPE BA \0INQ WEKP R`d<Z;<<<<=IP)U\)aMiN{[c`\z%Y_1\_٪ :=:l:z@{AyDzATW}X}XnCjBkAkAxCiCAAB:A9@#=:k9k9R8H6D4B0A.@#<#$V$Vm8D?GDlLNX}i^i\lXqXzIHFF@NT `  A  3 9{{:z6wtrqpoon- . ,+*  # !    &8? Z l k jjjt|}rk 2vww ` P  @qH  !%+,-0 _^_^`^0[MFFL[ZMGMAbb \TLJLOUaaE :lWlNx>x?>?EjXBmNPrNqXrNzCBi[iSXnii/i4iRV|əɑ R   RsIqIuHvIwI{H|I}KrBB;X=i/"6"/= 3553"6:9`QuuGHCBA-8-8JsB Jv/1 &!E)'3()4?A%'*,,004488<<@@CDE!76 A;<:</j/i4XCD@LNZL-@%M%g$g99;;:,)1ftDuE}U~ZqeGH~=IvJyJ|RuI|4 kx%%xx='vwx{}z|}xw|zs%8 $~, :T67-,+!kk)n&nqq$tt!ll(ooooo%o$rr$uu u  8:  +2<Yjl Z>6(   )5>[k 2   !4$3 4'32 # APae i 11'1212?>>5?6        " " $$ &&((6688:: < < >>@@BBDDFFHHJJLLNNPPRRTTVVXXZZ\\\^^``bbd df fh h j j & 1 @5@,?)$5$%&(***+ - 0 2 333589: :8888 743!371710 / - ,,6*6*")'&&6XC=C@D@D;A<9;b!d!i,A&M&f%g$g9l'c*)a8d6   :kAm)`)D,a,B8h+R(R-S""c5d8e5^*M(M%( +.0([*Z-\,dh"e>o9w7|?WT4Y@e54675EHLILhNIUJUi^CZHZfc>`A`]h9ea?]^D^`[ec?cWa\h:hQfT >?WQEIEgKhNJNhTi]E]^[ab@bWaYg;gPfQFIFeKfOJOfTg?RZ[ >G_AP\A\\LsL~aUfN\2U1.1!H41P30.-/0/4J7R7XIcSa\]aWfO\4TZ QKY QOL1[W+ aO fI KuK{S1P/0K0H-17,5)!0&.#!)*((**((''))\.\,\0\Z[[aSfL++,,)3(3./!54!H21G]AS18@PZAI"K%K-H01R"S%S.Mz1PLATMTWGKAKLKVKZ\HaBf=67!7)7-Q"[JR!S#\G[HaAf?I!GIPKMt0AxB @pL*:* @@a91PS\X\NaHfAaQfK\(N|I\HQI1J2P)I(6%50/+.(#(0%$BAQoRuN{@?nMvBwA 5 6 5 6 6 767676778789::; : ;<>?>@@?@@F>F?H>H?J?J@L?L@N?N@P?P@R?R@T@TAV@VAX@XAZ?Z@\=\>^<`:`;b8b9d6d7f5f6h3h4^=3 69CyCkXoiTaQdQhjQToHqLn0Dp1Du1TsAXtiXSvSXyi\S{@GzAt6|o7wr7z!m8tx11j8x--j2x))j,x%%j&x! @Dj vjuzjt{ks{ 15 9 = .+(DzErQmQFzGqUlUDI DEVGVKZG ZDh7 > ;<=?MJd?_D  E SzwsoA2C2EA%1265:;?`nj{ww ht t z  72 0)7B %@0 @P`MPxNLZNaWlfzn 9c 9_5q5s57k7w4s 4q:\:_wgli o bge$V$W!_:O<Q> S XrSxBtHpHqBuSyWtCrC~FpF~ItILuLOuORwRTtTVrV}G;99;: %  !'*-45B E N RT^ ` #"%)*058:AAJJP /.1/(#  #  &$'$"  -;=ATmx2:"J* B#4)#"n#|ᒚ鑚ڒ {rёّʡ ˑ FSSA@9luq|~F}AIPP}L|BOr9)1RB&!i,I Z:  "]abc_JKRZbnqqBBJOOrr||{daNLHKLOcksy}rFw J)+@ ɛ31"A1r01Y0)** !#IuzuzGOyd^l_ Q}*<QcOWq       b)[ )YXVP]QdNeJdE^DYEVGUKVPWQWR^ScPcO]w]zYQPPQOX\{\zUSYQ]R_QaP`\MU}]d @ٱ”tC{DAj}xswrtsnso}pjVrٜQWZ)s]ɑdfaZ\FEQYD^%AOW41:DQ4!NQtDBRj    DP `) QiQaLcIaG]F[ RZ1cgdhkisdsmtCtE{FDBuD{EdgihlgnfperdsctftkSZV[RcRgR_OaMbKaI`H^LQFQ HF*!1*)VS!)dtQ`1IieTOL@M;F@yQElnUhSaMhEZEVFSMR{?{rjdUoTUJLJXEd NzZ<2m0/w(t'q(n.l1l('033B|<{5x0z1;A dYZ^ae dns|{v'tghmtx${(yU ᠑$i[ ib$VUaehbmuu{G$&)u)133A5u eUi\`b#g f do7v"|({()u)w0y5v5u0}1C5A@=9424v1w/x-w(z#{!zefdxj|g+3x1y]W_tm.t+6~Q{UwSgY"b6a8\:Z;V\Bc:W <]O6I*Q P>aQMCPCVC^Z:ZDP;X>VFPSDXD]QNDTU8PCCSONr)k*k/q1v/v+r)pA[;QZK=R[A@l0u0u;q@oFv131-/377&RY : 20-1P>,9:9=>@A+m1AI ,A )308084v7}8~9[B@hA9* *o1,@N?D@A=7>52BE6<G6=;;+LI*+WA!$79#+ 19" !+ T3)" 2:!#9 48E7*-H J?VF'_5I3G:F8|BVGe )3A?841@PAX?\[t=A\YAP2wy ep h/a?TYjzRt:954989=EG3!1>3HW7h_ i]p]r[r]j\jOkLlKnKoMpOp\k\oK#qNq[849FK[`l_L9nRHK ! dP@hOhDg@d>a?`CgOgDf@IfR=G@eOI GHJHFEA@FGFBJi0HIGDF KLNOhٳS1g]sKGJJrQsQMIjg_sN C fXrGrUhDCF9WƓT"8[V8VG,G!'L $X *W*/`#Z(K-J5I:I;O5Q5Z,X-`{1#9$1$>K:~..&|''>Е` 'I;0@ @(V+# (V#0Q)$A#R=J>J?J8J3J*E!J`!LN(?"F 00'RZ%R"P0 Q&D(Z0I0J2I2J4JL"\Q"-Q%\*_0\1`7L7R:L;S;T8L9L8M)M'V#V"W!Z [.V0*V3V Z"V$U'S(O!N9V 2K8K>K=PMQ2T,O{@Qv4Az56055/1[<"a=q5e:Qj7Av22|32310Ql,RZ'R9C`E:QlQ6aE03APraduQivrw:e,'@i-8b>m:p9v?ygxd}jpq|y}|#c$g+j;j.d1b)h&m!f=h8k0k5e>w:y6t9o>rdwjfipo{}z{ /z/hr1IIKK{{}\~\^T^|G|oF\Haq? q3.9 ^W=WCyGTB'̽''|'e*f1e5c2i,k%lZ_eglxgyy4A)b)2A*~R*zRj4CaCaCaCaCa)KUK[hptatatata)AYnQYiQXdaX_aYZQYUQdpqrdkrmrhSg1Sc1S_1JgcJdbvkavfavaav\avWavRavMavHa|I:KPUZ_dibSbXb]bbbgblbqbvb{b\QZY[RNNECIEYJ0MAQASPX`]]^^bbccnOlR nUlX dBeDeGeN58; \ \^y^tB>D;&:'rvbVLKBgeVhZoHfh@Bd nzz#kL_/a4_8a:V/[*WVQSOSOUTP"O%M(K$G#M$>B<8"(+W V SUS Q#L'P,94;6 x}v~v}~~|{~~zx{~MrIoFrGnItMuMwKzKvI}JrJ;I=KCIDRKSNTO ZIZ&[]` ejkquz||:`E`%adhosuwx#x=xuroheb` y u=vxq.r r q o n n l lj jhhffdc #w`#`![(Iy$9ZIl x=K [3I[=Jy*)y2)wtuu tVcv)EXXddV6U6a:f=f?kBmCnDmOrWrrvsw~wol[hTeO^QUqE==pokkcd`}`}cco`0rchch`j`_ThTjSjQcQ`SIIJHGITP   o 4'0k  %.7;::EII<:IbOZcjmmkkw}}{pk{1~{H =qmElcHcNY;&81.aa@{|pIR<>Grz,!+  <2:$*#1 =2 ;"**12"*2I92YbBJo"9"KK)"<0*!$036@I   $&("   ;9149M:YQ!j *5j[ё9) <974HJOLgknp| =fz  n?Fu CvK:J7K6Q6^?^Tc 0 NVVVN[Pc[4dcscs^q\pVdVd\e^q^q]_c ~Z~``][\\HHEHXX^aaX0XHFI[dV'f]q]pVNV'@?]?P>K=K;`O`O\e\f`^\:RRYlZWS65!4#5+5E4I4P5Q('(*#)&**+?*B+O*P)T-R0N1Q2T5S2L0>/+0(/&223!402(261=/-"*+ ""!3,36 )* "9+$!*)9,:**T1T/R,&39%,(451ZSIGJJHM; I = ; !!@BI I !*" A @ , '$#',@A?@A"H)H)D#C#4&1)1)0&0"4"A'E7F8HFHFDEBE@D>D1C.A,<,:.919=8?8A7C7EC>;>9<:=:0<-OF"PJ\J\HZFZ4X3U2R3P4PFQGQ4W2RGZGeF2hHqHqDpBp0o,l*j*i+g.f4fAeBeFn,h0hCgDgHgA!`rB"tH~H~D}B}0|-z+x+v-u0u@tG|BuBsAs3t.u,w*y*|,FCIHC@/,**,/3?CE+0A@@F$F? 'C&9%5$4>%> D >>DUHlDfDsDyFD:w+v,u.t4i,h.g5)F $+'8?6WAj:z7<2 4+ --I: #!##&#)"*"+(.).0/156.9K I03bK.S0Y/\._+_(^'^$e$i&i*b*_(s/~.9* iR/ !*D)л*9!Pe:!0E9!:!P= =6=)G+LSCRLw3 55Y:"165)E1Bb[5j*q4~4YK4@+g+кE*"+zz {|}!|&|+, ~ }?WXfjiBC*|u9a[z IRzQrᐒ1ccMcɫ9#zJ!mɚ:*!*!R3bɚ99}`ښYHifHsHbHROJ J!7H 6C`^F:! I Q JSRI2QZ"WQ"YiDP7J(I!m !\,*;K:)!)* 92+1c#Kë24J!B". .> $%%%  *<1)@"$,* +'@B<T"G!_xol ps<'w  "*DO(L5LANLF_FF^z]``I_Lb1_j ed gw#yKsu}NI6Dn 1`-`J ]P* }|zrypvmy๙LyЫBz:z8vJTAT@S_TWTTQcIlQ~QQYNG>@6?H?`Aq>AI*IAl`L/rK=xiwvw[SFSbFOGF^0c'r10'0@%;,:-71$/&01*]9`+r87+9 7%0,N ! -3A C <=:F+G%uy*'2eB"gDqDrB"tD~DBCED@3CB_lUlUn_nTt"s$$w2wrI ^"'E'h'(:b:9,c-S2ʺ010262)$/.ұ 1%-&5%L5UE_ChCVe>G>G   rzrz4)=p?(b(b))()80'LKg^|y/, .1[/1V0AO0!K1K2H/H0,-r1q0(/108/m :?,#+',2-C,E-J,P*R)()+"2?343*2"1/.!| ~~ }(~-%6&9%9&;%;'@&@&=%=>li 3"2?+c,01c2E2 OLSW)V2W'O%IFANxjfLtPssxz]EF_FcE& ) , ..26 7:9: @ BBC?; ##KM"O%K%I)IIKOSPRTVY[]ZYV URX]"[``!\)W,W%T'V(Y+Y-'$)    %*%@ACDBA"<#:"=?A(%#!-urqtwxmpl &Z-b)hsx nxz^ XV@dKXBVMNFJHCN@J>]@c@_KhRaV|RvV{fofdl`fShMlAr8g0}&`fdzq{{xkodOQX]D>>@~>D6? AC>?H/_mJyMzL}IB ? =AMPSXTQS]_!b atx tj l ecb% # 46 K-J+H,!)+)'  qomlnoppo  !#e *"q0y@|@@@ v )@'=0';0'90&5@<3 >3 <6`B8<:`S69!U9V9V;U;S>PSAPSDPk/ x/ j2@w2@k5 x5 j9@n;j=@j?@w9@w;@w=@w?@K@N P RT@V@1)$11663080>: 74 1/ ) + "++69<?B1t&t)p .p00n`WePXc0WaPX]0XX0W[YgX kX0hZ QX0RZ lZ li d okhC1WRb]vm+XYdeVVSSPPMIJJcP!a_0=Z8WP=T:Q8P)$=Y@pfijmJMZu0CP -*>H_ra6}~==>>t=<=<<I I EEH+H -F!F!H)H7HFHFD7D7G\JPJNHNG[G\IgH~HzFeFgHF3IHFFHG)T6S1R)SZ@3_4bAbA`>_4_K^%Mcscr^K^`~`}^^`]Pp0#kkn&n&k"u%$z3z3x1u#uQv%S{b{bx_vRvw3zzxwwww4 #5+ (+7788DCysv.$'v{v6zrswssy ~stuwturergpmorputdtexehiffyrrsktsstssnmji}h{etetrt =n0j=o=w@wApAm>r?w ,;^D^?2.;a;`<_C_BmAt@x>=DcDhB6BwCl A|EZ^}\s^scdaad 2%s ffg\s\|\ +i+9 ,"_antsn!o !!t!` (m, ws- &djnp twz~t ggk0&b`_]ZYXWIJIEDDAg`` _[_|]tb>?DA~ abcd S+A^]|_y^uBGux r"b&y)+$00C1 C/734 {yr*t{~pJiznZYamZ9@Al:I0Aj}:iQizJIahw*Intvufu;iAC76* C65)@5*&;!6bddcdddBBA@BAA]]^^^^____`^`_]_qf}qfqfqffnflfjP0`00>>/9@6..4 i`k kmmooq q ssu uwwyP} s&*tox^u_ya`}b`^]ACB@@MQ]N*ux SFEY`UY- C@ GWYZ_cbd$B E.DB$^NZ _ bdYUSPOKJHF('+,,-uvwxyz~*"Ace@@4k\\XXrp.0XX\\m lk e!a#_&](])^,]-\5\5d7d7\8\8XX ! #&()*+,/2mlkkdd}`y]x]u^r\j\jdhdh\g\gXX~ } zwvutspmbb  bb l&_'^ly_x^ 55 6 7;=@jj i hdb_ __ }by^"c i&^( s '""S WxR}}SW!1~<7d@?^?hc/=of8X@9^9gX8Z@<^0:044pp>o;okk1m 'b''&&dxcxyye ..@-@-qq@r@r % ,=t=t5,4 {{{%uv{%%z8]9Y:U;QcOeVg]N: S0RP /]/s.x.]qxqxq]prp]-]-{,{,^r]r{s{s^+utu+htg l]lgk`k]3]3g4`4]9_I_I_I@f_U_U_U@I1I U U1 ERYP2]2j1j1]m]mjnjn]o`0`0^o^'J-J T T-J-O J.K3S3T.T/T.N/ JJTTP55353454jj3j3k5k337272ll7m7m13n3$W74h4{WlWa7 `7>73W(M #R0/A +E 48 1; |RtFn;xSlTuLiKqGhHn@d?d=k W8]:`P:A:@;J;WTLITU TRPO%L IJ1T1#V)I6U,@0>1655D3Z3j5o>uI|UiWfJb?UV%I]8bBfP|JPt?n6R#MczC CCQ%CCCPt9s9n010,9+9tq+q1&AHR-< C A< ~r~}ccK <@RM{Ft;n112+;$FF~A=tt+tcqyupqu,/.,&!l4'my#8"1z$9 0*%+ 1<x p h $ 5frzx  D|DJnDD{zt:s:n1tro]B)M<4% )*+xnecciv}tfdc GF=-# B9=5  Bcf%u+g%.,(1!s9 'to{sthns!z%(B cB c G G  b_bPb2ba ` <8ga<6icViIi9`@ =_I_U_b_b`f` `>bUSVcfWWeVPlhb=7IjVj$5g6e9aKaK]J]JXTXTYSafa{ie3k1k0s/|)&$ 29=kIgVgmdw=lcpag9;vag{tos $ + 0s{yuwltqgormrdsujo|f{jkcjT]T0J0J]gnjoxrmnsmiwOde2m.~'b^{$%$h jhgfd dz`h%$*+y0w0i4fD`?i:KhZ`kfoxeuj{$`joftydgzD+  RR OO LL JJzJ zL LLJJOORRUUz{z{{z{hgihghgft|tytvdd~oloiofodob|O#O$O#L$L#JtCtAsAsAt?s?n8n6n4_9`9`;bBcBcDbDbDdFcFcF$$$$gMhP MNPQQPQST{K{{{=N=_=2=> @ _ @Ia;aM`RZeIJQTY;!cUUIA=]=]]]]MIbt 45 W %wJ %p> k5 !Q(H/e2hbw=w?x`ExEHx`NxNQx`WxWZx``x`7::ee]e_mao?yPHyPQyPZyP$B3>d@dvu t rpo nl)* ,/0)>2?3am`l`? 4kk4 w^n(^ n!fO~fP@@@UUR`O`LLJJ%%RUU%J+w+z0b0e0h%$$%,\\hs\\ix%TWJWTTJTjfdd|yyxuwsws{r{qvpss}cncnjmjkak_U_U^a^aW=W=^I^I_5_2j1j1c cs/s-{,{,ww*'&& ## 59;;2=2=353372723#3;0;.@-@-==E*E'L&L&HHVWW R"R"R"W5Wv@x@EEGHH>; $~ 78-:tAwADE )W ;_v )!ctfhhiy, ^<* 9KIJ^L#)*%1$9&@'G%N$T&Z'c$m$t&z(,15778:<@<::933}-w)l&e&Z)W)M&A)=)0&,'*'#, /58: = =A >+ DD#3#==;=3==;7+ >{-#}4`4@*.( ,-%-z-r-r)p(o(`(R(H(6(/( &    9:;<|?v@wBGXY}`ubwl%] ;('+&4&8']'X(x)== ?8#/-*q*|09@ A=: 1)+1'M'i'u*~1:=B;333ddaax>>y;;> 0@C@: Y WW X2] : 9 ; ;== \ \ZZ S SQQ H HFF X XY] : >>x5fy.yL>>w!5!e&L&.30&&+!!)$y pp 0'%.+" (!#!''7 ,00 i ~ &M&_l_lPvPv_y_yMwJ(J&Mv_tZtQ5KuV&_y_sU @y[&[ - %%_"fmz_oEE|>>=u"5"b>v~5~dx.xJ'.'J*.*Iu.uIs.sI,.,I^RqwywyrT dId*o*oIoQVI]3u@qQl+lEmGnGn+lEeEIVWIXh4m3OP~iHt.tI+.+I0I09/8/5;5:=:I8I89292I'NyNyP'P475?D _Y#D(@0]@w8<GR[<GR[2;;-b\lp W L * &#y#V&PA&'&v&`|)@,000"),44`8&aya{e$e#i|i!m~mqqvdv]vAv;vv{:{B{Y{]{e{{fVI98B IV[ giVI7m]t]sZsWnTnQmQnHeH)vnvve)a vMqXa5eTo[.{@n`j?`gGfF)P)^2^2Q4P4^=^=Q?P?^H^HQJPJ^S^SQUPU^^^^Q`P`^i^iQugyhxfOrOtKtKryxtuRRUV+~6gx,HH=; &_y_}}ebWWxP!x+_7xBxBk9k6xYxixekWkXxxyxvnvk}k&^x^e; =GXaiwcwYwBw:w9lBlXjdjyww}lQ:~@2H2P2K@K*:):':JJI(<(;II';GZ" \*N L#K ?)@ 4+S,V,00T1Q+S3.++,G+K+T#*m0G3G<*F+_+bvwG2*;*F(F)J)S*S)T*W*^q*c*+"l'l0H;*+w+Z*N,F/E2D5C8B;A>@A?D>F=i2l1o0s/v.x-{,++Bm+*_r+E+;F3m/m'~#-B -=4;6? 6;=9?< jo- Iu+ 9z) 9X=-[0R*`4<=:E7s)x'}& IHHNHDDLCKCCLBKG[BLBC|tjdg;jqi )mpjs 12".!0042423(JCE(MGL(TNcj)1lJ(P'O77RB!1259O8Q1S7R7m1Z25\5n$<bY(g(y7)i~i~'' ~M(T54~$8O5Q%N$V*1#I"O q:p>prmtm?l<k<l@lsoF `2ْqbap!r!r ]A]b`c`@j=k>khhghAe?c?kgv9v_qc47g}i}7|6a \0r"qgl \b1 ggA[dIpIs[gAu8{8Ay~{)~ !!   Yf@w{6|7|hvbij^eb-~ x7fi_ZgXb[i[rYi\3~;v8s9v:vMtNt>q=aaa@Z3!xc1gqutt}v{ywytx]n]nI|AlIC"GP0;+)"A8K\Iv^h_nlejkr{g9I~^o]oI}@AMvfjkn{e* Xy0mh>}ltxoSm=dn m 000111111111jc{`c\{Z ]WwTAy\ahwUx`dXn,}i:mt:H>G{J{MJAvRxz|}8xArImZbYaW]RXOVKS'..(!<&K+ 0@>;KRKHK9K)K)<$K)<$(b `%$ <%) +#<' &S)-/Alswl 1CFe <'<4br' 9$=%!?&H)I)J*&% 0?>0]y}Vf?u)! 2A><,='! ?(I+J, _T  7-:S)KB@>  ab      )")0[a @_ab_yMGVXSTLPOL[\\U\PZOWNTMQLMKNQXXYS[RQPROQNQRUTe{MNTQZQ\SZZYV //[/L/6 P45yA[IQ2*c2,9\q1qN1zy*U1tkkkWWWI5FpwZ{Z{Vgxxxw|} "'"/%0%(%0(1()(1+1+)+2.2.*.2131+1."*%("'()+).*1+%( b0eehhhkkkn nn q qqb Aqnkhebpm6m)wjgd+2.2)f(1%0"/13q n khebOyZq(f !%(.15777=@DGMPUX]`eglaZ{X-,I0SHKp<6W!9 2')#!{rmjghRjLg@+uM!Ss)l6b%idjBuC)%"  I%#wRAU[OyODNRGUKVOWRY[ZyR)jj~ }05q"!105#2C&3 E)4#F,4&HO!]!b!f!l[U!RN!KF!C>!:6!2 -!) % !  !      f_{\w]Bbi0 E(M_1c b2e!e1h!h0k!k/k/m&a p"V\wSAG2KDBCFK1@:damkqptwvyv~rqr|ti{g!mm ![) " 1q)rOqK2j%r#X 3v"i#`qT' hAhggX_Zf[gZ`YaaX0dYff e^bVKfSfAbT:eRe@bTb@dLeScTbUfV$X$`$f$~!wc!oc!gc!_! %`-1[1}3u2v2n3m3e2frQqRrKqLrEqFdLcMdFcGd@cAgDgDgLqBgT+ +++++''$$!! 3] A88AA}8w8vA|??x;;t999CC:<>CCwmwxsxspnt dq_x_oZmZxUxUk <fnop; tvk gH,"I2JPAQD/ ?,>R 5"&/=.; -7+1)'" ""syptmBkc^![W!UQ!PM!:s8nS8j@n8fAk8cAg8`Ac8]A`8ZA]?Y!If!IcRI_RcI[TaIXS\IU!9i9;`9q9Lc9i Y  0 !! !"" ! `@ #@@`###)"/!  w l c fhl1 gi e qfozgm{|kB_FCLBRCXC fY[^_][dk =Y=M?Z?MRgR[R]MWITIULWQ]AO1OdOWLbLUA[AMI`IQJSJHLTLHNVNGQXQGT[TIW]WLZ_ZOZSRKMHMIQKYSy!x|NkNl@t@uSh9y 0lljkkt t x}RhOdG_@Z@X;X3V3SLSPVV[X_[a[bj_QQOKD3VB 0%P%k*k*S/U/k4k4W9Y9k>k>YC]CkHkHaMdP 4 ppmgmɻUNIGCA?8531*&%"!%/248>AEGMUXZ`cehknorrH}H}s' $*^$22llLmMm!"#$%'567:@BDHJNVWY\^aefhjn,*b*(~ rr <<>?:::8<88=yrsssQAQAAAw~~}~lw}   0!# !5ivvv sr#'+/37;?CGKOSW[_cgkosw{;qq;;psihcbeECJLD?B>BHJ3L#CJ   ~~w w ppi i bb[ [ TTM M FF? ? 881 1 **# #          " # *)0 1 87> ? FEL M TSZ [a b iho p wv} ~ Pk9eT1H[vYKTxnsv~NQKE1C1A!.): 4 1:!$-%-,i")Y#/<<#+#<;>?@@A=@<3;D;368"BCA@?tus 23{_{`~b~ffghhubxfftbkbwgn _^*^gogYo iitgqgZ?Z><#isiIiiInMnlC '[?f? d:k_oZY?Y73]Y9A]^@^?[?'1fjfg"b(b)_"_|swst||suFhISfi%a{Y8W:T=Q@OCLFIHFLCNAQ>S;W8Y6[:[ILLIOFRC fDcDcVfV_J[J[X`X`JRMPWMWZRZRNZP&q(d^~SYd^~`eQ4QVIdI{tws|(Dx 'c;~S`abcf_ #jtfkevae_aTM23c^c^c_g_z3ublfo eoafbf`e_c`c`h`yffkLjUjKsm7vmuiunvlvIxQ]ePzQz]f^fRzSz^g^z]x\z]z]@@]5g5w1>5:5:9>9>=:=:A>A>E:E:I6Q @ @ @ @ @ @ 2**!&!&%*%*).).-*-*1.1.5*5*9.9.=*=*A.A.E*E*I.I.M*M*Q.Q.U*U*Y.Y.]&]&Y&U &M &E &= &5 &- :I@BE#EBI"IBM#M>Q#Q:U#U6Y"Y2]#]8j :j:sCj EjEsNj PjPsYj[s uYsIuNsS#sQ) uStKuOsPuXtVsUt_ Y#"!"%#")("--"12"58"9>"=E"AM"EU"I^"Mh"Qr"U{"Y"\titJuKuRu`ugscs\uksfS@@@@S< @ @ @ L9@LC IFI9 I1 @ @ B@>@ !W!a^fehZbaehmmr_geknut|RZZadkkrrwxEMMTU^^fhqqy{U;$R>$PAMDJGGJDMBO?RS5SGUEU3Z-.WZ+e>z"$&#$$~z`%v r`4|^|`T0S R V0^fOabc y0w u t s{4~^~(1=0=;>;>0?0?;@;@0A0A;xUxfzhzWyVyfTOTR^M^V fGeIfKfN URUXTU]Q^P=;0-3-?.?.3/3/?0?03131?ReZO>1  >5 @7?7@904.4.>0>05>:/6/8/:/<SUXVZ\_]4~ bRdE{ERZacehhhi0YKM = {{zzxupii{oizvhu5!6Jdp u{!%*.0VE~Xdffhff\7Qelsu v|!$,/w,3~42ge +)PS6g^lENdC|C FOOrPpPo Y_3l X ;44" zJzOz]{]{azazfk{`p3_3^2Z2Y3Y322220:+E-E/D/DJFJ`R`OqAzJkTDJ~0NZZ}dDD|dYPEDYRLKGDC? : 72*=P@QBRESKUOVRWVX@`tUz_zNrWOqNrMsLuJwIxHyG{20=2E-qDdOkVwJqD=N=4E/=422C/鐹<.lN8O7?>X?>5^FeKgOhSjVkXl[m^n`ohtmuncecdYmZbO^V7nI~5\6[^2NE:P1??@{V[S{fj\`pOk{S`NGGGIGGNBNCLFSL3+\\k]Q?[TNBE@Y ) ) FWEEVRQ1LT1O]2LE7P/==>{dhYA[ Y 9/\{X]TGI`P~trr}pwumtcUXBCc[trwxWsYE |mSn}^2M]HH!Q!QKZM\N^N_O{WY[[\P0>>?{eiE9O1E8N1J4fhat5^\{c\~\{b]_Q\PYOVNRMOLKKHJX cQ.QyLlYq\nixTuac`QhkLxH}GGHMzbbr^yVX]QOZRFWR=TR5RA4T9ZB]j*o4g+d l#ai_f\ccObPrCxIjWslXlNhFe>b9``oeqwv46<74:<;4>K\>G\>C\>>\>:\>6[aRjZaXaUQaSj[C1=533uy!}wYsr{tzusraVVW+a*h}hlg=!qzhk|qt{r|qk^_}^f}b{{}{}vwrrnmjifeba_]YUzvtmJDEE1EHMHSWRNUYSN]YjxjtZzUZ_d`~\w`rQi{fa|ewlo_jQfHb=^tgtU k]fPrFhRsHkTuJut}XVTRQOMJGXO !I !FK6CO4ItCoBnAI9LxGlDF;O{KiGE>R|OfIMCcLLFKFV{S]r#\2^&Z1Z(W2W+U2T2Q ^+bZvPrWzPwT~Q1]/[ , 7*4'2%/"] Z$$V((S,,P00M44.88+<<*HH4@ @+D D,LL1PP.TT/XX0\\0``1dd2hh3ll3pp4tt5xx6||7789:: ; < G8pA rAG40CDH6 Dt?H6I6[  HYYXXGAOOO?9G6EEVVDI9IFKGK:S_LaLa?mAO;ODMDM:oBH7EH7!J8F F32DC2C512;nBJ:JFT`K EUN;NCO4 ) HX@N8F3FO5I8 D6`>J:J;Tq>s=v=w>?@A@BCQOhHgIfH`HMEGUMUMXqqqqqqq11qqacqq1q1qrrqqaAaAqqBaAqqBaAqqAaAaAaaAbAAABAAF1111>qqqq11qqacqq1q1qrrqqaAaAqqBaAqqBaAqqAaAaAaaAbAAABAAF111118qqqaq1qqAqAAABEC8qqqaq1qqAqAAABEC14+ f;?  }S6rrr221111111111111111111111BBAABBAcdAd6stusr3q2111111111111111111111CCAAAAbAaAacaAdaAd6stutq5q21q11q1111111111111111111EAAAAdAAcAaAacaAdaAd6stvuq5q31q21q21q11q11q1q111111111111111CACAAbeAdAAcAaAacaAdaAd6suvq2rq4q4q21q21q21q11q11q11q1q1q1q11111111111BAACAAAAAaaabcdeeAAdAAcAaAacaAdaAd#?]|T5Trt2q2Tqtq1q3q1qTts2q1qTrrqqqTqqqqqTj%K XWWWAWAWWXWWVVVUTTRTRW WVVVAAVAVWXWWVVVUTTRTRW XWWWAWAWWXWWVVVUTSRXX XWWWAVWWXWVVRQSUQrRQRqUXYX WVVVAUVVWVRQSTQQqTQrSRqTWWYX WVVVAUVVWVRQSTQQqTQrSRqTWWYX XWWWAVWWXWVVRQSUQrRQRqUXYX XWWWAWAWWXWWVVVUTSRXXh] XWWWAWAWWXWWVVVUTTRTSX XWWWAWAWWXWWVVSRSTURX XWWWAVWWXWWVVVUSXX WWWWAVWWWWWVVVUXX XWWWAVWWXWWVVVSQSXX XWWWAWAWWXWWVSRSRSTURX XWWWAWAWWXWWVVVUTTRTSX&__U__SQ_^SR_[RT_WSQQ_TQRQ_SQQR]QSQQZQQSRVRQQSQQQRQRRQRQQQQRR4u $ruuqqq1q11q11q1q1q11q11q1q1q1q1q1qsqrqqqrqrrrrqq E(qssqqq1q1q1q1qq1q1q1q1qq1q1q1qqrqqqqqrqq(rrqqqqqqqqqqqqqqqqrqqqqqqq(qqqqqqqqqqqqqqqqqqqqqqqq!(baacccaaaaaaaaaaaaaaaaaaaaaaccCCCCB4 ( n) !5%a$a%A%A$%%A$(&A!!"&!!a(a"&!a"#a%!"A!AK"!±FF#1BBEBqB$1AAA3AAqB$BAA2AAqB#BAA11AAC"CAA2AAC"CAA3AAC!!DAA3AAC!!DAA3AAqC!!"CAA3AAqCb!!CAA11AArCa!aDBA2ABCq!!aHEFq!!aDrBBqBBrBq!ACqBAAqAAAqBB!BBBqBAAqAAAqBBq!ABBqBAAqAAAqBB"AEqBAAqAAAqBBA"AACqBABBBCA"AACqBAEGC#AADBECAB#BHEACA$BHEACA$BGEAqCqA%AGEAqCq!!!FABqAq!AAB!AJCqq#E!qACCrq!q!qq!!q!r!"qqq!&!##"!!s!#!##$"qqr!$rrr!q$""(q"q!q#$"qq")"!"$!q!q!q!)!q#q!%q!q!q*!q#!%"q"+#&!q!,#'/!5%a$a%A%A$%%A$(&A!!"&!!a(a"&!a"#a%!"A!AK"!±FF#1BBEBqB$1AAA3AAqB$BAA2AAqB#BAA11AAC"CAA2AAC"CAA3AAC!!DAA3AAC!!DAA3AAqC!!"CAA3AAqCb!!CAA11AArCa!aDBA2ABCq!!aHEFq!!aDrBBqBBrBq!ACqBAAqAAAqBB!BBBqBAAqAAAqBBq!ABBqBAAqAAAqBB"AEqBAAqAAAqBBA"AACqBABBBCA"AACqBAEGC#AADBECAB#BHEAAAA$BHEABqAA$BGECqAA%AGEqBqAq!!!FABqAABJBqq!"Eq!qACCBq"!qq!!qq#"q!&!"qs"!rqq#!s"$!rr#$"!q"$!qq!("!!"$r!!r)q"q"$#q#)"q"%!q!q!*#q#%!q!q!+"q"&q!q,!q!'/!4%a$a%A%A$%%A$(&A!!"&!!a(a"&!a"#a%!"A!AK"!±FF#1BBEBqB$1AAA3AAqB$BAA2AAqB#BAA11AAC"CAA2AAC"CAA3AAC!!DAA3AAC!!DAA3AAqC!!"CAA3AAqCb!!CAA11AArCa!aDBA2ABCq!!aHEFq!!aDrBBqBBrBq!ACqBAAqAAAqBB!BBBqBAAqAAAqBBq!ABBqBAAqAAAqBB"AEqBAAqAAAqBBA"AACqBABBBCA"AACqBAECAC#AADBEACB#BHEACA$BHEAqCqA$BGEAqCqA!!AEEBqAqAABAECqA"E!qBIrAq!q!qqACAAAqr!"qqq!!#"!!s!#!##$"qqqq!$rrr!$""(q"q!q#$"qq")"!"$!q!q!q!)!#q!%q!q!q*!q#q!%"q"+#&!q!,#'/!4%a$a%A%A$%%A$(&A!!"&!!a(a"&!a"#a%!"A!AK"!±FF#1BBEBqB$1AAA3AAqB$BAA2AAqB#BAA11AAC"CAA2AAC"CAA3AAC!!DAA3AAC!!DAA3AAqC!!"CAA3AAqCb!!CAA11AArCa!aDBA2ABCq!!aHEFq!!aDrBBqBBrBq!ACqBAAqAAAqBB!BBBqBAAqAAAqBBq!ABBqBAAqAAAqBB"AEqBAAqAAAqBBA"AACqBABBBCA"AACqBAECAC#AADBEAAAB#BHEABqBA$BHECqAA$BGEqBqAq!!AEEBqAAABAEBqAqq"EqqAIB!"!qqACAABqq#"q!!qr"!rqq#!sq"$!rr#$"q!q"$!qq!("!!"$r!!r)q"q"q$#q#)"q"%!q!q!*#q#%!q!q!+"q"&q!q,!!'/ *Vr$b%qa%c"$ac!b!e&b"qac#e"caag!acbad!ebccfafbqdbhbqb!abhbq"abhb$bh$chD$ch#cdqba"!qbbrca!%cr"c!a%bq$ba%ba&d!$b!b&b!$a"a&a$!a!a'a!$!c'a!$"a&a!$!'!a#!)a#+$b%qa%c"$ac!b!e&c"qac#e"caag!acbae!ebbdfaecqdbhbqb!abhbq"abhb$bh$chD$ch!#cdqc!"!cbrc$er"c!$cr#c!#c#a$c!#b#a%b"#a!#a%b"#a""a%!b"#a"!a$b!#b!"$!a!#!(#a$'"a%'"$b%qa#!b"c"qac&c"cb#e!acaah!ebaefbbdqeaecqb!abhbq"abhb$abhb$bh$chD$cha!#cdqca!"!qbbrbb$cr"bb$bq#ca#b!a&ba#!b!b&aa#!a"a%ba$a!%a!a%b!%b!a%a'a!%a(!$a(!$*$b%qa#!b"c"qac&b"cb#e!acaag!ebadfbccqeaebqb!abhbq"abhb$abhb$bh$chD$chb#chb"!qbbqcb!$cr!b!b$c#bb#c%b"a#!c&a!"a#"b!&a!"a#"a!&a!"a##a&a!a##a%b!#"a'a#$!a&a"&&" 3U$b%qa#!b"c"qac&b"cb#e!acaag!ebadfbccqeaebqb!abhbq"abhb$abhbbhDchD$chbA#chb"!qbbqcb!$cr!b!b$c#bb#c%b"a#!c&a!"a#"b!&a!"a#"a!&a!"a##a&a!a##a%b!#"a'a#$!a&a"&&"$b%qa%c"$ac!b!e&b"qac#e"caag!acbad!ebccfafbqdbhbqb!abhbq"abhbbhDchD$chA#cdqba"!qbbrca!%cr"c!a%bq$ba%ba&d!$b!b&b!$a"a&a$!a!a'a!$!c'a!$"a&a!$!'!a#!)a#+$b%qa%c"$ac!b!e&c"qac#e"caag!acbae!ebbdfaecqdbhbqb!abhbq"abhbbhDchD$ch!A#cdqc!"!cbrc$er"c!$cr#c!#c#a$c!#b#a%b"#a!#a%b"#a""a%!b"#a"!a$b!#b!"$!a!#!(#a$'"a%'"$b%qa#!b"c"qac&c"cb#e!acaah!ebaefbbdqeaecqb!abhbq"abhb$abhbbhDchD$cha!A#cdqca!"!qbbrbb$cr"bb$bq#ca#b!a&ba#!b!b&aa#!a"a%ba$a!%a!a%b!%b!a%a'a!%a(!$a(!$*4  ^  t6"/&/+/&q/+/&/+q/%q/*r/%/)/%/(/$q/(q/$/'/$/&/#/%/#/#/#qqq/#qqq/#/#/#v/#/#/#v#q/!q!v!qst#/!!q1t!q2q#/!!q1q2q!q/"#/!!q1!/"#.!!q!/"q2q#.!!q2q!/"q2q#.!!q2q!/"q2r#.!r2q!!!!!!!!!!q#.!q!q#.r!!!!!!!!!qq!!!!!!!!!rr!!!!!!!!!qq.q!!!!!!!!!/q!!!!!!!!!sqq/qqs!!!!!!!!!sqq/!qqqq!!!!!!!!!qqqq/!qqs 2))((((q((q((((((q(q(('q'q'q'q'q'q'q'q'q'q'q(((q(q'"$q!q#q!q!q"qq!qqAqqAAqAAqBc!Aa!A!Afa!A"Ada#A!$A!a%a0+*++++++++!!+!!+AA*a*A*qa&&ssaA&qqA&sBqq&qq%rqArq%qAq%rrq%qAq%qArq$Aq$Ar#Aqq#sq"arb"rA!aqbA!Áq!arqbrAbqbAqgAAaaaA!!AaA!ABA"BA"B"B"A# 9&q&q&q&q"&q"&"&"&!&!q&!q&!q&&q&q&q&&q&q&%%q%%$q$q$q#!#!#q!"""""q""q""#"#&&&&&&$qa"qbaqccqaqq11b1AbAbaAbAbAABAA%$#B"A!BABA'''A'AaA'BaA(CA)FA+D a!a!a!a!#aa!aac!cgccaaaaaaaa!aaa!a!a!a%%U*U%!*$!!!!%! !%!!!!!!%!!!!!!A/'/'/'/'/'/%/'/'!/%!%!*$!!!!%! !%!!!!!!%!!!!!!&A*%A*%A*&*%*%(&)&*%(!$!!!!% !%!!!!!!%!!!!!!-(A$'AA#'AA#(#'#%!#$$!!%! !%!!!!!%!!!!!!(A$'AA"'AA"($'#("$!!"!!!$!$!!!!!!$!!!"!!!$!*!'A&'A%'A%''''''''!%!%$q%q$($*$,$.A/'A/%A/%/'/'/'/'/%/&KySA/'/'/'/'/'/&/'/%/&'A'&A'&A'''''''''!%!%$'$($*$,$.(A$'AA"'AA"($'#("$!!"!!!$!$!!!!!!$!!!"!!!$!*!-(A#'AA"'AA#(#'"%!"$$!!%! !%!!!!!%!!!!!!&A)&A(&A(&*%*%)&)&*%(!$!!!!% !%!!!!!!$!!!!!!A/&A/%A/%/'/'/'/'/'!/%!%!*$!!!!%! !%!!!!!!%!!!!!!%!*$!!!!%! !%!!!!!!%!!!!!!4 yOqqqqqrqqqqqqrqqqqabaaa11raqrraaqqqrqqqrraaqrraaaqqaqqrr11qqr1qrqqqrqr11rrr1rqqqqqqrrrqqrqqrrqqqqqrrrrrrrqrqqqrsqqrqrqrrsAqAasqqaAqAaAqrqrAaAaAaAqrsaAaAaaAaAqrqrAaAaAaaAaAaqqqqqAaAaAaaAaAaqqqqqaAaAaAaAaAaAqqAqqaAaAaAaAaAaAqqAqqaAaAaAaAaAaAqqAqAaAaAaAaAaAAqAaAaAaAaAaAaAAaAaAaAaAaAaAaAAaAAaAaAaAaAaAaAAaAaAaAaAaAaAAaAaAaAaAaAAaAAaAAaAaAaAaAAaAAaAAaAaAaAaAAaBAAABAAAAAAAABAAAAAABCAAAAACOLOqqqqqqqqqqqqqqabaaa11raqrraaqqqrqqqrraaqrraaaqqaqqrr11qqr1qrqqqrqr11rrr1rqqqqqqrrrqqrqqrrqqqqqrrrrrrrqrqqqrsqqrqrqrrsAqAasqqaAqAaAqrqrAaAaAaAqrsaAaAaaAaAqrqrAaAaAaaAaAaqqqqqAaAaAaaAaAaqqqqqaAaAaAaAaAaAqqAqqaAaAaAaAaAaAqqAqqaAaAaAaAaAaAqqAqAaAaAaAaAaAAqAaAaAaAaAaAaAAaAaAaAaAaAaAaAAaAAaAaAaAaAaAaAAaAaAaAaAaAaAAaAaAaAaAaAAaAAaAAaAaAaAaAAaAAaAAaAaAaAaAAaBAAABAAAAAAAABAAAAAABCAAAAACOLNqqqqqqqqqqqabaaa11qaqqaaqrrqqqqaaqraaaqrqaqqqq11qrq1qqr11qqr1qqrqqqqqrqqrrqqqqqqqrrqqrrrqsrAqAqqrqaAqAarqrqaAaAaAsrqaAaaAaArqqqAaAaaAaAqqqqqAaAaaAaAqqqqqaAaAaAaAaqqqqqaAaAaAaAaqqAqqaAaAaAaAaqAqAaAaAaAaAaAaAaAaAaAaAaAaAaAaAaAaAAaAAAaaAaAaAaaAAAaaAaAaAaAAaAaAaAaAaAaAaAaAaAAaAABAAAABAAABBAAAABCBAACLJNqqqqqqqqqqqabaaa11qaqqaaqrrqqqqaaqraaaqrqaqqqq11qrq1qqr11qqr1qqrqqqqqrqqrrqqqqqqqrrqqrrrqsrAqAqqrqaAqAarqrqaAaAaAsrqaAaaAaArqqqAaAaaAaAqqqqqAaAaaAaAqqqqqaAaAaAaAaqqqqqaAaAaAaAaqqAqqaAaAaAaAaqAqAaAaAaAaAaAaAaAaAaAaAaAaAaAaAaAaAAaAAAaaAaAaAaaAAAaaAaAaAaAAaAaAaAaAaAaAaAaAaAAaAABAAAABAAABBAAAABCBAACLJCqqqqqa1rarqqqarcqrrrr1q1qqrqqqqqqqrqqqqqqqqrrqqqqAqAqrqAqArraAaaAarrAaAaAaArrAaAaAaArrAaAaAaAqaAaAaAAAAaAAaAaAaAaAAaAaAaAAAA AAAAAAAAAAAAAAAAAGCqqqqqqqqa1rarqqqarcqrrrr1q1qqrqqqqqqqrqqqqqqqqrrqqqqAqAqrqAqArraAaaAarrAaAaAaArrAaAaAaArrAaAaAaAqaAaAaAAAAaAAaAaAaAaAAaAaAaAAAA AAAAAAAAAAAAAAAAAG>qqqqqqq11qqacqq1q1qsqqaAarqBarqBarqAaAqAbaAbAabAABCBF>qqqq11qqacqq1q1qsqqaAarqBarqBarqAaAqAbaAbAabAABCBF8qqqaq1qqAqAAABEC8qqqaq1qqAqAAABEC4v4 !q!q!q!q!qqa!aqaqaqcqcqbqbqaqq )q)(q(q(q('q'q'q&qq%qq#qs4X yn c% ,3q2s2s2rA2q2qq2rq3qAq4Aq332222222q2222222qr3r3s3s3s3r4s4qr4qr4qr4qr4r4r4qq4q4q4r4q144 +3q2s2s2rA2q2qq2rq3qAq4Aq3322222q1111q1111r1t11s3t3s3r3qs3qs3rr3r1r3r1r3r1r3r1r3r1r2r1r2r2r2r2r2q2q2322 *3q2s2s2rA2q2qq2rq3qAq4Aq33222222q2222222q2rq3qq3qr3s3qr3qs3rr3r1r3r1r2r1r2r3r1s3r1r3r1r4rr4rq5q5q5 +3q2s2s2rA2q2qq2rq3qAq4Aq33222222q2222q22q2q2r3r3s3r3t3qr3qr3qr3qr3qr2rr2rr2r1r1r1r2rq3r4q4q5 ,3q2s2s2rA2q2qq2rq3qAq4Aq33222222222q22q2q2r2t2t3s3s3r4r4r4r4r4r3r3r2r2qr2s2r3r4q44 ,3q2s2s2rA2q2qq2rq3qAq4Aq33222221q1q1q1qq1q1q11r1t1At3s3s3t3s4s4s4qq4qq4qq4qq3rq3t3qq3q12r12q2232 +3q2s2s2rA2q2qq2rq3qAq4Aq33222221q1q1q1qq2222r2t2t3t3t3rq3rq3rq3rr2s1r2r2r2r2r2r2r2r2r1s2r1r3r1r3rq4q54 *3q2s2s2rA2q2qq2rq3qAq4Aq3322222222q222q22r2s2t3t3t3rq3rr3r1r3q1r2r2r2r2r2r3r2r3r1r3rr4r4r6q6q7 +3q2s2s2rA2q2qq2rq3qAq4Aq33222222222q2222q2rq2rq3qq3t3t4s4s5r5r4r4r3rq2rq21r21r31r31q326  .3qq2qq2qq2qBAq2A2qrq2qq3ArA4r3B2qq1q11111q11q111q111qq11s11t3u3u3rr3r1r3r1r3r1r3r1r3r1q3q1q3r13r1q3r1r3r1r3r1q3r13r13q33 .3qq2qq2qq2qBAq2A2qrq2qq3ArA4r3B2qq1qq111q11q1q1111q111q3u3u3u3u3rr3r1r3r1r3r1r3r1r3r1q3q1q3r13r1r3r1q3r13r13r3r3r3q33 .3qq2qq2qq2qBAq2A2qrq2qq3ArA4r3B2qq2q11111111111q11q11tA11t3u3u3rr3r1r3r1r3r1r3r1r3r1q3q1q3r13r1q3r13r13r3r3q33 .3qq2qq2qq2qBAq2A2qrq2qq3ArA4r3B2qq1qq11111q11q11111qq2u3u3u3u3rr3r1r3r1r3r1r3r1r3r1q3q1q3r1q3r1r3r1r3r1r3q1r31r31r6q66 .3qq2qq2qq2qBAq2A2qrq2qq3ArA4r3B2qq1qq111q11q1q111123Aq3t3t3u3u3rr3r1r3r1r3r1r3r1r3q1r31r3q1q3q1r31r31r31r6r6r6r6q66 .3qq2qq2qq2qBAq2A2qrq2qq3ArA4r3B2qq1qq111111q111122q2Au3u3u3u3rr3r1r3r1r3r1r3r1r3q1r3q1r31q3q1r31r31r6r6r6q66 {F .3qq2v2v2v2v2v3t3qr43211111111122333u3u3u3u3rq3r13r1q3r1q3r1q3r1q3q1r3r1r3r1r3r1r3r13r1r3r3r33 .3qq2v2v2v2v2v3t3qr43211111111111333u3u3u3u3rq3r13r13r1q3r1q3r1q3r1r3q1r3q1r3r1r3r1r3r13r3r3r3r33 .3qq2v2v2v2v2v3t3qr43211111111111111111u3u3u3u3rq3r1q3r1q3q1q3q1q3q1q3q1r3r1r3r1r3r1r3r1r3r1r3r1313r3r3r .3qq2v2v2v2v2v3t3qr4321111111111111113u3u3u3u3qr31q3q1q3q1r3q1r3q1r3r1r3r1q3r1r3r1r31r3r1r6r6r66 .3qq2v2v2v2v2v3t3qr43211111111111111111u3u3u3u3qr31r31r3q1r3q1r3q1r3r1r3r1q3r1q3r1r3r1r31r6r6r6r6r66 .3qq2v2v2v2v2v3t3qr432111111111111133u3u3u3u3qr3q1r3q1r3q1q3q1q3q1q3r1q3r1r3r1r3r1r3r1r3r1r31r316r6r6r4W\1  k/[ZZZYYYZ[[[ZqYSXXQqXXQQX oeZYYYYAYYZZZYYqYYXqQXXXocYYXXXAXYYYYXWqWVqRRRRocYXXXXAXXYYYXWqWVqQTqQQn WVVVVVVWWWVVqURqQRUQS l WVVVVVVWWWVUqSQqQUQQQQ l k3ZZYYYAYZZZZYYqXXqXXQXodZZYYYAYZZZYXWqVVqVWQWod[ZZZAZZ[ZZXVUqUVqWXQXod[ZZZAZZWSVRVRUU VqVWqXXQXod[ZTUUTAUTUqSUTURVQVWWqXXqXXQXod '\\‘V‘qVqaaaqVrcbqVqdVV aaVaaVcaaaVcaaXaaXcaaXaaaXcaaXaaXcaaXaaaXcaWaYQa^a_Q__WqWqbBbaqWqbBbbWjWhW aWaWcaaaWcaaXaaXcaaXaaaXcaaXaaXcaaXaaaXcaWaYaa^a_Q_UR_URTSbrqaaaQbqrbbogQQaaQabaeaaaQabaeaaaQabaeaaaQabaaaaQabaSaaaQabaaaaaQaaaaaaQadcaQaaQaQVaQaVaQa_aQ_Q_^^QQRSWQQRRWQQRQbasteQaasudabazeogQaQaaaQaaaeabaQaaaeabaQaaaeabaQaaaabaQaaaRQabaQaaaabaQaaaaaQacdaQaaQaQVaQaVaQa_aQ_Q 'Q Qj gcgcaaaabaaqaaaqdaaqaabaaaa11qaaAa1aqaaqAa1qaaa1qaacqaaaabaaaaAqaa!a!aaၡacaaaaba!aaaaaaaaaaaᡑaaaaagcgc ddaccccdda  RR_U_ZsT_TqQQq_SqQQq_TSrqQr_TsWvUsWvUrWUr  !VUUAAUUUVAVAUUTqTqTqTqRqRqRSRVUQUQTQTQV#TSSAASSSTATASSSqSqRqRqRqRRqRRVSSRSRTVV%RQQAAQQQRARAQQQqQqQqQqQqQqQRRUTT n\[QXATRqQqqqrArQrQqqQAAqQBAQqRBAAQRBARSBRqSARqRAASQAAAQAAQRBTAUV YYYAXYYYAXqUqTqRqQqqqqqqQqQARAAQRCqSRSRRAAQAAAQAAQRBTAUV UUUATUUVVUqUqURQqRrSrqTqqTqqRAAFQQAAAAAAAQRBTAUV TTTATTTUUTqTqSSBQQBQqBQBRqBSqBSqBQBBAAFQQQAAAAAAAQQBRAQRV TSSSSSTTSSRAQCCQCQCRCRCRCQCCCAEQRAAAAAAARBRAQV l+ UTaTbTAAUaUVUTTqTSSqSSSqSSqRqTR UTaTbTAAUaUVUTTqSSSqSQSQSUqSUS UTaTbTAAUaUVUTTqSSSqSQrSRSqVT UTaTbTAAUaUVUTTqSSSqRQRQRqUqRqUS4 b wF ,3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B2B1B1B1B1B1B12222333344444444q4q444q144 +3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B1B1B1B1B1A111111A3333333131313131212222q2q32322 *3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B2B1B1B1B1A11222233333313121231313144q5q55 +3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B2B2B2B2B2B2B2A222233333333222111q234q45 ,3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B2B2B2B2B2B2B2B2B222333444443322q2234q44 ,3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B2B2B2B2B2B2B2B2B2223333333444333q31q212q2232 +3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B1B1B1B1B1B1B1B1B1113333332122222222121313qq454 *3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B2B2B2B2B2B2B2B2B2223333312122222323134q46q67 +3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B2B2B2B2B2B2B2B2A222333445544322q1213131q326  .3aa2aa2bb2aBAa2aAa2aba2bAb3d3b32111r1B1B1C1C1C1C1C1C1B1A1A133331313131313131313131313131333 .3aa2aa2bb2aBAa2aAa2aba2bAb3d3b32111r1B1B1B1C1C1C1C1C1B1A223333131313131313131313131333333 .3aa2aa2bb2aBAa2aAa2aba2bAb3d3b32111r1B1B1B1B1C1C1D1D1C11A113333131313131313131313133333 .3aa2aa2bb2aBAa2aAa2aba2bAb3d3b32111r1B1B1B1B1C1C1C1C1C12233331313131313131313131313131666 .3aa2aa2bb2aBAa2aAa2aba2bAb3d3b32211r1B1B1B1C1C1C1C1C1C1223333131313131313131313131666666 .3aa2aa2bb2aBAa2aAa2aba2bAb3d3b32111r1B1B1C1C1C1C1C1C1C12A23333131313131313131313166666 iz .3d2f2f2f2f2d3d3d4321111111111112223333131313131313131313131r3333 .3d2f2f2f2f2d3d3d4321111111111111223333131313131313131313131333333 .3d2f2f2f2f2d3d3d432111111111111122333313131313131313131313131313r3r3r .3d2f2f2f2f2d3d3d432111111111111112333313131313131313131313r16666 .3d2f2f2f2f2d3d3d4321111111111111123333131313131313131313131666666 .3d2f2f2f2f2d3d3d432111111111111112333313131313131313131313131316r6r6r4^ 9 J& ,3222A2223A4A3A3A2AA2AA2BA2B2A22A2A2A2AA1qAA1223333344444444A4A444A144 ,3222A2223A4A3A3A2AA2BA2BA2A2A1A1A1B1B1B1A1111133333331313131312122222A2A2322 ,3222A2223A4A3A3A2AA2AA2AA2B2B2A2A2B2B2A1qA1B2A2333333313121231313144A5A55 ,3222A2223A4A3A3A2AA2AA2AA2B2B2A2A2A2B2A1qB1A2A2333333333222111A234A45 ,3222A2223A4A3A3A2AA2AA2AA2A2A2B2B2B2B2B1qB1A2223334444433222234A44 ,3222A2223A4A3A3A2AA2AA2AA2A2A1AA1AB1AB1AB1AC1qB11A11A3333444444333A31A212A2232 ,3222A2223A4A3A3A2AA2AA2AA2A2A1AB1AB1AB1AB2B1qB1A2223333332122222222121313A4A54 ,3222A2223A4A3A3A2AA2AA2AA2A2B2B2B2A2A2B1qA1B2A223333313122222323134A46A67 ,3222A2223A4A3A3A2AA2AA2AA2A2A2B2B2B2A2A1qB1B2A22333445544322A1213131A326  .3222BA2A223AA4B33A2ABA2ABB2ABB2AAB2AA2AA2AA2AA2AA2AB2AB2AB2AA223333313131313131313131313131333 .3222BA2A223AA4B33A2ABA2ABB2ABB2AAB2AA2AA2AA2AA2AA2AB2AA2A23333333313131313131313131333333 .3222BA2A223AA4B33A2ABA2ABB2ABB2AAB2AA2AA2AA2AA2AA2AA2AB2AA2A2A2333331313131313131313133333 .3222BA2A223AA4B33A2ABA2ABB2ABB2AAB2AA2AA2AA2AA2AA2AA2BA2BA3333333313131313131313131313131666 .3222BA2A223AA4B33A2ABA2ABB2ABB2AAB2AA2AA2AA2AA2AA2AA2AA2B3A33333331313131313131313131666666 .3222BA2A223AA4B33A2ABA2ABB2ABB2AAB2AA2AA2AA2AA2AA2AA2AA2233333331313131313131313166666 oG .3222233443B3BA2AC2BC2G2G2G2ACA2ACA2ACA2ABA2ABA2ABA3BA3A333333131313131313131313131r3333 .3222233443B3BA2AC2BC2G2G2G2ACA2ACA2ACA2ABA2ABA2ABA3BA3333333131313131313131313131333333 .3222233443B3BA2AC2BC2G2G2G2ACA2ACA2ACA2ABA2ABA2ABA2ABA2A23333313131313131313131313131313r3r3r .3222233443B3BA2AC2BC2G2G2G2ACA2ACA2ACA2ABA2ABA2AB2B233333313131313131313131313r16666 .3222233443B3BA2AC2BC2G2G2G2ACA2ACA2ACA2ABA2ABA2ABA2AB2233333131313131313131313131666666 .3222233443B3BA2AC2BC2G2G2G2ACA2ACA2ACA2ABA2ABA2ABA2BA333333313131313131313131313131316r6r6r4  5 ET"2211A11A12322q2q2qq22qq22q2q2222233322211r1Aq2q3q3q3#2211A11A12322q2q2qq22qq22qq2222222233332r1qA11q2q2q3#2211A11A12322q2q2qq22q2q2r2222222222122212Ar2r2q2q12#2211A11A12322q2q2r1q1s1q1s1q1A122222222121222A2q1qA2q11q3q1q312"2211A11A12322q1q1s1qs111s1A1112222222121A21A3qr3qq4q3"2211A11A12322q2q2q2q1r1q1s1q1A12222222212A11r1q2q3q3q3#2211A11A12322q2q2qq22q2q2r2q222222333332q1q11q2q2q3#2211A11A12322q2q2qq22qq22qq2222222222122121A2r2r2q2q12#2211A11A12322q2q2qq22qq22q2q2222222222121222A2q1qA2q11q3q1q312"2211A11A12322q2q2qq22qq22r2q222222222111121A3qA3qq4qq4q3 XC#2211AA1A11A2321qq1qqq1s11s11s11122221212121212121q2q1q2q1212#2211AA1A11A2321qq1qqq1s11s11s112222212121212121q21q212q12q22#2211AA1A11A2321qq1qqq1s11s11s111222212121212121q21q2q12q22#2211AA1A11A2321qq1qqq1s11s11s1122222121212121212q1q2q1q21q214#2211AA1A11A2321qq1qqq1s11s11s2222222121212121212q121q4q4q44#2211AA1A11A2321qq1qqq1s11s11s1122222121212121212q1q2q1q21q214 -O#22111112321s1qq1s11s11s11222221212121212q12q1q21q2q1q2q14#22111112321s1qq1s11s11s222222212121212q12q121q21q4q444q#22111112321s1qq1s11s11s112222212121212121q2q1q2q1q2121q4q#22111112321s1qq1s11s11s11122221212121q21q21q212q12q22#22111112321s1qq1s11s11s1122222121212121q21q21q2q12q1222q#22111112321s1qq1s11s11s111222212121212121q21q2q1q2q12124  tI:"\[TUUSaSUUVaUSSqVaUSS!rVaUSS!qq!VaUSSqVaUqSqSq"q!VaUSS!!VaUSS""VaVUUVaVUUqqVaVaUaUa]aUaUaqqqTVaUaUaqqSUaUaUaqqqRaTaUaUaqqUaWaUaUaqqqUaWaUaUaqqUaWaUaUaqqqUaWaUaUaUaWaUaUa\aWaUaUa\aWaUaUa\aWaUaUa\aWaUaUa\aWaUaUa\[ZYrYXAqWVqUqUTqSqRQqqq1ZYYXWWqVqUrUsTqSqqSqqRqQqqqQsqrqqqsqrqqqqqrqqqqqqqqrqrqrqqrÁrqqqāqqāqqrqqłqƁƁ%WWqqWvVwVuVvqVuqVuqUwqUuqUqTqrrqTqqqqqSqqqSqqqrRqqqrRqqrRqqqqQqQqqqqqqrqrqqrqrqqqQBAAAAqQqAAAqBBQqqqQqqqQqQqQrqrQqSqRTqRqURrrVqRW"VAVAVAVAUAUAUAASAAAASAAASABAARAAAAARAAqqAAAqAAqAAAAAAAqAAqqBAqqAqQBAqqqQA‡QBQBqqrRAqRAqRqRqRrqSqSqqSqqqqTrqqqTAqqRQQTTTQQAQ2A±1AQQAQQAAAAAAA2A2AQAAAAAAQQQQQQQQ11313131313Q3QPOA /QQqRqRQqqqqqqqqqrqqqqqqqqqqqqqqqqqqqqrqqqqqqqqqqqRRbSaTaQaQaRaaRaaSaSabSaTaTaaTaaTaTaaTaTaaSabSaaSaaQQcaQabRa!UTr_STsZTvTT|T|TzVTxUUqtSUrrRUrzqVqyqaVqubRaqcQqcQRcQQQQRbTQQQTQQQSQXRQQQZQQQ[RQ]QQ^R_Q UUUUSRbbQaqqaQqAqQaqaQaaQaaaaQaaaaaaaabaabbaababbaabbaabbaabbaaaaabaaaaaaQaaaaQaaQQaaAQaaaaARaaaaATaaA T1R11Q1Q11Q11Q21Q6Q111Q1111Q11Q111Q121Q11Q1q1QqqQQRRTSASBQAAAQAQAAvqqvvvvvAqqAvAvVTSySqvqSsSqqRqrQrqqQssvQqqxqrrrruqsrqqQqqqQqqqqQqqrrQrrwRrq}RqsrRrqqRqUSsVqSqVqSqrVuTuWrrUWR4#  H q# 21qq1qq1qqqqqqqqqqqqqqqqqrqrrqqqqqqrqqqrqqqrqqqrqrqqqqqsqqqr1qqr1qqq1qqq12 21qq1qq1qqqqqqqqqqqqqqqqqrqrqrqqqqqqrqqqrqqqrqqrqqrqqsqqrqqq1rqq1qqq1qqq12 21qq1qq1qqqqqqqqqqqqqqqqqrqrqrqqqqqqrqqqrqqqrqqrqqrqqsqqrqqq1rqq1qqq1qqq12 21qq1qq1qqqqqqqqqqqqqqqqqrqrrqqqqqqrqqqrqqqrqqqrqrqqqqqsqqqr1qqr1qqq1qqq12 21qq1qcq1qqqqqqqqqqqqqqqqqrqrrqqqqqqrqqqrqqqrqqqrqrqqqqqsqqqr1qqr1qqq1qqq12 21qq1qq1qqqqqqqqqqqqqqrqqqsqqqqqqqrqqsqqsqqqqqqqqsqrqq1rqq1rqq1qq12 oKb 62uBArCrsstsqruqr2utrq5rsq8tr;qq> :q1q9u52qs4w3q1q4qrr2u41qqq2qs42qqw42qqqrr342qrqqqq14q11qu1qq53qs2qq1:1q2qrq:21qu2;4qs21?31q12?324?45?;?7?8 258; )3r3q2s2r211qqrq1222211124444444133321135O!.65E355sJ65uuI5uuvrD5Auuvu5Aqquvu5Aqquvu5Aqqqqqqu5qqqqqqu5qqqqqqu5uqqqqq5Auuvq5Auuvq5Auuvq4Buuvu4AEquvu4AGvu3AAHu3AAAF2AAAAqAA2AACAqaqсA2AAAAraqSA1AAAqaArQQB1AAAAAqcAqQQBAABBqarSBDAAAqaaArQQBACCAqaaAqRBAAACCqTAAAAAACCRAAAƒAAAAACAAAAƒAAAAA2AAAAƒAAAA32AAAAƒA352AAAA135212A1352151552151552151555517555175551>55?65?65?=!.65E355sJ65uuI5uuvrD5Auuvu5Aqrqqvu5Aqrqqvu5Aqrqqqqu5qrqqqqqq5qrqqqqqq5qrqqqqqq5Auuvqq5AqAqAquvqq5ArArqAqAqqAqArqq4AurArrBru4qEquvqCq4AqGvu3rHu3Ar11qvF2r3q!"vAuA2q21r!!qqqtA2Aq12r"!q!qA1r13q!#1#B1q11r$3"B3q!!!2!!BD3q%2!"BACC$3!!!CAAACC2$AAAAAAACC!AAAƒAAAAACAAAAAƒAAAAAA2AAAAƒAAAA32AAAAƒA352AAAA135212A1352151552151552151555515555175551>55?65?65?=4v  <bcabAaaaAqqrqqqsqrqqqqqqqqqqqqqqqrqqqrqqqqqqqqqbcabAaaaAqqrqrrqrqqqqqqqqqqqqqqqrqqqrqqqqqqqqqbcabAaaaAqqrqqtqrqqqqqqqqqqqqqqqqqrqqqqqqqqbcabAaaaAqqrqrrqrqqqqqqqqqqqqqqqqqrqqqqqqqq4w;su                     ;           <  4FD   .  .     ! u 8222222u8222212t4I ]/z4z4z(4z<4zP4zd4zx4z 4# z/F  -7DRSgb !)-+%<6#:%!)-+%x86#: !)=XC%6L #!)=XC%2#6L #!)-+/%0OXC#:! !  !)7+%x#Qzx+%zx#Qx! !  !)%s el6 #ZP Q)P +LG;+PLQ< F +PLQa\G   :   Hႇ&/#I $ႇ&/#I $~&/#I $aq& / # I  $ aq& / # I  $ ]`& / # I  $ ee+e3~ee.~e,e-(e/]e0e1+Qe2e3k3hxQTV`Ft. San LorenzoCity of ChagresThe thickest jungle you have ever seen!!You are approaching the Isthmus of Panama!The Sea Farer has served its crew and passengers well. The sounding of a cannon on shore has announced its arrival.The "Old Town" or native town is on the south side of the river and is mostly palm-thatched houses. New Town or "the American Side" is composed of frame buildings and sprang up overnight.The river's mouth is filled with every kind of small boat imaginable.The boatmen are American, Irish and Dutch profiteers who by force keep natives from competing against their exorbitant prices.There is not much protection here and the seas are rough. Transferring supplies and people from the ship to rowboats is perilous.You're not here to go for a swim, you're going to California!!Seeing this new place is exciting, but you feel some uneasiness about what lies ahead.On a high rocky point stands the ancient "Fort San Lorenzo", now in ruins. The cannons are there, but are useless.Red, white, and blue is waving proudly at the stern of the ship.470ke8?lzeglzemyzemzemzerzefze\zePzeEze;ze2ze)wzemzedzeWze NzeNzeAze4ze'ze!)e+/%6=#F!)e+/%%6=#F!)e+/%26#F!)e+/%{;6#F!)e+/%uH6#F!)e+/%qU6#F!)e+/%f_6#F!)e+-% 6=C#PQ28Azerzefze\zePzeEze;ze2ze)wzemzedzeWze NzeNzeAze4ze'ze!)e+/%gl6#F!)e+/%my6#F!)e+/%m6#F!)e+/%m6#F!)e+-%fk6=C#PQm8N!)e+/%r6#F!)e+/%f6#F!)e+/%\6#F!)e+/%P6#F!)e+/%E6#F!)e+/%;6#F!)e+/%26#F!)e+/%)w6#F! ) e+ / % m6 # F ! ) e+ / % d6 # F ! ) e+ / % W6 # F ! ) e+ / % N6 # F ! ) e+ / % N6 # F !)e+/%A6#F!)e+/%46#F!)e+/%'6=#F!)e+/%6=#F!)e+-%r6=C#PQr8?; Q}9 QuQ QhU Qf_ Qfk 8 H'$%$2$;$H$U$_$ ((Beee x>x> Bee  22 w?w? nUnU8A  H'l$y$$ msms Be- mmBe2e3e4 mm Bee?e@ BeFeGeHeIeJeKeL 66 == GG R'R' _4_4 eCeC tWtW |m|m  jL X8|!:2*<m ( p Land has just disappeared from view. The excitement, expectation, and anticipation of your journey are gone. Now you are beginning to wonder just exactly what you have gotten yourself into.You have left your home and friends behind, and you wonder if you will ever see them again.It hasn't taken long, and many of the passengers are sea sick.It will take a few days before the land-lovers get their "sea legs".The passengers, for now at least, are quiet and keep to themselves.But, as time goes on, people meet people and have a wonderful time getting acquainted.From passing ships you hear rumors about gold being discovered in California.Most travelers left with great haste, but very few left without a notebook, a pen, and an ink bottle.Many passengers on board are keeping journals of the experiences they have on their journey.Playing cards, singing, reading, sunning, and wrestling are other popular activities.Any reading material on board was read to tatters before the journey had barely begun.The captain is relatively young as captains go, but he is a wise and frugal man.The captain makes use of the Northeast trade winds through the horse latitudes.He makes use of the wind and sails at every opportunity, to conserve the supply of coal and to prevent wear and tear on the steam engine.The food on board is not as bad as expected.In fact, at times it is quite tasty! (If you are really hungry!)Rations that are provided in the galley are quite safe. Very few get sick from eating them.The usual fare is hard-baked biscuit, salted beef, and boiled pudding once a week.In the course of the trip various activities begin to occur on board.There are debating societies, clergymen have sermons and prayer meetings on Sundays, a band has formed, a ship newspaper has been started and professionals on board give lectures on scientific subjects.There is also a group called "SSA"... Which stands for "Sea Sickness Anonymous".This group meets at the aft railing of the ship.When the Northeast trade winds die down around the equator, a seaman finds himself in an area called the doldrums, or calms,a place definitely disliked by crews without steam.Many a sailing ship would lie still in the water for days, even weeks, waiting to take advantage of even the slightest wind.This is one of the greatest advantages of steam!While other vessels lie motionless, with smoke belching from your smokestack, you press on!The captain is proud of his ship because it makes way even in the calm.But he is constantly aware of the danger of having that flammable material in the hold.4xj_8A|z_!z_!z_z_}z_oz_az_ Sz_Ez_7!)_+/% 6=#F!)_+/%.6#F!)_+/%<6#F!)_+/%J6#F!)_+/%X6#F!)_+/%f6#F!)_+/%t6#F!)_+/%6#F! ) _+ / % 6 # F ! ) _+ / % 6 # F ! ) _+ / % t6 C # F ! ) _+ / % x6 C # F !)_+-%6=C#PQ8Cz_!z_!z_z_}z_oz_az_ Sz_Ez_7! ) _+ / % x6 C # F !)_+-%l6=C#PQl8I!)_+/%!6=#F!)_+/%6#F!)_+/%}6#F!)_+/%o6#F!)_+/%a6#F!)_+/% S6#F!)_+/%E6#F!)_+/%76#F!)_+-%6=C#PQt8A Qu  H' $.$<$J$X$f$t$$$ $ Beee 22Be e e NN Bee gg Be {{ Be(e) Be2e3e5 Be 00 RR nn   vv8C? Qm  H' Bee8Ii Qa Q S QE Q=  H'$$}$o$a$S$E$7$ Bey BeeWBeeeeA Bee   gg  P P ??j/ X *TmO$ ^ ^  l You are aboard a mighty steamer, but it is not the most common type of vessel on the high seas.Clippers are the sovereign of the seas!It will not be uncommon to see many clippers during your voyage.While passing through the area of the equator, the heat gets unbearable.The deck is too hot to walk on.The tar in the seams of the deck bubbles.The island of Fernando Novonhu, located about 190 miles from Brazil, now comes into view.Rumors abound on the actual story pertaining to this island. Some say Alexander Selkirk, more commonly known as Robinson Crusoe, was exiled here. Others claim that the Brazilian government uses the island as a place of exile and a prison. Who really knows?In calm weather, especially aboard the sailing ships, one of the favorite pastimes is catching porpoises, cowfish, or any other fish that can be hooked! These catches provide a much needed diversion from your now monotonous diet.Eventually, the familiar constellations of the Northern Hemisphere begin to disappear, and the Southern Cross, composed of four brilliant stars marking the four corners of the cross, begins to rise in the night sky.Another new sight in the night sky is the Magellan Clouds. This is a golden mist in the sky similar to the Milky Way.When another ship is sighted, the race is on!!The competition is fierce, especially among sailing vessels.However, captains of sailing vessels love to beat steamers at every opportunity!!When approaching a port, the crew begins painting and polishing! They want the steamer to be "ship shape" when it pulls into port!Even at sea, the crew is rarely idle. They are continually busy, tending to the needs of the ship to make your voyage a speedy one.You pass many ships leaving Rio as well as many barques and brigantines steering south towards Rio.Just south of Rio, the captain advises you that you have crossed the Tropic of Capricorn, that invisible line on the globe at 23 degrees, 27 minutes south latitude that separates the torrid zone from the south temperate zone.Most passengers on board have little use for such trivia but it is reassuring to know you are making progress!!The only excitement today was crossing the Tropic of Capricorn for the second and last time on this voyage! The unbearable heat isn't far away again!When the captain sees another ship, he always knows what kind of ship it is and under what flag it sails."There goes a British full-rigged three-master!"Saw an interesting sight today...flying fish!!Fishing has become one of the favorite pastimes, especially since the weather has warmed up.Those who don't partake in the fishing enjoy watching for whales and porpoises.On the west side of South America, the crew anticipates arriving in California and begins putting things in order.The crew is busy scrubbing the deck, chipping off rust, painting and polishing.4j_8DNz_=z_/z_&z_&}z_&oz_&az_&Sz_&Ez_&7z_-)z_*z_* !)_+/%t6=#F!)_+/%n(6#F!)_+/%d66#F!)_+/%[D6#F!)_+/%PR6#F!)_+/%J`6#F!)_+/%En6#F!)_+/%@|6#F! ) _+ / % >6 # F !)_+-%w6=C#PQw8Fz_&z_&}z_&oz_&az_&Sz_&Ez_&7z_-)z_*z_* !)_+/%=6=#F!)_+/%/6#F!)_+-%A6=C#PQA8H!)_+/%&6=#F!)_+/%&}6#F!)_+/%&o6#F!)_+/%&a6#F!)_+/%&S6#F!)_+/%&E6#F!)_+/%&76#F!)_+/%-)6#F! ) _+ / = % *6 # F ! ) _+ / = % * 6 # F !)_+-%'6=C#PQ''8D Qn( Qd6 QZD QPR QJ` QA  H'$($6$D$R$`$n$|$$ l*l* Bee J[J[B e e e e e AABeeee ww n&n& `:`: OSOS AmAm AA8F Q= $Q5  H' Bex@Beeeeeeee:Beee6Beeee 778Hr  +-6( Q( $ Q& Q   H'$}$o$a$S$E$7$)$ Bee BeH Bee'Beeeeeeee '' '`'` 'E'E '*'* 55 ujh7o q@Gi$X5 7 " l i Rumors are starting to spread about the difficult times you are going to encounter in a few short weeks.You hear horror stories about getting around Cape Horn.Passing the 45th Parallel, the temperature begins to drop.Passengers begin spending more time below deck.When you left Brooklyn, it was the dead of summer.It seems to have slipped everyone's mind, at least until now, that June is the dead of winter here!The freezing temperatures are making this painfully clear.Captains vary in age, experience and wisdom.But all captains, no matter what their background or experience, approach The Cape with great respect.They all realize they are extremely vulnerable to the elements.As you approach the southern tip of South America, the captain advises all persons aboard that the sea you are about to encounter attains a degree of violence unknown in any other part of the globe.Just before rounding Cape Horn, the captain points out Deceit Rocks, which are colored white from the bird droppings.Rounding the Cape from east to west is not an easy task.If all goes well, it is usual for a sailing ship to allow three to five weeks to get to the west side of the Horn.Winds in the area of the Cape rarely blow less than 45 miles per hour and almost always from the west.Gales in this area can easily pick up a schooner and smash it into the rocky shore.The raging seas are the temperature of melting ice.You scarcely get six hours of daylight. When it is light, it is of little benefit.The overcast hugs the seas and visibility is very low.It is not uncommon for it to snow here in the summertime.The captain is continuously looking through his looking glass, keeping track of the ship's progress and position.He also makes entries in his log religiously.Nowhere is navigation more difficult than in these waters.Some sailing ships would take seventy days to round the Cape.Some ships would turn back because of the damage the sea had done to them.Some ships would not make it at all.Occasionally you see floating wreckage and debris from less fortunate vessels.With the rounding of Cape Horn (also called Cape Stiff by many sailors because of the difficulty of rounding it) behind you, the captain steers the steamer north by northwest. It is everyone's goal to reach the port of Valparaiso, which means "Paradise Valley".Off the coast of Chile, the ocean is swarming with sea cows.A little farther off the coast of Chile, about 400 miles to be exact, is Juan Fernandez, the island most often recognized as the island on which Robinson Crusoe was actually exiled in 1704.As the temperature rises so do your spirits.Every person on board has been looking forward to arriving at Valparaiso.They have been in close quarters for too long!!The port at Valparaiso is shallow, so the boat is anchored offshore.People go ashore and supplies are brought aboard by a continuous stream of small boats going back and forth from the shore to the ship.While ashore people would nearly kill for a current newspaper to read.But the word is confirmed ...GOLD HAS BEEN DISCOVERED IN CALIFORNIA!!!We waste no time in loading the ship with only that which is absolutely necessary and head for California.4j_8Jz_"|z_nz_`z_Rz_ Dz_6z_(z_!)_+/%56=#F!)_+/%+6#F!)_+-%@6=C#PQ58L!)_+/%"|6=#F!)_+/%n6#F!)_+/%`6#F!)_+/%R6#F!)_+/% D6#F!)_+/%66#F!)_+/%(6#F!)_+/=%6#F!)_+-%*6=C#PQs8J Q*  H'$$BeeeB e e e e eeBedeeef >> 44 **8LK QR Q  H'|$n$`$R$D$6$($$Beee<B eeeeee-Beeen Bee ww ee RR 99 j/ 3^=JpJwT  @ t Most of the passengers who were keeping journals at the beginning of the trip have stopped by now.But throughout the entire trip people have been reading whatever they can get their hands on.Many days aboard the ship are spent in utter monotonony. There is nothing to do, at least nothing you feel like doing, but watch an occasional ship come and go; watch the sun rise out of the water, move across the sky, and then set into the water again. Day after day after day ... The last leg of the journey is slow and seems to drag on forever.The walls seem to be moving in.You are positive the ship is only half the size it was when it left Brooklyn.Moments of solitude and privacy are nonexistant.Fellow passengers, who only a month ago were easy to get along with, now seem impossible to tolerate.Fights break out over trifles. There is constant bickering and gossip.Before, you complained of having the same food to eat meal after meal......but now you would gladly eat anything.Provisions are running dangerously low.You are fortunate that the ship has a sufficient supply of coal to make it to California. Other steamers ran out of coal. When that happened spars, doors, bunks, and portions of the deck were ripped up and fed into the fire box to keep that ship moving toward the gold fields!The Captain has given the word that you are only a few weeks from the coast of California.This seems to calm everyone's nerves.The arguments and fights subside.As the ship nears California, you begin to forget the hardships and tough times you have just endured.The promises made to The Almighty while rounding the Cape are all but forgotten.Somehow those times don't seem as tough now.Much more important now is the topic of nearly every conversation on the ship: where people plan to go to search for gold, how they are going to get it, and what they are going to do with the fortune they discover there.There is also much fretting and worrying about arriving too late and missing out on the best opportunities.Hopefully there will still be plenty of gold left when you get there.For the crew, no portion of the voyage is without danger.They must maintain their vigilance to the very end.The ship is now approaching the Golden Gate, and your journey is approaching its end.The dense fog makes it difficult, not to mention dangerous, to find the entrance to the Golden Gate.4]Fke8Bze.ze$4ze#Aze*Kze6Jze6Wze7\zeAgzeMdzeU`zeTjzeZuzedxzedzedzedzed!)e+/%6=#F!)e+/%"6=#F!)e+-% 6=C#PQ"8E0zeU`zeTjzeZuzedxzedzedzedzed!)e+/%.6#F!)e+/%$46#F!)e+/%$A6#F!)e+/%*N6#F!)e+/%6J6#F!)e+/%6W6#F!)e+/%?d6#F!)e+/%Ag6=#F! ) e+ / % Md6 = # F !)e+-%"6=C#PQ*8HzeZuzedxzedzedzedzed!)e+/%U`6#F!)e+/%Tj6#F!)e+-%UW6=C#PQUb8Lzedzed!)e+/%Zu6#F!)e+/%dx6#F!)e+/%d6#F!)e+/%d6#F!)e+-%Su6=C#PQZu8ch!)e+/%d6#F!)e+/%d6#F!)e+/%d6#F!)e+-%d6=C#PQd8Bi  H'$    Bee  Bee !! Be8E{ Q. Q$A  (Q$C Q%C Q(J Q*N  (Q6J   (Q6O  Q6W  Q7\    (QAg  QIh  +(QJd  H' ..$ $4$4$ $A$A$ *N*N$ 6J6J$ 6W6W$ 7\7\$ AgAg$  / / Be 'E'E Be 1Q1Q Be e 9g9gBeee DhDhBeee #2#2 6I6I =g=g JfJf8H (QQb QQg QTg QTj  H'`$ TjTj$ U[U[B eeeeee QfQf dmdm dd8Lv  (Qd  H' ZuZu$x$$ dmdm dd8c&  H'$$k < ziA xpx\  Near the mouth of the Rio Chagres are ancient Spanish, Scottish and English forts, now in ruins. The most famous of these is Fort San Lorenzo. Hidden by the dense jungle are many more that are now invisible.Other cities and fortresses which once flourished, are now overgrown and hidden. No one knows where they are.Ships arriving from all over the world are not allowed to dock on the Caribbean side of the isthmus. Ships must anchor off shore which results in the passengers having to pay exorbitant prices to native businesspeople for a ride to shore.You will ride to shore and 40 miles up the Rio Chagres in small, wooden boats.Offshore it is beautifully silent.The crooked river winds its way through a deep canyon with steep walls covered with thick vegetation.In the jungle it is never silent. There is an underlying hum and rustle, and the sound of water dripping. Birds are squawking, monkeys are chattering, things you can't see are crashing and crumbling.The wildlife is breath-taking. Monkeys are seen swinging in the trees; alligators are sunning on logs; jaguars stalk the shore; flamingos, pelicans, eagles, blue and white herons, and vultures dot the sky. Not to mention all the creatures you can't see that are watching you!Insects are unbearable. They are not just a nuisance; they carry dreaded, deadly diseases.At times it is necessary to get out of the boat and drag it through shallow portions of the river.You don't want to touch the jungle plants.Some of them have poisonous juice, some have 4-inch spikes, some have blades as long and sharp as swords.For a portion of the 20-mile walk to Panama City, you are traveling on a road built centuries ago by the Spaniards. In the early days of their conquest, this road was used to transport treasures across the isthmus. It was called "Camino Real", meaning Royal Road.A traveler in the jungle has hardly any view at all. You rarely see the sky and can see only a few feet in any direction.A person unaccustomed to the ways of the jungle could find themselves lost only a few feet from the road.When not on the primitive Spanish road, you are walking in untouched jungle; treading on mud or wet, squashy leaf mold; crawling over fallen trees; cutting your way through thick vegetation.It is difficult to get off the road, even using the most common and effective tool in the jungle, a machete.There is nothing in that jungle but snakes, alligators, tigers, pumas, jaguars, vampire bats, tarantulas, scorpions, and stinging centipedes!!You sweat continuously. The temperature may only be 85 degrees Fahrenheit, but the air is saturated and perfectly still.All around you is the smell of hot, wet, rotten vegetation.You are beginning to wonder why you ever left the comforts of Brooklyn!4k/>88 -88 .8/8 z5, j  HKNWbb%zHR^zNRzNSK! ) K8 8 + + - / 6  C X ! ) K+ - 6 C X ! ) K+ - 6 C X !)H+/6%7lCX#G!)H+/6%kX#G!)H+6 CX%T^#!)H+6 C%\4#LG!F)N+/6 C %E4#!F)N+/6CX%4#!F)N+/6 C%]^#!8O8U8K))8K D) D6 35%4 ]l%f# kk> kk kk kk  )+-O( >  8O8U8K))8K D).O( >     )+-O( z{> 8O8U8K))8K D).O ( dI]K8ODe=F& 844 P^j^3j3 F) /I 9 :e??8UDe=F& 844 P^j^3j3 F) /I 9 :eAA8Ke[ZdDx D e#) e#) F[ZdD FD HF& 944 P^j^3j3 F) /I 9 :eeEEDZb ee e!e"^ E() +-/ O! ) + - C X % *g# !) +-CX%t#QP !)WCX%]6#Q +-QP Q ) +-I)  +-GQ!( + - G G 9$ *  (+-( Q .iQ(t  $ (+Q/?P 8  $ ()O.+ 9eex H "/ % Kk# F Q kP  $ 8 8 z#c%n8Ree'e(e)  c%n c%n0 % d# F Q P  $ 8R  eF8 8 cODc%ndd8Qee+e,e- % g~# Q ~P  $ 8Q  eF 44  ( 8:  ( j5[ 6 j5[ 6 j5[@  (   ( z^k,  (   ( A4O4 I A4O4 K 49 I 49 K Y^g^ I Y^g^ K+ q342Bee_ee39e393^e 3^2ae 2`e 3j3^e3je3j3e3eZIae= ^`^18P%ae\a{c {eee7a ^`^eea ^`^8Pee<<<FE> (eEx x|^ E) DeFeG F eH]O]POZOO (A4ue~]De.\aeT_eG`e:Ee.^e!eeQ84zc ze$<O4 !,| |x^! a) D F[ZKe1TTUWVWEh P^g^ 84H4 I4ON P^g^e2 84H4)8er8ev8 8 e{8e3 I4Oe6e3  U T T W VW   E P^^^ 84H4 I4r4h P^^^e4f 84H4=8 setu8ewx8 8 |e}8e3 I4r4e7e3( 849 PXv^ ioe;e:z 849 PXv^ ioe<e: 849 PXv^ ioe=e:{0 849 PXv^ io8 8 e>e?e:S e@eD. leMeN.S 84o4 p4O PPt^ l3 84o4eR p4OeS PPt^eT leXeDSw..S..Sw..S.Sw. leMeDSw..S. leXeD 84keAeD 84OeOeD PSePeD {^eQeD" 84keUeD x^eeV]]]00]]]00eYe) <^`^8Pae e%e e&22 2 2929 9 29929) <^`^8Paee%e e* A44eZeD992 2 P^g^e[eD]](](]((=(=]e\*Z*e]. lVepeqeDL) <^`^8Pae eee.eLeLeLLe A44e^eDj**VNNk)]6Wz ]\D< - ! N R  + v @z JnKFbv"J8V(GY!,sLVo_You are on the bridge deck.You see a wheel, a compass and a staircase.There's nothing interesting on the floor right here.From here the captain and crew do their utmost to ensure a safe voyage for the passengers and cargo.The captain keeps his floor spotless. Only after a storm will there be anything on the floor.The main attraction on the captain's deck is the captain's cabin.This is the aft section of the sun, rain, snow, hail, and sleet deck.Today is a beautiful day! What a view!This is the staircase that connects the captain's deck to the bridge deck.This is the captain's cabin.The captain keeps his quarters very tidy. Only after a storm will you find anything out of place here.There is a paper clip lying on the floor. It must have been tossed there by the storm.You are immediately outside of the captain's cabin.This is the small set of stairs connecting the main deck to the captain's deck.This is the main deck of the ship.You are on the ladder that connects the main deck with the lower deck.This is the ship's lower deck.You already have the paper clip.There is no paper clip right here.You pick up the paper clip and put it in your pocket.There is no paper clip here now.There is a hefty-looking paper clip lying on the floor.This is the place to fish, but how can you fish without something to use as a hook?This is the place to fish, but you are going to need some fishing line!This is the place to fish, but you need some weight to attach to the fishing line!This is the place to fish, but the fish are going to want to see some bait at the end of that line!This is the place to fish, all you need now is something to use as a fishing pole!Well you've done it!You have found the perfect place to fish, and you have everything you need to do it!You can't see much of that deck from here.You pull the string you found in the bunk room out of your pocket and attach one end of it to the wooden stick. The other end you attach to the paper clip.You tie the metal scraps from the engine room to the string a few feet from the paper clip.And last, but certainly not least, you gladly take that piece of pork out of your pocket and carefully place it on the paper clip so that it won't fall off!With great anticipation, you lower this make-shift apparatus into the churning sea.All the supplies and food are running very low and you are feeling weak to the point of death.You're getting close to the ideal fishing spot, but you're not quite there!The captain keeps his quarters very tidy. There is nothing out of place.You can't see the captain's cabin from here.This rock has done serious damage to the hull of the ship.The captain orders the crew and passengers to abandon ship, but it is too late.The lower levels of the ship fill with water and you are on your way down in some of the most frigid water in the world.The iceberg once again pounds the side of the ship, but this time the force may be too much for the hull to withstand.The wretched iceberg punctures the shell of the ship, flooding the lower levels.The end is near.That is a wonderful idea, but you just can't muster the strength to do it!You have no fish to eat.The captain is busy at his desk doing whatever is necessary to keep this ship moving!You are not close enough.Talking helps pass the time on such a long, boring journey. And talk, the captain can do. He always seems to have a story to tell.The first mate is keeping this massive ship on course.The ship's first mate says, "I've been sailing with the captain many years and have never had a mishap. You can count on a safe trip!"It looks like this wooden stick once was a shovel handle.You can't see outside from here.The sea is deep blue and gently rolling.You see an island on the distant horizon.There are no rocks in sight.You see the tips of a few icebergs floating in the frigid sea.You can't see an iceberg from here.You can't see through the coal hold door.The mast looks very sturdy.That piece of pork sure does look tasty!You can't do that from here.You eat the piece of ham you have been carrying around. It really hits the spot!As soon as you sink your teeth into this piece of meat, you realize something terrible is about to happen.That pig had some type of disease that poisoned the meat. It looks like your trip is over!How can you do that? You don't have anything to eat!You just can't get it open!Just walk up to it.The rigging whistles in the wind!They are whale oil lamps.Just a typical ladder.This is the aft door.This is the forward door.This is the door to the captain's cabin.You see nothing but blue sky and water.These stairs provide quick access between the bridge deck and the captain's cabin.The door keeps coal from falling out of the coal hold.You have to do that yourself.The first mate controls the rudder of the ship by turning this wheel.You find nothing of interest.You'll never get to California if you do that!It might be best to leave that up to the crew. They know what they are doing!This compass is crucial for accurate navigation.This would be a good place to fish!The door is warm to the touch.The door is cool.You met this young man, Eric, the first day you were on the ship. You are both from Brooklyn, the same age, and have the same interests, one of them gold. The two of you have been friends ever since.Eric says, "Hi, Jerrod. We're one day closer to that California gold! This is easier than I thought it was going to be!"You reply, "That's right, one day closer! I'll drop by and talk to you later.""Okay, that sounds great. Make sure you come by again," says Eric.Most others wouldn't notice, but you detect that Eric is getting pale.You say to your best friend on the ship, "I've noticed that you're not looking healthy lately. It's probably just a slight case seasickness. You'll be over it in no time!""It's true, Jerrod. I've not been feeling well lately. I hope you're right about the seasickness," says Eric.He replies, "You better believe it! I've got plans!"When you met Eric, he was strong and healthy. Now he is thin and very weak. He stays outside, despite the cold, to breathe the fresh air.With all the enthusiasm Eric can muster he says, "I feel very weak, Jerrod. But I'm going to make it to California. I am determined to make it to California!"Trying to be as convincing as possible you say, "That's right! We're both going to make it to California."You are already fishing.None of these doors are locked; just walk up to them.Once again, Jerrod, you have saved the day and the lives of those around you.You reel in the catch of the day and share it with your companions. Now you will all make it to California!The captain strokes his beard and says, "Did I ever tell you about the time I maneuvered that overloaded steamer through the Straits of Magellan. Well..."The captain thinks for a moment then says, "Did I ever tell you about the time I broke the existing world record for the quickest trip from London to Hong Kong? Well..."A paper clip that was on the desk is now lying on the floor. It must have been tossed there by the storm.There's no desk right here.4+;Gzj z*j 8P8Pz* 88 zz588 zz58zz5zmj z-9z 9z$j j8W INQT]bb%b'zNRzN-RzNWR88 zI 88 8zI 88 zI 88 zI 8P!! ) Q+ / 6 % *C X ^# : ! ) T+ 6 C X ! ) Q+ / 6 % C # F ! ) Q+ / 6 % C # F ! ) Q+ / 6 % ?# C : !)I+/6%t\#G!)I+/6%V`#G!)I+/% XC#F!)I+/%6#:!)I+/%26#:!F)N+/6CX %4#!)I+6 =%d!)I+/6 =%c)#:!8)]6 C9%c9 )Q+6 %1[G#!8O8U8K))8K D)6 *,5%9 2: %9 / fn%j % 8:%9 fn%j8=Z[&23#8 etF dR+F  k k k k kk  )+-O( >  8O8U8K))8K D).O( >     )+-O( z z> 8O8U8K))8K D).O ( 49 I 49 K #Gc'"c'/<$ d8 8 g_nT c%nc%nc%n8R  eF8 8 1)nc%ndd8Q  eF8O;e4F393j3 F) /I 9 :e??8U;e4F393j3 F) /I 9 :eAAVy ::i+  (  / G $  eF  ::8Ke[ZdDxe D)[ZdD FD HF393j3 F) /I 9 :eeEE*,D lf U9nj /<e. <Veee.  % 1< 429g e %;IVeW8c% # G  1<;IVeW8c% 5# G  429eie'.R  % 1<- e %;K 1<;K eje>eq>) Sjj`eeree /<e  SjjCeee__, Sjj 8W8eCeee' SjjtCheei CZ[\8= =W8W8@ @W8W8E EW 8W8G GW 8W8K KW8W Geell<8P$^ 9ee^e 9e eZZlZlZZR8P:^e^ 9e!c\^$ e^e 9e"e]34e#398e&e$3j3Ze(3jeo3j3e23e38P ^e<e;LLemLen4e+L Sjj`e4ese5ZZL4`e6( Sjj`e7c`\ese5ZZZ;82Ee?$ +j:je@yc y E\e eA(8EeB +j:jeCe eD<<<U8LEA +eEx x|c^ E) DeFeG F eHeA]O]POZOOeM43j8eee RRR3je e 3jepe ]]]0eZ{e[e\ Sjje]3:eYe> 4je^e**e_ 49ee`TUT->e  49 Z1 2jRj Sjj? ea 49eL Z1jeO 2jRjeS SjjeXe.(  49 49 ebeSw.S. ebeS efe ege  T U T   - >    9D9 j1j 2jRj SjjY eh 9D9eee j1j8ee8e 2jRje9 Sjj eI/<eL Sjj`e0ekekLeoLe3jtnw5wR.y:&J l e  M s n 1c n1HhA%AmDLnFm'~<UYou can't do that from here.The engines are running like clock work. You notice some metal scraps on the floor around the engines."Excuse me, young man," the engine man interrupts, "I see you noticed my engines."You ask these young men, "What are you going to do when you get to California?"One of them says, "I'm going straight to the town of Coloma. I've heard there's gold a-plenty there!"At this moment, the table is bare.The pig that used to run freely, is now steaming on the table!The cook works miracles on that stove. He can make anything a meal!You need to get closer.The other young man says, "I'm with my partner. I'm heading straight for Coloma."The cook says, "We have plenty of provisions right now. If we start to run low, then we'll invite the ship's mascot to dinner!""These are a couple of beauties. They're nothing but pure power. I'm mighty proud of these engines, I sure am!"The door is very warm to the touch.The door is cool to the touch.The worker is in the way.There is no door close enough.All the supplies and food are running very low and you are feeling weak to the point of death.The valve is rarely used. It is rusty from the moist sea air. The valve is in the open position.You see that the valve is now broken and in the closed position.You see no valve right here.You see no guage right here.The reading on the gauge does not look good. It is buried in the red zone!The needle is right in the middle of the green.The needle is approaching the red area and continually rising!As you attempt to move the valve, it moves to the closed position and breaks off!You try to catch the valve handle but it falls onto the floor and rolls out of sight!During the storm, the shovel that used to rest here was broken. All that is left is a wooden stick.You already have the wooden stick.It isn't here!The cook says, "The provisions are gone. All that is left is the ship's mascot. It is now steaming on the table. There's only one problem."This is the spare shovel used by these men to stoke the boiler.The workers don't mind if you take the stick. After all, it's just a useless old stick!I wouldn't try taking that shovel. The workers might need to use it.You are on the bridge deck.You are on the top deck of the ship. There are people and a pig here with you.You are on the top deck of the ship. The young men are still leaning against the railing, but the pig is missing.You are on the short staircase that connects the main deck with the captain's deck.There is a stove, table and benches.Considering all the work that goes on here, the area stays surprisingly clean. There are a few metal scraps lying on the floor.You are on the ladder that connects the main deck with the lower deck.You are in the depths of the ship. This is the lower deck. You see coal hold doors and the boiler.A few metal scraps are lying on the floor around the engines.There are no metal scraps right here.You already have some metal scraps.You scoop up the metal scraps, being careful not to cut your hands, and put them in your pocket."I may have waited too long before preparing the pig. It may be diseased. So far no one has had the nerve to try it."The man sitting at the table says, "I'm heading for California to make enough to buy a farm in Pennsylvania. Then I'm going home to my wife and kids."There is a shovel resting against the wall.There is a wooden stick resting against the wall.You notice nothing unusual about the smoke stack right here.You already have a nice piece of that pig!You grab yourself a nice slab of pig meat from the steaming pig.The young men tell you, "Don't do that! We're going to have to eat that pig later in the voyage."That piece of pork sure does look tasty!You see a poor little pig, which used to be the ship mascot, steaming on the galley table.For now the pig is the ship's mascot. Later it will be dinner.You eat the piece of ham you have been carrying around. It really hits the spot!As soon as you sink your teeth into this piece of meat, you realize something terrible is about to happen.That pig had some type of disease that poisoned the meat. It looks like your trip is over!You don't have anything to eat!The engine man dissertates, "This baby has been outfitted with the latest in high pressure steam engines. When the captain gives the command `full steam ahead!', I give her everything she's got and blow the whistle!"On the top deck are two young men with big ideas of what they are going to do when they get to California.That is a great idea, but this isn't the best place to do it!This is the ship cook. You can tell he loves good cooking!The man at the table is a hard working man hoping to make things better for the family he left behind.As you open the coal hold door you notice the door is very warm, nearly hot, to touch.The engine man is very proud of these engines. He keeps them as shiny as the top of his head.The whistle is attached to the smoke stack.Go ahead and climb on!The rigging on the Sea Farer isn't nearly as complicated as on some clippers you've seen.The mast is very strong.Attached to the smoke stack is a pressure relief valve and a pressure gauge.The whistle is attached to the side of the smoke stack. The pull chain reaches clear to the engine room.The paddles propel the ship without the wind's aid.No one gets to the boiler but by this ladder.These men move when the captain bellows, "Pour the coal on!"The coal lies behind these doors.Coal is the fuel used in the boiler.The boiler produces steam pressure which powers the engines above you.Conversing with these men, you learn that they wish to put their shovels to better use, IN THE GOLD FIELDS!The door is not locked; walk right in.Just walk away from it.There's nothing important right here.You can't see much of that deck from here.The top deck is affectionately called the sun, rain, hail, snow, and sleet deck!You are on the main deck of the ship. The galley and the engine room are located here.There is a man sitting on the bench at the table.Located here are two engines and a man to operate them. The smoke stack goes between the engines.These engines are running like clockwork.You see no metal scraps.Food is running out on board the ship. Everyone is suffering, one man has already died.44 n88 088 182j JKNbb%zj8Pzjz[5!)J+6%\#G!)K6CX!)K+-6CX!)K+-6CX!)J+/6%ek#G!)J+/6%Ql#G!F)N+/6C %j#!)J ++/6 %53#F!8O8U8K))8K D)6 8:%9 ik%j+%-9# ::1 :: ::  )+-O( jj>  8O8U8K))8K D).O( ii1 ii ii  )+-O( HH>  8O8U8K))8K D).O( 8O7e0F393j F) /I 9 :e??8U7e0F393j F) /I 9 :eAA8Ke{[ZdDxe* D)[ZdD FD HF393j F) /I 9 :eeEE9.8 8 ++-/%{k#FQ0kP $.8 8 &0%#FQ-Pg #c%n8Reeee c%nc%n$8R  eF8 8 c%~#QE~P8 c%n$dd8Qeeee 8Q  eF8 8 (I / j#j I j#j K+  O '9K9 L9i9; '9K9( eeeee ce\+eeee 3 9K9 L9i9 9K9 e e e e s  /9C9eee ZZsssss2 e' /9C9eeece\+e ,39e$e%393je&3j2!eeLeLLe) "jj8P_eNeOeeMZ@_e"4 "jj(_8Pe!c_\e-e-e#) "jj8P_e'e-e-e#L) "jj8P_e e.e.ek<<<IEA +eEx x|c^ E) DeFeG F eH]O]POZOOe) "jje+eM]]]0eZ{e[e\**e_e`.e^. ebeg'. eced( 99eee]> X#jefe]z 99ene]{" 998 8 elehe] 99eme]se,jn@zgX,{>Z ^y2 C g  t E @ 2Qn-EYEpYou feel the ship shaking from hitting the iceberg, but the hull continues to hold out the water.The iceberg once again pounds the side of the ship, but this time the force is too much for the hull to withstand.The wretched iceberg punctures the shell of the ship, flooding the lower levels.The end is near.You ask these men, "How much gold do you figure you're going to take out of those California hills?"One of the men replies, "I'm not greedy. If I can fill my hat with gold everyday, I'll be happy!"This rock has done serious damage to the hull of the ship.The captain orders the crew and passengers to abandon ship, but it is too late.The lowest level of the ship fills with water and the ship is on its way down in some of the most frigid water in the world.The long days, filled with nothing to do, don't seem to bother this man. He's perfectly content to bask in the sun.Reading a good book helps this man pass the time.These men are standing in the bow because they want to be the first ones to California!Get a little closer.It is a black bound book with pages edged with gold.It definitely resembles what some folks would call "The Good Book", the Bible.He replies, "It's a long voyage to those gold fields. I figure I'm just going to relax and enjoy the ride.""What are you going to do with all this time you have on your hands?" you ask the man.You already have the Bible.The other man replies, "I fear we will arrive in California too late. By the time we get there, most of the gold may be gone!"You are in the bunk room.The Bible is not yours.However, the man has just finished reading the Bible and offers to give it to you.You graciously receive it.You say, "Thank you!""You're welcome!"You are just outside of the bunk room.The bunk room is neat considering the number of people sharing it. But, so far, it's been smooth sailing.You say to the man reading the book, "We are on our way to California, but we have a long trip ahead of us."The man continues, "You are right, it's going to be a long trip and you will want something to read.""Take this book. I'd like to give it to you; please take it."Thinking that the string might come in handy someday, you pick it up and put it in your pocket.You already have some string.You see no string right here.This is the forward section of the top deck.You see people enjoying the fresh air and also notice a ladder leading to the lower decks.You are on the ladder between the top deck and main deck.There is a long piece of string on the floor.Fishing would be fun, and maybe helpful, but there is a better place!All the supplies and food are running very low and you are feeling weak to the point of death.Some bunks are neat, others are a mess!You don't have a %w2!There's no string here now.You notice nothing unusual right now.You eat the piece of ham you have been carrying around. It really hits the spot!As soon as you sink your teeth into this piece of meat, you realize something terrible is about to happen.That pig had some type of disease that poisoned the meat. It looks like your trip is over!How can you do that? You don't have anything to eat!The top deck is affectionately called the sun, rain, hail, snow and sleet deck!You are not in the bunk room.The bunk room looks bare since the storm. Everything had to be thrown overboard. In the process, some string was left on the floor.The bunk room looks bare since the storm. Everything had to be thrown overboard.Go ahead and climb on!The rigging on the Sea Farer isn't nearly as complicated as on some clippers you've seen.Made of strong wood the mast goes through both decks to the keel, making a sturdy structure.You can't do that from here.This is the door to the bunk room.The paddles are turning, propelling the ship without the wind's aid.The ladder provides access between the top deck and the main deck.Just walk up to it.Just walk away from it.The door is closed.The ocean stretches as far as the eye can see.That engine sure looks powerful!The door is open.There are no icebergs in sight.Just walk away from it.You see nothing important right here.You see icebergs bobbing in the frigid sea.You can't see the rocks through the water.The ship passes an occasional island.4$Jkk!)k+-6 %w#QSwP!)k+-6 %x#QixPL QrpQq  H~ee(e e eee0ee e e 0 'e e''](](((]]=(=e ee  eBeZ(''e2k2 f<q4kALThe Panamanian jungle is all around you.You have never seen plants like this before, and you hope you never will again!This is the Chagres River. Who knows what lurks below the surface of the murky, muddy water!You can't climb anything while you are in this boat!There are jungle trees of every species.The only ground you can see are the banks of the river, and they are typical riverbanks.You see the blue Panamanian sky.All you see is the murky river.There are a few jungle rocks on the edge of the river.It wouldn't be a jungle if there weren't vines!It looks swampy at the river's edge.Since you have entered the humid tropics, whenever necessary you have worn the mosquito net to keep those pests from biting you!Why do that? Who knows what dangers lie beneath the surface of the river!This small boat is nothing but a hollowed-out log. You seriously doubt that it will make the trip!You don't have any mosquito net.You are riding with other people on their way to California!The people riding have very little to say; they are worried about capsizing, and about what might be in the water.Your guide is completely at home in the jungle.You don't need any water.4}kknbb!)k+-6 %~#Q~P!)k+-6 %#Q)PL!)n+%2k6!)n+%m6!)n+%p6!)n+-%O\!)n+-%:`!)n+-%1b  QYyPQozGPL   QrQ   H QIyQ_z FF)n+PQyG  cwMg  ###Q kk kk kk  )+-O(   ).O( >     )+-O( z{ ).O ( 8Oe:S e@eD. leMeN.S 84o4 p4O PPt^ l3 84o4eR p4OeS PPt^eT leXeDSw..S..Sw..S.Sw. leMeDSw..S. leXeD 84keAeD 84OeOeD PSePeD {^eQeD" 84keUeD Y4eVeD]]]00]]]00eYe <^`^ae e e&22 2 2929 9 29929 <^`^aee e* I4w4eZeD992 2 P^g^e[eD]](](]((=(=]e\*Z*e]]O]POZOOen. lVepeqeDL ^`^ae eeZe0LeLe%LLej*=x'D60SJwIZ2 @ A ! > }  $ @ V mb1Ml~You are on the bridge deck.The captain and first mate have their hands full with this ferocious storm. The stairs lead to a lower deck.There's nothing interesting on the floor right here.From the bridge deck, the captain and crew do their utmost to ensure a safe voyage for the passengers and cargo.During a storm, this is the only safe place to be outside.This is the aft section of the sun, rain, snow, hail, and sleet deck.Today is a windy, dreary day.This is the staircase that connects the captain's deck to the bridge deck.This is the captain's cabin.The captain keeps his quarters very tidy. Only after a storm will you find anything out of place here.There is a paper clip lying on the floor. It must have been tossed there by the storm.You are immediately outside of the captain's cabin.This is the small set of stairs connecting the main deck to the captain's deck.This is the main deck of the ship.You are on the ladder that connects the main deck with the lower deck.This is the ship's lower deck.You already have the paper clip.There is no paper clip right here.You pick up the paper clip and put it in your pocket.There is a hefty-looking paper clip lying on the floor.The sky is dark and dreary.You can't see much of that deck from here.The main attraction on the captain's deck is the captain's cabin.You can't see the captain's cabin from here.This rock has done serious damage to the hull of the ship.The captain orders the crew and passengers to abandon ship, but it is too late.Sea water rushes through the gaping hole. The ship is on its way to the ocean floor in some of the most frigid water in the world.The iceberg once again pounds the side of the ship, but this time the force is too much for the hull to withstand.The wretched iceberg punctures the shell of the ship, flooding the lower levels.The end is near.The first mate skillfully follows every command of the captain.You see the once powerful form of Eric, sitting slouched on the steps writing in his journal.What Eric writes in his journal is none of your business.You watch the captain, with complete confidence, as he commands the "Sea Farer" around the treacherous Cape amid gusting gales and heaving seas!You are not close enough!The captain yells, "Don't bother me with small talk right now, young man. I've got my hands full!"The first mate doesn't even realize you are talking to him. He is intently listening to each command of the captain.With great concern you ask Eric, "How have you been lately?"The howling wind is too much for you. You are blown overboard to an icy grave.Eric replies, "I'm doing tolerably well. However, if conditions get any worse, I don't know if I will make it."You can't see outside from here.The sea is deep, dark, and churning.You see an island on the distant horizon.There are no rocks in sight.You see the tips of a few icebergs floating in the frigid sea.You can't see through the coal hold door.The mast is sturdy, but many a ship's mast has been snapped like a tooth pick by mother nature!You can't do that from here.You just can't get it open!Just walk up to them!The rigging is being tested to its limits by the storm!They are whale oil lamps.It is a typical ladder.This is the aft door.This is the forward door.This is the door to the captain's cabin.You see the terrible weather outside and hope that the ship, and yourself, survive!These stairs provide quick access between the bridge deck and the captain's cabin.The door keeps coal from falling out of the coal hold.You'll have to do that for yourself.The first mate controls the rudder of the ship by turning this wheel.You find nothing of interest.You'll never get to California if you do that!It might be best to leave that up to the crew. They know what they are doing!This is the only safe place outside during a storm.They won't be biting today!The door is warm to the touch.The door is cool.A paper clip that was on the desk is now lying on the floor. It must have been tossed there by the storm.There's no desk right here.4 " _z+ zj z*j 8 zz58 zz5zmj z$j j<8O8U INOQTbb%zNRzN-RzNWR8 zI 8 zI 8 zI 8 zI !)T+%6CX!)I+/6%t\#G!)I+/6%V`#G! ) Q+ / 6 % C # F ! ) Q+ / 6 % C # F : ! ) Q+ / 6 % ?# C : !)I+/% XC#F!)I+/%6#:!)I+/%26#:!)I+6 =%d!)I+/6 =%c)#:!<8O8U))6 68%9 fn%j % 8:%9 fn%j<)X=%96G 9# IG; ; / I /  / / Q @: K ; I 6 / I /  / / Q :   ]l,  (   ( kk> k k k k kk  )+-O( >  8O8U8K))8K D).O( >     )+-O( z z> 8O8U8K))8K D).O ( #G /<$w8R#c%n8ReePeQeR c%nc%n8R  eJ8 8 G?4c%ndd8QeeTeUeV 8Q  eJVu ::+ ( /G$  eJ}c } ::39< <)G 9<* O O2 6X68lf U9nj /<e. <Veee.  % 1< 429g e %;IVeW8c%#G 1<;IVeW8c%5#G 429eie'.G  % 1<- e %;K 1<;Ke>eq>) Sjj`eeree /<e  SjjCeee__, Sjj 8W8eCeee'L Sjj@C4ee CZ[\8E EW 8W8G GW 8W Geell 9e eZZlZlZZ 9e"e539e$3j3Ze(3jeo3j3e23e3e;LLemLen4e+L Sjj`e4ese5ZZL4`e6( Sjj`e7c`\ese5]O]POZOOeM43jee RRR3je e 3jepe ]]]0eZ{e[e\ Sjje]3:eYe> 4je^e**e_ 49ee`TUT->S  Z1 2jRj Sjj3 ea Z1jeO 2jRjeS SjjeXe.(  49 49 ebeSw.S. ebeS efe ege  T U T   - >[  j1j 2jRj Sjj; eh j1je8 2jRje9 Sjj eI/<eL Sjj`e0ekekLeoLe3ejs l%=-Qp Kh?C@kT h H d G  fWp&Z /v*B`3eYou can't do that from here.The engines are running like clock work. You notice some metal scraps on the floor around the engines."Excuse me young man," the engine man interrupts, "I see you noticed my engines."At this moment, the table is bare.The cook works miracles on that stove. He can make anything a meal!You need to get closer.The cook says, "We have plenty of provisions right now. If we start to run low, then we'll invite the ship's mascot to dinner!""These are a couple of beauties. They're nothing but pure power. I'm mighty proud of these engines. I sure am!"The door is very warm to the touch.The door is cool to the touch.The worker is in the way.There is no door close enough.The valve is rarely used. It is rusty from the moist sea air. The valve is in the open position.You see that the valve is now broken and in the closed position.You see no valve right here.You see no guage right here.The reading on the gauge does not look good. It is buried in the red zone!The needle is right in the middle of the green.The needle is approaching the red area and continually rising!As you attempt to move the valve, it moves to the closed position and breaks off!You try to catch the valve handle but it falls onto the floor and rolls out of sight!The sky is dark and dreary.This is the spare shovel used by these men to stoke the boiler.I wouldn't try taking that shovel. The workers might need to use it.All you can see is your life flashing in front of your eyes!You are on the short staircase that connects the main deck with the captain's deck.There is a stove, table, and benches.Considering all the work that goes on here, the area stays surprisingly clean. There are a few metal scraps lying on the floor.You are on the ladder that connects the main deck with the lower deck.You are in the depths of the ship. This is the lower deck. You see coal hold doors and the boiler.A few metal scraps are lying on the floor around the engines.There are no metal scraps right here.You already have some metal scraps.You scoop up the metal scraps, being careful not to cut your hands, and put them in your pocket.The cook says, "The only time I don't think about food is when I'm in a storm rounding Cape Horn. I just hope the ship doesn't break up."The man at the table says, "Right now I wish I was back in Pennsylvania with my family. This ship sounds like it is going to come apart!"There is a shovel resting against the wall.You notice nothing unusual about the smoke stack right here.The engine man says, "I have complete faith in these engines, but I have my doubts about the ship. I hope we make it."They won't be biting today!Just by looking at the ship's cook, you can tell he doesn't have food on his mind.This rock may have done serious damage to the hull of the ship.The captain orders the crew and passengers to abandon ship, but it is too late.The lowest level of the ship fills with water and the ship is on the way down in some of the most frigid water in the world.The man sitting at the table cringes with each creak and moan of the storm-tossed ship.The iceberg once again pounds the side of the ship. This time the force may be too much for the hull to withstand.The wretched iceberg punctures the shell of this ship, flooding the lower levels of the ship.I am afraid the end is near.As you open the coal hold door you notice the door is very warm, nearly hot, to the touch.The engine man, just like everyone else on board, has a concerned look on his face.The whistle is attached to the smoke stack.Go ahead and climb on!The rigging on the Sea Farer isn't nearly as complicated as on some clippers you've seen.The mast is very strong.Attached to the smoke stack is a pressure relief valve and a pressure gauge.The whistle is attached to the side of the smoke stack. The pull chain reaches clear to the engine room.The paddles propel the ship without the wind's aid.No one gets to the boiler but by this ladder.These men couarageously continue to work, pausing briefly when the ship shakes from the storm.The coal lies through these doors.Coal is the fuel used in the boiler.The boiler produces steam pressure which powers the engines above you.The workers agree, "The last thing on our minds right now is the gold in California. All we want to do is make it through this storm alive!"The door is not locked; walk right in!Just walk away from it!Nothing important right here!You can't see much of that deck from here.The top deck is affectionately called the sun, rain, hail, snow, and sleet deck!You are on the main deck of the ship. The galley and the engine room are located here.There is a man sitting on the bench at the table.Located here are two engines and a man to operate them. The smoke stack goes between the engines.These engines are running like clockwork.You see no metal scraps.4oI88 088 182]zjz]W9 ]j8O8U JKNObb%!)K+-6 CX!)K+-6CX!)K+-6CX!)J+6%\#G!)O+/6%dk#G!)O+/6%Ql#G!F)N+/6C %j#!8O8U))6 8:%9 ik%j73j%-j# jj>  8O8U8K))8K D).O( ii1 ii ii  )+-O( HH  ).O( 8O2e+F3j F) /I 9 :e??8U2e+F3j F) /I 9 :eAA j#j I j#j K6+8R 00%#FQ-Pg #c%n8Ree e e c%nc%n$8R  eJ%~#QE~P8 c%n$dd8Qeeee 8Q  eJ"/%{k#FQ0kP $39< < ( )G 9< O O7.39e$e%e&393je)3j2!ee "jj_e/e0eM3Uee<e "jje+eMe]O]POZOOe,Z4_e"( "jj_ce!_\e.e- "jj_e'e.e-]]]0eZ{e[e\**e_e`.e^L "jj_e'ejek. ebeg'. eced( 99eee]> X#jefe]z 99ene]{" 998 8 ele]e] 99eme]   "jjee] "jje e]jn !Bt4*{_A^Q/ ' l  7 I m That poor pig looks like it is freezing its curly little tail off!From here you can't see the pig.Go ahead and give it a try, if you can get to it!These men are weathering the storm in the bunk room.This rock has done serious damage to the hull of the ship.The captain orders the crew and passengers to abandon ship, but it is too late.Sea water rushes through the gaping hole. The ship is on its way to the ocean floor in some of the most frigid water in the world.The iceberg once again pounds the side of the ship, but this time the force is too much for the hull to withstand.The wretched iceberg punctures the shell of the ship, flooding the lower levels.The end is near.None of these men are interested in talking right now. They are busy worrying whether the ship will survive the storm.Get a little closer.You are in the bunk room, the most popular spot to wait out the storm.You are just outside of the bunk room.The sky is dark and dreary.Thinking that the string might come in handy someday, you pick it up and put it in your pocket.You have the string from the bunk room and don't see any more.There is no string in sight.You are on the sun, rain, snow, hail, and sleet deck.This is not the place to be at a time like this!Things don't look too good for you!There is a long piece of string on the floor.You are on the ladder between the top deck and main deck.The bunks are filled, but no one is sleeping. Everyone knows that mother nature could crack this ship like an egg.They won't be biting today!There is no string right here.There's no string here now.The bunk room has just been emptied to lighten the ship. Everything that wasn't nailed down is gone. The floor is a mess.The bunk room has just been emptied to lighten the ship. Everything that wasn't nailed down is gone.You are not in the bunk room.Go ahead and climb on!The rigging on the Sea Farer isn't nearly as complicated as on some clippers you've seen.Made of strong wood, the mast goes through both decks to the keel, making a sturdy structure.You can't do that from here.This is the door to the bunk room.The paddles are turning, propelling the ship without the wind's aid.This ladder provides access between two decks of the ship.Just walk up to it.Just walk away from it.The door is closed.The ocean stretches as far as the eye can see.That engine sure looks powerful.The door is open.You see nothing important here now.You see nothing important right here.You see icebergs bobbing in the frigid sea.You can't see the rocks through the water.An occasional island passes by the ship.4b c cwMeig vAs you fall down you realize what has happened. You should have brought something along to balance your diet!You should have recognized your symptoms; scurvy has overtaken you!4*AwM iegeg eg egeg LYou should have noticed the door was suspiciously warm! The rush of oxygen blew this ship to pieces!Remember that valve you tried moving in the engine room? That little stunt just blew the ship to kingdom come!!It happens very rarely, but the boilers on these vessels will occasionally blow sky high!!You have joined many other sea faring adventurers in Davy's Locker!That iceberg raised the price you have to pay for riches in California considerably!!4%b c cwM iegeg EThis is one of the problems of no refrigeration!There was something around to eat, you just needed to find it!!4wCP[\b!8R8Q)P)[+/%5H6CX#IL!)\+-/%#LG!)\+-/%5C#LG!)\+-/%j#LG!)\+-/CX6 !)\+-/CX6 !)\+-/CX6 ! ) \+ - / C X 6 ! ) \+ - / C X 6 ! ) \+ - / C X 6  2H2//( ( + / I cc + G C"2! ) \+ - % PN6 # G \&/#I $\&/#I $\&/#I $CV& / # I  $ CV& / # I  $ CV& / # I  $ 4 mjUb!)U+/6%8#FC!)U+-%H6#Q[HP!)U+%j#FP 9!)U+%oM ݖ/$c Q1T QX $  +-%X6#Q-XG QOT QH 9 H#G"  ( CC#+F%C6 #$+-6 %j#$ "  ( np  $  "  ( N|N|F,# GBeeeee )ee "  ( jj  #$+-%C#$u _H_H Be ze$e ~je(eee/ee  e!e"e"&e#e%j%LEf-_The prominent landmark in this famous port is called "Sugar Loaf".Every person on board is looking forward to going ashore! You have been like a caged animal on this ship for nearly six weeks!!Ships of every kind - brigs, barques, brigantines, schooners, clippers, steamers - from nearly every country come and go.The stay in Rio normally lasts about 10 days; could be more, could be less, depending on the extent of the repairs.During this time supplies, including coal, wood, fresh water and food, are replenished. Small repairs are made and the ship is prepared for the next leg of the journey.The fruit here is plentiful! You manage to secure more of the fruit to which you attribute your good health.This is a fine well protected southern harbor, which makes it a favorite stopping point for ships preparing to round the perilous Cape Horn.Whaling, cargo, passenger and even slave ships come and go.The town is built along the beach at the foot of the mountains.The water is beautifully clear and calm.It is a delightful, sandy beach.The people and supplies are transported to and from the ships in these smaller boats.It is just a typical Rio dock!These are the streets of Rio de Janeiro!There are all kinds of indigenous trees!What a sight! The "Sea Farer" in the port of Rio!People are scurrying here and there. Everyone seems to be in such a hurry!These islands are picturesque.You are in the port of Rio!4wCP[\b!8R8Q)P)[+/%5H6CX#IL!)\+-/%#LG!)\+-/%5C#LG!)\+-/%j#LG!)\+-/CX6 !)\+-/CX6 !)\+-/CX6 ! ) \+ - / C X 6 ! ) \+ - / C X 6 ! ) \+ - / C X 6  2H2//( ( + / I cc + G C"2! ) \+ - % PN6 # G \&/#I $\&/#I $\&/#I $CV& / # I  $ CV& / # I  $ CV& / # I  $ 4 3ksknpqrtub !)k+-6 %#QP!)k+-6 %#QPL!)k+-%rO#F!)k+-%]N#F!)k+-%mP#F!)k+-%IK#QK!)k+-%HO!)k+-%XM! ) k+ - % RO! ) k+ - % MM!)%6Y! ) u+ - = C 6 % q# L  Q tQ6u Q3hQIi QX[Qn\k )n+<:$%QQKQOGQPGQNG#QM# Q O# Q M#QN QZ $%Q#QZ $)q%+6#QU  Q   $ QZ $)p%+6#QU Q $ QZ $)q%+6#QU Q $ QZ $)p%+6#QU Q $ QZ $)r%+6#QU Q $ Q Z $ ) s% + 6 # Q U Q  $  Q Z $ ) t% + 6 # Q U Q  $  QZ $+#QU Q  H H.9DOZ2u 2v + / L I  + X L Q qG ' )u+-/($ 9LI ep~ee(e e eee0ee e e ''](](((]]=(=e eee  eej~eeeeerreBe&Z(''e2k2Kfr 0[U+I1Here your boat ride ends and you begin walking through the jungle on the ancient Spanish road!You have never seen plants like this before, and you hope you never will again!This is the Chagres River. Who knows what lurks below the surface of the murky, muddy water!Give it a try, but it won't do any good.There are jungle trees of every species.This is just typical jungle ground.You see the blue Panamanian sky.There's nothing interesting down here.Here and there you see a few jungle rocks.It wouldn't be a jungle if there weren't vines!It looks swampy at the river's edge.Why do that? Who knows what dangers lie beneath the surface of the river!That small boat made it after all!These other people are also on their way to California!The axious travelers say, "Let's get going! We have to get to California as soon as possible!"A few straw huts make up the city of Cruces.These mules will carry the provisions.There isn't a mule to look at now.There is no man close enough.It is difficult to see snakes in the jungle. You could be looking right at one and not see it!This is where the ancient Spanish road meets the Chagres River.Those animals are mules!Your guide is completely at home in the jungle.You don't need any water.4cak pqrstvbb b !)v+/%c[X#Fzvc[La L!)q+%+#Q{+!)p+%+!)q+%+!)p+%+!)r+%+! ) s+ % +! ) t+ % +!)%+^ %+#!)v+-6 %XC!)v+-6 %XC! ) v+ - 6 % X C ! ) v+ - 6 % X C ! ) v+ - 6 % [X C !)v+-6 %[XC!)v+-6 %[XC @/Ic #Q{+ #Q{+4 #Q{+A #Q{+N # Q {+[ # Q {+A+#8W8V8X8Y')8We8Ve8Xe8Ye Qj2 QW7 QW7 Q?? QC QH Qb  Qu  Q=  QW  Q   $ Qj2 QW7 QW7 Q?? QC QH Qb  Qu  Q=  QW  Q   $ Qj2 QW7 QW7 Q?? QC QH Qb  Qu  Q=  QW  Q   $ Qj2 QW7 QW7 Q?? QC QH Qb  Qu  Q=  QW  Q   $ Qj2 QW7 QW7 Q?? QC QH Qb  Qu  Q=  QW  Q   $ Q j2 Q W7 Q W7 Q ?? Q C Q H Q b  Q u  Q =  Q W  Q    $  Q j2 Q W7 Q W7 Q ?? Q C Q H Q b  Q u  Q =  Q W  Q    $ op ZY  c  #Q Q Q~ Qv #Q Q Q # Q  Q  # Q  Q  # Q [ Q ^ Q b Q g Q l #Q[ Q^ Qb #Q[ Q_ Q_ QX'R 'R ' R  ' R  ' R  'R 'R   $  $ $   $   $   $  $'() 9G2  9)(M) +- 9/I6 )v+/ 9F /  /   /  c cwMg # )v+/- 9MIw w   9N)+.Y[8W8V8X8Y>Zx[ ) /Idd eM 98V eAAa 8Z[\^~ee(e e e qee0;e)eee' +nee(e]](=(ee( JFt e+e* ee$ '9 JFt! e3e4e5e6e1\+cc e$e [e! e#e"e%e&ZZZAAX yLe8e)e yQ~X2~R23e 6] 6] ]0Z060Z 6 2!e ee'Ke s  JFte-e,9ee:::ee7ZZsssss- e." JFte4e5e6e1\+cce2k8 r( b3W"n?v9^|\A b 9 l  u  X v Oh no! It can't be!! Not the dreaded jungle ants!!!It only takes one of those tiny, vicious creatures to get up your pants leg and you'll be hoppin' like a Panamanian jumping bean!You can only jump around like that for so long before you become completely exhausted.You are not feeling well. Every inch of exposed skin is covered with mosquito bites. You have the chills, a fever and are sweating profusely!The jungle is taking its toll on you. You are feeling nauseous, your limbs are cramping badly, and, despite the moist surroundings, you are extremely dehydrated.Your physical well-being has been weighing heavily on your mind lately. Your skin has a strange, yellow tinge and your tummy is upset. The natives say it may not go well for you.Let's just say you aren't feeling well. You don't even want to know what your symptoms are!You can fight the ants no longer.That's a great idea!That's a great idea, but there's no vine nearby to jump onto!Right now, that doesn't make sense.That would be crazy right now. There are jungle ants galore down there!The ants are thinning out, but you better wait until they are all gone.What a terrible way to go. These jungle ants are ruthless!The Spanish road is steep, treacherous, and surrounded by bushes and vines.Bushes and vines line the road.There is no river right here.You don't want to prolong your stay in this jungle by doing that!The jungle has both large and small trees.There are no ants in sight right now.Right here, all you notice is the blue Panamanian sky.All you notice right now is the rough ground.The road is lined with rocks.There is a long vine hanging above the road.There's no sign of a swamp right here.Those are the dreaded jungle ants!It's all you can do to just hold on!You left that back in Cruces.You swing back and forth for awhile. Isn't this fun?!There's a man resting beneath a tree next to the road.The man walking ahead of you says, "We're in a hurry to get to California. You can take your time if you want to!"The grass is long and lush from the moist climate.These mules will carry the provisions.There isn't a mule to look at now.There are others ahead of you on the road. There is also a man resting beneath a tree next to the road.It is difficult to see snakes in the jungle. You could be looking right at one and not see it!This portion of the road is very steep and rocky.The road looks clear, so get down from here!There are many vines in this part of the jungle, but right here you see none that are interesting.You see a road covered with dreaded jungle ants.The man is resting under the tree reading a book.A weary traveler is taking a nap under the tree.From here, it looks like the man under the tree is reading a book.It is a black book; the pages are edged with gold.You already have the Bible.You gratefully receive it and say, "Thank you!"You won't be able to do that from here.The tired man is taking a nap. Don't disturb him.The resting man says, "I've been traveling long and hard. It's time to rest and relax for awhile."The man continues, "In fact, stranger, you look tired. I wish there was something I could do for you. Well, maybe there is something I can do.""Here. Take this book. It may be helpful to you. Go ahead, take it," says the man.You aren't hanging on a vine.You are on your way to the vine.4uak stub bM9 M!)s%#QPL!)t%#QPL!)u+-=CX%VL!)] %+_ %+#8W8V8X8Y')8We8Ve 8Xe 8Ye mv 8 C 8 C 6 mv 6  $ Q $ ``   )/ 9  9)P<  9M) I e c cwMeg2 \\ M6 #QV  )  )u+-/X($ 9LI   ee c cwMg2 8W8V8X8YXZ ) /Id uM) / 9Idd eM 98V eAAa JmJo J`Ja L`Mb " 3   L`Mb B zzzzzz8Z[\_ 8Z[\]~" "e* H`Sb eeeee.P "e7E H`Sb eeee0 _ke, lwe/ xe- e-aa55^ " ae( E H`Sb eeee0 _ke6 lwe5 xe4 e4aaaaaaaa0P "e(E H`Sb eeee0 _ke6 lwe5 xe4 e47e0ZaZaqZqZa5Z5( H`Sbge \"gcee J{ee(e e eeeee]](=(eee$e  e$[e!e#e%k7?pwt_2A!WS9Z-  > X . ] d  OUCH!!You wonder what you just stubbed your toe on.You push back the foliage obscuring your view. What your eyes behold is difficult for your mind to believe!You rub your eyes in disbelief, thinking that you must be seeing things, but what you see is real!There is an ancient GOLD disk with Spanish markings on it! It must have been lost during a treasure shipment or a bandit raid along this trail centuries ago!There is nothing around here but plants, bugs, and creepy, crawly creatures.First, you take a good look around to see that no one is watching you. Then you cautiously pick up the gold disk, constantly on the lookout for creepy crawlers.You are not feeling well. Every inch of exposed skin is covered with mosquito bites. You have the chills, a fever, and are sweating profusely!!The jungle is taking its toll on you. You are feeling nauseous, your limbs are cramping badly, and, despite the moist surroundings, you are extremely dehydrated.Your physical well-being has been weighing heavily on your mind lately. Your skin has a strange, yellow tinge and your tummy is upset. The natives say it may not go well for you.Let's just say you aren't feeling well. You don't even want to know what your symptoms are!You keep your eyes peeled for the slightest glimmer, but you have seen nothing, so far.This silent, slithering snake has squeezed the life right out of you!Watch out for those jungle plants! They have leaves like swords!!Those brightly-colored plants are a jungle specialty!The jungle is full of many kinds of plants.There is no river right here!You don't want to prolong your stay in this jungle by doing that!This is yet another view of more jungle trees.Through the heavy jungle growth, it is difficult to see the sky.There are a few rocks around here, but the jungle has overgrown them.Vines abound in this part of the jungle.No sign of a swamp right here!Where?You left that back in Cruces.The other travelers are ahead of you on the trail."We won't wait for you forever!"The grass is long and lush from the moist climate.There isn't a mule to look at now.There is no man close enough.It is difficult to see snakes in the jungle. You could be looking right at one and not see it!This is the worst jungle you have experienced. Some trails are overgrown and difficult to find.You've found all the gold there is to find in this jungle!Any GOLD left lying on this ancient trail would be overgrown and difficult to find.You see nothing but dense jungle.The overgrowth is so dense here that you can barely see the trail. No one has been here for centuries!From here you see two narrow, but well-defined, trails.Centuries ago, GOLD was carried along this route. It is now overgrown. There are narrow trails leading through the jungle.The jungle gets more dense as you leave the well-used trail. Few people travel this trail. You notice the jungle gets even more dense nearby.This route was used to transport mass quantities of GOLD centuries ago.There must be another way through this jungle!Ouch!!This trail is traveled by too many people. If any gold was lost right here, it would have already been found. Some trails are overgrown and difficult to find.You are not far enough from the well-used trail. Any gold that might have been lost right here centuries ago would have been found.No one has been here for centuries. The extremely dense jungle makes looking for gold nearly impossible. You see nothing right here.This ancient Spanish gold route is very overgrown.4 k stb bbbN N!)t%#Q}PL!)+%\#GL!)+%n#GL!)+/%X!)+/%d!)+%# $ S 0 09 ) 9F  0  0.  )  ) 9 S 0 0) ) 9F 0 0 ) ) 9 xrwS 0 0) ) 9F rw0 zrw0 zrw) rw) 9  xrw)+/M 9I(( $)ccwMg 2E  2E cc#I2 $#I $ 22"3)+/-M 9(Ic3 4$e)c cwMg u u H 8Z[\^~ee(e e eee0eeee''](](((]]=(=eee$e  e$[e!e#e%e&e'e(Z(''e2De*k2f@_$n'E[u^The more you struggle, the quicker you sink ...You are having a bad day and this gator is having lunch!It's hard to believe, but even the depths of the jungle can be beautiful! Here the road crosses a jungle stream.Jungle plants line the stream.This is a small, seasonal stream.You don't want to prolong your stay in this jungle by doing that!This is yet another view of more jungle trees.Most of the ground here is covered by the stream.Through the break in the vegetation over the stream, you can see the sky.There's nothing interesting down here.The stream rushes over the rocks that lie in its path.There are vines everywhere in a jungle!The still parts of the stream appear to be swampy.If you insist, give it a try!There is no %w2 here.The other travelers are ahead of you on the road.They can't hear you.The grass is long and lush from the moist climate.There isn't a mule to look at now.There is no man close enough.It is difficult to see snakes in the jungle. You could be looking right at one and not see it!This is another section of the ancient Spanish road.There is no way of knowing what is under the water.It is a jungle cliff with jungle plants growing on it.That gator was hiding just out of sight. There was nothing you could do!An alligator can be anywhere in a jungle!You don't need any water.4yk!)y+-%#Q P!)y+-6 %mC#F!)y+-6 %mC#F!)y+-6 %mC#F!)y+-/=%:6#F#2/d$+ d! "d# $d% &d' (d) * d +G +Q HQmPG Qo $+%}#Q Q_ Q% F( +Q_G  Q  Q}   $  +%o#Qo Qm $QmPG Qo $+%}#Q Q_ Q% F( +Q_G  Q  Q}   $  +%o#Qo Qm $QmPG Qo $+%}#Q Q_ Q% F( +Q_G  Q  Q}   $ ! +%o#Qo Qm $e+~~e,e-e.(e/]e0&e1+e2je3~ e4e5e6k6tn7pNW I0*XOnce a traveler makes it to Panama City, his worries are really just beginning!The population of Panama City increases every day due to the steady stream of fortune seekers coming across the isthmus.Panama City is becoming extremely overcrowded and unsanitary, and is an ideal place to contract a deadly jungle disease.It is difficult to find food or a place to sleep.The overcrowded and unsanitary conditions basically stem from a lack of ships on the west coast of Panama to take gold seekers to California.Those ships that do leave for California are overloaded to the point of being unsafe.Gold seekers, trapped in Panama City, will do nearly anything to be one of the fortunate souls to be on board when the next ship sails!Tickets are scalped for two or three times the price paid for them!Fights break out over who will get on the ship and who will be left behind!Those who are left behind are forced to retreat back into the City and attempt to fend off the numerous jungle diseases.Delays of two weeks are usual, delays of two months are not uncommon.You are one of the lucky ones; you manage to get on a ship. It is incredibly crowded!!!It is only a sailing ship, but it is the prettiest thing you have seen since you arrived in Panama! It is anchored about 2 miles offshore.The old part of Panama City is within ancient walls. The suburbs are bigger by half than the walled city, and the houses are dilapidated.The city is nestled at the foot of a considerable mountain.It is necessary to use rowboats since the water is too shallow to bring ships into port.This port is more protected than the one at the mouth of Chagres. The water is much calmer.You've waited too long for this to bail out now!Everyone looks as expressionless as you do, but they are just as glad to be underway.The white walls make the city within look beautiful.Most prominent are the whitewashed ones with the red tile roofs.It is a pleasure to leave that jungle behind!The flags are animating in the jungle breeze.What a view of Panama City!4u.c cwM i8Wg8Xg8YgD,This is the end result of parasitic protozoans that have been transferred to your bloodstream by genus anopheles.Your yellow skin was your first clue. Yellow fever has gotten the best of you!You have been through a lot of misery lately. Dysentery isn't a pleasant way to go!!4~ c cwMg nSo Sorry! This silent, slithering snake has squeezed the life right out of you!4l ^Z=  4bqq܂#ݰݳww݂x ޮx ނ      ܂>U>a>mnyn݅nݑnݝ{>U>a>mnyn݅nݑnݝ{>U>a>mnyn݅nݑnݝ{ ܂>U>a>mnyn݅nݑnݝ{u>U>a>mnyn݅nݑnݝ{u>U>a>mnyn݅nݑnݝ{u>U>a>mnyn݅nݑnݝ{?P!) W 0 4 2W3&23X# K:U 0 42:3Q$&23# 0 4= i g e)N 9 + + +{23e) +N 9 ) ) Zaeooaoao]o'( / )/M 9Gee'7'; 3e%e^)+/M 9Ge  ee# e%e#e&e'e+e,[e-e.e1(e0((e''](](((]]=(=e/Z(''e2 0 4=p QQpiKpzo{p pz2 fBp!Fm'W-{Miles from Sutter's Fort: E: %v111 S: %v112Downright bright thinkin'! But how ya gonna do it?Nothin'!Ya can't be pannin unless yer in the water!"My, Oh My!! Ain't that a beauty!!!""Willikers!! This is wonderful!!!""If this keeps up, I'll be rich in no time!!""Suuuuuweeeee!! If only those Brooklynites could see me now!!!""Oh baby! Ooooohhh baby!!!""Boiling Brooklyn!! What a beautiful baby!!"Diggin' is for when yer on dry ground!!Ya can't pan if ya don't have a pan.Ya can't dig unless you have a shovel.A tree is a tree is a tree. That's all it is, just a tree!This is the Sacramento River. No miner's claim ever panned out in this river.You've done enough diggin' right here!What %w2?This is just like every other bush you've seen.If it ain't GOLD, ya ain't interested. That rock ain't GOLD!Yer walkin' along the Sacramento River.This is the shore of the Sacramento River.The hills across the river are out of reach.This is just wild grass.There may be gold galore right under you, but you can't tell just by looking!There's no time for that. Yer lookin' for gold!You see more of the same terrain.There's no need to cross the river.You don't need any water.4 f do o#pp 4 0s;dc ddoo=poo p oop poo=ppo'o=po o(p o o p o opp oo(p po!o(p oo"poopoopp qq܂d    d    xyxy yx xy߂ww 4 0= ddddb b b/b 4b܂9dUamy݅ݑݝ{9dUamy݅ݑݝ{9dUamy݅ݑݝ{~ ܂/dUamy݅ݑݝ{s/dUamy݅ݑݝ{s/dUamy݅ݑݝ{s/dUamy݅ݑݝ{?PdS 4 0!),P&#d.!)P&#S !)P&#S !) d%Px# 0 4= i dc gc  M d ߗ" F M d ߗ" FN# fn( $& dGTGT!% c/' Mw)/ 9I GTGT c cg( $$ + + +{23~1e fsne fsne fsne fsnee) +N 9Zae'7'? 7E<e e\)+/M 9Ge ooaoaoe>87EEe)Ee<ee   > 8  ;EEe*Ee!< fe   e e- e/e-e0e1e2[e3e4 0 4=~poppoppoppoppoppoppo;ppp|p{oB;poopoopo;oo{p&po;pp{Fpoopoopo;ooozo{4 j$Gu `eW*X !8%o $ E ^ Miles from Sutter's Fort: E: %v111 S: %v112Downright bright thinkin'! But how ya gonna do it?Nothin'!Ya can't be pannin' unless yer in the water!"My, Oh My!! Ain't that a beauty!!!""Willikers!! This is wonderful!!!""If this keeps up, I'll be rich in no time!!""Suuuuuweeeee!! If only those Brooklynites could see me now!!!""Oh baby! Ooooohhh baby!!!""Jumpin' bullfrogs!! Look what I found!!"No shovel, no diggin'!!Yer gonna see a whole lotta trees before yer through. I wouldn't waste much time doin' that. There's GOLD in them thar hills!!There's a %w2 workin' real close by!There ain't no %w2 to look at!You've put enough holes in this part of the earth. Go dig somewhere else!"I thought I'd try my luck 'round these parts," says the miner."I been diggin' all dern day and I ain't got nothin'!" exclaims the miner."I've heard 'bout some mighty good diggin's up 'round Coarsegold!" says the miner.The miner says, "The more I hear it, the more I believe it. Gold ain't no where but where ya find it!""My pard and me, he done passed away, worked the land up by Mt. Bullion and did right nice," says the miner."The worst, lousy, hare-brained idea I ever had was to come here and look fer GOLD!! I ain't found a single nugget!" says the miner."I saw the derndest thing up in Calaveras County, a jumpin' frog contest! I couldn't believe it!" says the miner.That %w2 is workin' up a sweat!"Don't be diggin' right there, pard!! That's part of my claim!!"Ya ain't close enough fer the %w2 to hear ya!"Don't move a muscle ya slitherin' rich gold man! That is if ya value yer life at all!!" says the bandit."Move real slowly now and hand over every last ounce of gold ya got!!""Yer doin' just fine!!""I said DON'T MOVE!!!""Now just pretend yer feet are stuck in cement and don't ya move an inch. Ya give us a one minute head start and then yer free to go. If ya move one second sooner, yer dead. Ya got that?"BANG!! BANG!!! These bandits mean business!!!All ya can see is shifty eyes 'tween the brim of their hat and bandanna!!Bandits ain't got time fer small talk!What %w2?This is just like every other bush you've seen!If it ain't GOLD, you ain't interested! That rock ain't GOLD!!Yer in GOLD country!There's GOLD in them thar hills!This is just wild grass.There may be gold galore right under you, but you can't tell just by looking!4 Ooo=[oo o'o=o o oo(o oooooy~qq܂ * ܂V ܂   xyxy yx xy2ނww= bb܂ mBd9y݅ݑݝ{ mBd9y݅ݑݝ{ mBd9y݅ݑݝ{ mBd9y݅ݑݝ{q ܂ mBd/y݅ݑݝ{f mBd/y݅ݑݝ{f mBd/y݅ݑݝ{f mBd/y݅ݑݝ{?O 4 0(!),\aQY&#!) X# 0 4= i g~1e!)< fsne fsne fsne fsnee)N 9 + + +{23~1e fsne fsne fsne fsnee) +N 9 PY ) PY ) Zaeooaoao]o'? /7 PY$E<e )/M 9Gee'7'R J PYe4E<e e)+/M 9Ge >?Ee<ee   > ? "Ee!< fe   e"e# e%e#e&oe'e(oe)e*e+e,[e-e.e1(e0((e$''](](((]]=(=e/Z(''e2 0 4=o (oiKoooo 9|ooo 9|p{2W f Cqf!\-(RN3Rmw; } 3 ` y  = Miles from Sutter's Fort: E: %v111 S: %v112Downright bright thinkin'! But how ya gonna do it?Nothin'!Ya can't be pannin' unless yer in the water!"My, Oh My!! Ain't that a beauty!!!""Willikers!! This is wonderful!!!""If this keeps up, I'll be rich in no time!!""Suuuuuweeeee!! If only those Brooklynites could see me now!!!""Oh baby! Ooooohhh baby!!!""Jumpin' bullfrogs!! Look what I found!!"No shovel, no diggin'!!The miner near by shouts, "Hey man! Yer pannin' in my claim!! You'll hang fer this!!!"There's a %w2 over by the river.There ain't no %w2 to look at.Diggin' is fer when yer on dry ground!!If yer gonna pan ya gotta get one.You've done enough diggin' right here. Move on!"The only luck I'm havin' today is lousy!" says the miner."I was just over at Grub Gulch and man-oh-man was there a ton of GOLD over there!" says the miner."I heard from some fella the other day that the hot spot 'round these parts is Fresno Flats!" says the miner.The miner says, "Ya ain't seen that gang of bandits have ya? I just heard the other day they were moving this way!""Did ya hear 'bout the big holdup in Hangtown the other day? The bandits got away with over $70,000 in gold dust!" the miner exclaims."Up at Downieville, those boys are takin' twenty ounces a day. I wish I could find GOLD like that!" exclaims the miner.The miner says, "I just moved here from Rough and Ready. There's nothin' over there!"The miner says, "I heard someone found a twenty-eight pound nugget up 'round Grass Valley.""Some of the hottest territory is up 'round Columbia I heard!" says the miner.The panner says, "Somedays I'll get some gold in every pan and other days I'll get skunked!""The pannin' here ain't nothin' like Moccasin Creek up north!" says the panner.The miner says, "Oh to be back at Rattlesnake Bar! This area ain't produced nothin' fer me!!"That man is doin' his best to find some GOLD!!"Yer crowdin' my claim, stranger! I ain't goin' to put up with that!" shouts the miner.There ain't no one to talk to!This is just another tree!What %w2?This is the American River. With a little luck, ya might find some gold in this river.This is just like every other bush you've seen.If it ain't GOLD, ya ain't interested. That rock ain't GOLD!You are next to the American River. You notice a trace of a road.You are in the wilderness next to the American River.You notice a faint road. It must lead somewhere!The road leads to Coloma to the west.This is the shore of the American River.The hills across the river are out of reach.This is just wild grass.There may be gold galore right under you, but you can't tell just by looking!There's no time for that. Yer lookin' for gold!You see more of the same terrain.There's no need to cross the river.You don't need any water.4H>8-88.*IzI Ik HKNzHR^zNRzNSK! ) K+ - 6  C X !)H+/6%7lCX#G!)H+/6%kX##G!)H+6 C%\4#LG!F)N+/6 C %E4#!F)N+/6CX%4#!F)N+/6 C%]^#!8V))6 35%4 ]l%f# kk> kk kk kk  )+-O( %  8V)).O( >     )+-O( z{% 8V)).O ( 8VCe<F% 844 P^j^3j3 F) /I 9 :eAA"/ % Kk# F Q kP  $  44  ( 8:  ( j5[ 6 j5[ 6 j5[@  (   ( z^k,  (   ( A4O4 I A4O4 K 49 I 49 K Y^g^ I Y^g^ K34$2wee2I2xee2Jee39ee393^e 3^2ae e 2`e 3j3^e3je3j3e3eTUT A4Oe2e3  T U T   A4Oe4e3( 849 PXv^ ioe;e:z 849 PXv^ ioe<e: 849 PXv^ ioe=e:{ 849 PXv^ ioe?e:S e@eA. leMeN.S 84o4 p4O PPt^ l3 84o4eR p4OeS PPt^eT leXeDSw..S..Sw..S.Sw. leMeDSw..S. leXeD 84keEeD 84OeOeD PSePeD {^eQeD" 84keUeD Y4eVeD]]]00]]]00eY2 P^`^e eDe <^`^e eD* I4w4eZeD992 P^g^e[eDe\*e]]O]POenZ*eoLe[koa R QLv.~&W8Y:^{?h L S  < This is the bridge deck.You are at the top of the staircase that connects the bridge deck to the captain's deck.This is the section of the bridge deck that is the command center of the vessel.It is from here that the captain does his utmost to ensure a safe voyage for the passengers and cargo.This is the most aft portion of the bridge deck, and also of the ship.It is a favorite place for passengers to take in the view!This is the aft section of the sun, rain, snow, hail and sleet deck.Today is a beautiful day!! What a view!!This is the staircase that connects the captain's deck to the bridge deck.The captain keeps his quarters very tidy.The bed is neatly made and his desk is organized.You are immediately outside of the captain's quarters, at the base of the staircase connecting the captain's deck to the bridge deck.This is the small set of stairs connecting the main deck to the captain's deck.This is the main deck of the ship.You are on the ladder that connects the main deck with the lower deck.This is the ship's lower deck. It smells of sweat down here!There is nothing that even resembles a %w2 here.The captain seems to manuever his vessel effortlessly through the high seas!You are not close enough!"Welcome aboard the Sea Farer! It is my sincere desire that you are enjoying the voyage! Panama is not that far away!!"You can't see outside from here!The sea is deep blue and gently rolling.You see an island on the distant horizon!There are no rocks in sight!There are no icebergs in sight!You can't see through the coal hold door!You sure can't see any coal from here!I sure don't see a %w2 around here!You can't do that from here!The mast looks very sturdy!The door just won't open!Just walk up to them!The rigging whistles in the wind!They are whale oil lamps!Just a typical ladder!This is the aft command center door!This is the forward command center door!This is the door to the captain's quarters!You see nothing but blue sky and water!These stairs provide quick access between the command center and the captain's quarters.The door keeps coal from falling out of the coal hold.Do it!The captain steers the ship with this wheel.You find nothing of interest.You'll never get to California if you do that!It might be best to leave that up to the crew. They know what they are doing!A good idea, but not necessary!You'll never make it if you do that!4Y M+zj z*j z+ 8zz588zz5 k INQb'zNRzN-RzNWR8zI 88zI 8zI 88zI ! ) Q+ / 6 % C # F ! ) Q+ / 6 % C # F : ! ) Q+ / 6 % ?# C : !)I+/6%t\#G!)I+/6%V`#G!)I+/% XC#F!)I+/%6#:!)I+/%26#:!F)N+/6CX %4#!)I+6 =%d!)I+/6 =%c)#:!8V))6 %9 2: %9 / fn%j % 8:%9 fn%j8=Z[&23# IG; ; / I /  / / Q @: K ; I 6 / I /  / / Q :   8:  ( 35  ( ]l,  (   ( kk> k k k k kk  )+-O( %  8V)).O( >     )+-O( z z% 8V)).O ( 49 I 49 K #Gc'c' /<$8V:e3F393j3 F) /I 9 :eAAl ^9fj /<e. <ee.Y  % 1< 4299 e %;I 1<;I 429eie'.R  % 1<- e %;K 1<;K eje>0 Qjlj eeCe mjje Qjje  QjljCeee_ Qjljee' QjljCeeeell &/e eZZlZlZZ &/e"e34e#39e$e%3j3Ze(3j>2e)22Be*e+e,2A2Ne.2M`e/e0e/e13j3e23,2e322=e:e;2<2Ke=2Je>!`3j2Me4e5`e5Z/`e6`3j2M e7`\e5`e5eKeJ]O]POeM jAjee R jAje e ]]]0eZ{e[e\e] 4Ke^e**e_ 49ee`TUT eae.(  49 49 ebeSw.S. ebeS efe ege  T U  T  eheL Njj`e0ekekkk.MVu_.s]|7{!:' A + > b  T / @ ] kR%J-TlYou can not do that from here.This is where the real guts of the engine are located.You find it quite fascinating.You also find something else. It appears to be a pressure relief valve, in the open position, and a pressure gauge.The table is bare.This is the galley stove.You need to get closer.Some more amazing engineering!! This must be the piston and the paddle crank.The door is cool to the touch.You can not get access to the coal hold door because the worker is in the way.There is no door close enough.The valve obviously is not used very much. It is very rusty from the moist sea air. There is an open and closed position.You look earnestly in the area where the pressure relief valve once was located, but it is no longer there.What %w2?What gauge?The reading on the gauge does not look good. It is buried in the red zone!!The needle in the gauge is riding right in the middle of the green!!The needle is approaching the red area and is continually rising.As you attempt to move the valve, it moves to the closed position and breaks off.You try to catch the valve handle but it falls onto the floor and rolls out of sight.There isn't a %w2 around here.This is the spare shovel used by these men to stoke the boiler.I wouldn't try taking that shovel. The workers might need to use it.This is the most forward section of the bridge deck.This is the midsection of the sun, rain, snow, hail and sleet deck.Today is a beautiful day!! What a view!!It is a great day to be up here!!You are on the short staircase that connects the main deck with the captain's deck.From this position on the main deck, if you go aft, you will go up the stairs to the captain's deck. If you go forward, you go directly into the galley.This is the galley, which is on the main deck.There is a stove, table and benches.This is a favorite social gathering place.From this position on the main deck, if you go aft, you will go into the galley. If you go forward, you go directly into the engine room.This room, the engine room, is undoubtedly the noisiest, and most interesting, place on the ship.Considering all the work that goes on here, the area stays surprisingly clean. There are only a few scraps of metal lying on the floor.It makes your knees quiver just to think of how powerful this engine is!!You are on the ladder that connects the main deck with the lower deck.Here is a hard-working man! He is standing next to one of the coal hold doors.There are a few scraps of metal lying on the floor around the engine. Apparently little pieces have broken off of the engine and haven't been picked up.What metal scraps?You already have some metal scraps.You scoop up a handful of metal scraps, being careful not to cut your hands, and put them in your pocket.Here are two coal hold doors. The coal is stored behind these doors.There is a shovel resting against the wall between the two doors.You are right next to another hard-worker. You can sure tell he has been working hard.The boiler is located down here on the lower deck. It is a hot spot to be!!How can you do that? You don't have anything to eat!What paper clip?There is no string in sight.That is a great idea, but this isn't the best place to do it!!Go ahead and climb on!The rigging on the Sea Farer isn't nearly as complicated as on some clippers you've seen.Made of strong wood, the mast goes through both decks to the keel, making a sturdy structure.The stack is ironclad, and carries the smoke and sparks high above the deck. The ship's whistle is hitched to the side.Using steam from the boiler, the whistle gives a loud toot! The pull chain reaches clear to the engine room.The paddles are turning, propelling the ship without the wind's aid.No one gets to the boiler but by this ladder.These men move when the captain bellows, "Pour the coals on!"The coal lies behind these doors.Coal is the fuel used in the boiler.There is a hot fire in the boiler. It boils water which produces steam pressure, used to drive the engines above you.Conversing with these men, you learn that they wish to put their shovels to better use, IN THE GOLD FIELDS!The door is not locked; walk right in!Just walk away from it!Nothing important right here!4w B8081,k JKNbzjz>D!)J+6%\#G!)K6CX!)J+/6%ek#G!)J+/6%Ql#G!F)N+/6C %j#!)J ++/6 %53#F!8V))6 8:%9 ik%j%-9# ::1 :: ::  )+-O( jj%  8V)).O( ii1 ii ii  )+-O( HH%  8V)).O( 8V7e0F393j F) /I 9 :eAA9.8 8 ++-/%{k#FQ0kP $.8 8 (I / j#j I j#j Kd   /9C9eee  /9C9 e e e e ZZss2 e' /9C9eeece\+e=39e$e% eKe&3j2e22"e2!e]O]POe)s  /9C9eee  "jje+e ]]]0eZ{e[e\**e_e`. Xje^e]Lek. ebeg'. eced( 99eee]> X#jefe]z 99ene]kn2%F['AW"dDs3]t+Hk)=Ui This man looks civilized enough.But he is a big man, with huge hands.He looks like he might be tough!Get a little closer!It is a black bound book with pages edged with gold.It definitely resembles what some folks would call "The Good Book", the Bible.This is a pleasant man to talk to.Quite a conversationalist!What %w2?You already have the %w2!The %w2 is not yours.However, the man has just finished reading the %w2 and offers to give it to you.You graciously receive it.Thank you!!You're welcome!You look around at the awesome, but noisy, machinery in amazement.You are in the doorway between the bunk room and the engine room.This is the bunk room. It is surprisingly neat considering the number of people that occupy this room.This is the forward section of the sun, rain, snow, hail and sleet deck.At this moment, the weather is nice and sunny.There is also a man relaxing with a good book.Fishing would be fun, and maybe helpful, but there is a better place!There is a stove, table and benches.There is nothing that even resembles a %w2 here.I sure don't see a %w2 around here!There is also a man relaxing on the deck.Go ahead and climb on!The rigging on the Sea Farer isn't nearly as complicated as on some clippers you've seen.Made of strong wood the mast goes through both decks to the keel, making a sturdy structure.You can't do that from here!This is the door to the bunk room.The paddles are turning, propelling the ship without the wind's aid.This ladder provides access between two decks of the ship.These men move when the captain bellows, "Pour the coals on!"Just walk up to it!Just walk away from it!The door is closed!The ocean stretches as far as the eye can see!That engine sure looks powerful!The door is open!Just walk away from it!There's nothing important right here!An occasional island passes by the ship.4E =*@ 0" =?@@>?= >!=$=&?'=-<.:/;67<6=5>6?5@6B6D7E5I6J5O4R6S6V4X6Y4\4_6`4c6e4h6k5k6l4n6o4r5s7t5u7w5{453545354565757545M.=1))Z*J2 1:* +19J*#!*Y1:a -)2: J*11:7 L? 7QБ *=a_^$]*],\1]5\5\=\>[;Z:[8Z7[6Z3Z2X1X0V7V?WGVOUUTYS[S[TUUSVSWSWiZWbXjYqYwXYYXWVEXTTTUUVVUUVWUUV|U|UwUuVpVoWiVgWbU\U/UBVEU[S?!!_ ] ^\VRRTVVXX:!*!0)ҹ W+M(J[V;jX`^[(G9[<[&B&H(T(OA034)!J C&F$&BB*;0# )1# ::<)ɪU]QSPLRISGPDPCO>O? >?BB>AA ?AH G !FF)"EG;EEDCDHHHHC"C#B F A@@@@@@AG"= %@ =: =$?$@ $> <> =">AAC ?C A@@@BBBBBBBBB@@A@1QP0T0S0R0R0R0R0R0R0R :S:R=R#@BRGRGQHS\T SSIT\QOТ M bSbRbRbRbRbRbRbR`RcS  fS iR|JzKzNyO}K!}PkS  pPtO)NPPRRPP2O Q0 S Q`R@QP6SCTGS|K gSPQ010QQ SSR`|Q!tQtQtQtQtQtQpRpRpRpRpRpRnRRdR^RoRoRoRoRoRoRoRoRoRoToToToToToToSoSoSoSoSoSoSoSsQsQsQsQsQsQsRsRsRsRsRsR3S5S5S5S5S5S5S5S3T5TATCTESESESESESESESGS^T^S`T`T`T`T`TaTaTaTaT9T9T9T9T9T9T9T9U9U9U9U9URSTTTTTTTTTvSvSvSvSvSvSrTpTpStStTjThUhUhUhUhUhUhUgTgUdTdUzQxQxQxQxQxQxQxQxRzR}R}R}R}R}R}R}R}SSSSSSSSSSSSSSSSSSSQQQQQQQSTU}T}T}T}T}T}T}TRRRRRRRRRRRRRRSwNyO>T1RUV1_VcV jWnWrXvV}WyV WWWWVVUnUZVY[\YWDYY\\V#Y\E,S,V(,S(-Y/[l"\&[f(\N[_ ]%XX>=;/U0[ [4Z!Y&V#WR92Aª P2;ʡI3@ 19"9+¹*!!1 U9!Q 91JA)"ORST%PѪiA iK*11,0ڲà"J190PbZ"9ZiQ IɱoFmHloGqG qEsFvCIkFlEhBGwCezD(E*CFFEEg@ieBj`Af[AhX?SAcPBU@&AHʂD)JmVbGDIK$|A)CbBgCWB2NJNVJVOm[I_IdIlgF(RGIICL ;O LO˞Cš@>/>ACFY\]Se$S PP(SNaVF,\OaMF@&DS$,N; 1*B-D/J4F)<#=4E5MO=O;Q:Q9R:S9T8T:U;U=W;X];]:\:\8[9Z:Z8Z7[7\8]6^7_7_6`6`7b7d6e6d7e8g9h9i9j8k:lm?lBmGmInJoJoMpNqOrMsLsIrHrEsCsAr>q'<';(;)<(;(8*7*7+5*1+0*-*))(*&)&($(#)#(")!( '!& %!$!$"$#$$#&#%!#!" "!!           *! !))01, !   " 1!10 ##!0" !   ! A  !09"""!\ehiklknrststxz|}|}|||{yyyxxwvvwvtrqqpopmlkl(!88gAiLuLw iF (>Vam~xwwwxy+*(%"sdUF92/46 8 !@               : * +  ! *!* *  +)  *9I!! 0 ; ? 5!2 / /y.v.w,t,u-h .^  0K Oz)Rx" ++ 3 546 <=/b/n/rP}OKHOM{SyPQ;><;52/.|.p-c.`0N| xs$n+f5b:ZGUON^JiGtFzEFD>853/,)'o(W+?-1/'1 3741.,+4@ $  #"'!"7!!#$" #: 2!1!0!/"/$1%8&9&=(@)B+D,G,I-L/N0Q2S3V4X5\6c5e7i9j:l=o?o@qAsCtDwGvIxLyMxOyPwQxS{UZ]_`acdedeijkmooqrstwvwxyxxyy)    j * ahb_b]`__]^]\^[^[^[_Z_ZaXfXgWiXkWlUkTmRmPmOnOkMiMhMgLfLdJaJ_I_K]J\JZIWIUIQINJLILHKIKJIJGJDKAK@LAM@M>O=O;Q:Q9R:S9T8T:U;U=W;X];]:\:\8[9Z:Z8Z7[7\8]6^7_7_6`6`7b7d6e6d7e8g9h9i9j8k:lm?lBmGmInJoJoMpNqOrMsLsIrHrEsCsAr>q 1  3 & "$&) !5" ! 0" 2! *  * -!)# /)  i=QAK--n*|9"u0e%"&%1"9")8G 9! $0!G\:)* *.,3 !YK!):XLURf=)#$0"k>))"),:,u))  *u *  l* -zx deb O 79M :M~G)e)jkzlta{ bx*= .D   +|xuro {'a!  "$%'~#}.!w)<27<) $-* .C&:3!#!- +) ;)G+"3+ )-O[H>GFVAg<:@4*.=N 2!  * " !+", : $#   0) 1 *1!)30 !Q ") )*!+1 "))*1+ #!)9! ) 9 !) # !%  *2 $ 0$9 !" "$`09M +9Z :0;+0,- 9ƒ!; I*) + Y.k)) 4] 7d  -~,-.~0w/u-y-|/sXXe^mWuUwV|KyNeJiMkMq7}.z,0i5_8ebRhf c`^ ]!W%Q<l\>:;.;*1$(* +))(")&.(1&2!5 678:;>?@IHJP#!_))cg!l, *9!*!{w* viAI9t2QFDB @ AABC@3>;2520&.',&*%* **"!#%!'02:=MLMOKNPUdeedchmo~uz}wwvw \>LZ@J,+0;9$0%&%t} =;; + {wtqtx{wx"q n *+!%v"å! ",) *v)l(i)d+c.`/].U-R/O2M4P3U5X4S5O9N;N=Q>Sb?d@g?k 92%  ZYW,I#*A$?!0] :"9N.+;$!A)RIJ+7* <0#*@,M'2++\+ `*. *_vdo)gr#)jx ;:+3 {h9 #! ["1#$1 W31:34%m"$X"Sy}supztj#l"h!k'`,`'l)s(u)w(y'{&$#@o?Q=VHUJ]U_TYVVVHXC198:@FKPU`\]b^waxcvd}fikvoc`dd^[gi^P\NYJ[IbCfEi>m9x5vjg e"d(c.c3s>p>n=m>:>@3>,=)>'?&@$?">#<&<-139DG&E)O&R%S"T!UVWDFEGDJCKj?k@lBmDnBTJUSTTML!'/S:iv#"MB*H#E%SKJ!ma!]*UATCc*b-}JQ]S]t_fkbj_d^cZyUyJI>7^dr!.!?[OZNXP mu0#!#"$"$#%'%&888877772::$$ ( '"*")%-%.#,#-iihhighgddccddUYUXVWVVV\V]N^N_K]K^<<771 1!3 66%%QZQYgghcdbbbb ""$#)&+(-)-,1+4-9.<,?,A.B/B0C1F3I6F7H6K8L:K;K=N?N@P@Q>U>V?XAZ@\C^G]I[P\R^S]T[SYUWWZW]W_X`Za[cZdZe\f]f^h]j_kajbjekgnhphufxd|degi%kmn4a 7.A.A6767/79A9BA?A@MDMETHVHW ;U L[OXN\PV LSwwTw[WkU<jDBjsLLJJKNL~DXwBFJJN~NR~RV~VZZ^^bfx^xZxV]VUONJV QNMKlWTQKkJcI`JJd.>D>X@XoXvmvwCn.oo ol>?><@@qqpj @+@1@@@F@U@[@j@p@@@@@PUqFq@q1q+qq94yj shZZhhj\j \hehRMMIGGIMMRhhjWjXfjXjVkUnaZs') \iXhSWaXdgZfWZa[cn]wWxXo_ >% 8=9=K>_>u>=>Mo9n$ookres[p]i`hWaZ^\[_Ybo^r[]swXshfhigTThhhRRjYlbXf]uf[hec^eg`a\d8`r  ( EF4I6L4JL479Q9DjQjYY9a9aYBY^aAaXa\ atUsSvRRSTVokZQQR~vssr j  gvgzgzh irisbsbr[PoPPPPZvZu ddcc"b\2^A]` `u h v|c|UR b"b9bAbWb[c!bdcLAMINg NrN|OM FAGg GrHi9j4m,o'p$tv{~ o9p3t+x$|"y J/IN K~{*  -E-M-X-c-l-&& A FFA NNS S ONS)S)NNAF)F)A3A3F>F>A>N>S3S3N=NSANNPbR@DQ$D8CQBPQ9P#Q /T1d0 -EjEfuuBjjBss-B-j/j/B-s-//sBBBjDgDBBsBDDsWBWclBlVnBn\BT`^fBRB\BaSU.XCUCjXFmKLdRCw.|}IEIEKKJEJNIXIVKNKNJVJ@0uuv N> & **. . 22 "     P 7 79@A0<@,<@A<@V<@k<@<@<@VmmEm0mmmffbb^^ZZVVRRNNJJFFBB $).38=BGLQV[`ejoty~EQDN1E1NEFEQVFTQfAuAAt\r^o`p_d[ax x w7yFyRxdrr{}gZ~dX &.8@IRW l [dmv@C[q jq pq q q r`z@s ls Ws @III,I0IAIEIVI-/BD W ln 0  q55-t-x%%U%VI  ZWVXXVZNJJNLLUUkXl[m_decaxii\f\t]whVgUY`ZbWfXhLiZb_[dtz`wowkw gsdt[zgz@ozzizibIIKbKbJJIIKKJJ/@/88/`/88/`%/%88'/`-/-8'8//`5/58/87/`?/`M/O/`U/U8S8W/X8c/ e/e8c8g/@g8Ut et t0@x@fx@Vx V}Z}k}o}}}}okZVuxxx|xyxvxsxpxkxhxhubuaw_xZwoopkZZkkZT S0 ZkkZook7okZV]]^^qqrr~umuXukIoIIIIIgrsrsgggrrssrssrggwrvrvswsqgpgqrprpsqskgjgjrjsksegdgdrer_g^g^r_r_s^shPUhAh0h,hhhhaaZZTTMMFFF *F ,MMT,T,ZZa,a0aAaAZ0Z0TATAM0M0F ?F OaVaVZOZNTVTVMNMTF cFkFoFFFFF`cMkMoMMMM`cT0iT oTTTT`ZoZ fZaaaFZFaaxZFTEFEMhv}   v0}@@uuu,u0uAuA{0{,{{{{,0AA0, ,0AA0, ,0AA0, zE E E E Ou0O{0O O u0| 0PPPPFFF{Fuv "6*|F5r<&2 r__9_A_Y_^[ [[]]$]+[0[7]]F]L]R[W[\_u[[ a Y !] ]Ya[[.a.Y- !].]9]AaB[C[UaUYT !]`84;6>5B7D5M7P5Q676][ [[]]%],[1[8]G]M]S[X[]]_ ___1_7_F_K_S_X ',(,15&<&C&M&T&6=CMSqtt5&<&C&M&T&l8qsqusTRNLDB><6$568=>DCLMRSXrj_ r j _ ` ` ` ` iP `   ssssjjj jb)b2bBbKbTdcddc&&&%""::885533h3k k kk lli i^94_ ij4&*+/48Y>[9]8_6`1`+_+_3]6Z8X>WATRR_OmMtJzFB=830+*("  -3:;!(-49kNkNll:X:X;;D<0qqyyyyqqmjAA< < AAggj'@@ @ C@)AE?VQ"+.1*3:>BY@8^6[8X@VLRbNsJ|EB")99a+h+q*y(w.u6p9b > 87al_t\~ZXVSOGB=5[Ae?m=t:XOYZbLiInER Rhhj j @hZZ[Z R T Thhhz.v4eB\P`>ieOS S W Ycdg EG3E4C4B3AGDHZHjB7>9@9j;j;@&@&j$j$@JZJ_=>@>>H>S>--(8L.Y8M=5<@<=:^%^*E ua ]/^>\HFP?MR>$@@$GH$IJ$MN#OTU#VW# 'G#G8G=768x0~,y.u.|8r*u(r(+) /qP7q=qPIq@"3 DA1+  >$'0*(J+2.A@z#|$-+4*5*8A<51&0u+}+-}'#,&z!)w)y$v zI! xv6r5x-s-q8::{@@>z*=x*B} D4 HmIzCmD +! 0*  9# * '" + . * ! 9"&"* * } * 3! ,)|!#))0-69r9;;r$r$&&r&&$,p7p=pPIp@6n?nKo:y%|% Er6{~>|,.43678''. Kszv#v'v8u$'0*(J+2.A@z#|$67-+4 HmIzCmD9r9;;r$r$&&r,p7p=pPIp@6n?nKo:y%| Er6{~>|Ksv#v'v8utBnCrDmGlGoIkMmIpEvC}GuH{HtJoLrMoOnQqNsKwIJJKzMLyMuOxPtQrTsUrWxTxR{Q}S}SPNNPQRS~U{V}WzY|[WTQPSVWYYZZ[^]]\XWTOMLJIGFECA@A>=;8:<=;848:745202/+(%"}    ~}~| { }vuvst {r l t | zvw | a ``/a2`4`AbJcTe[g]i]jEiAkDl=k8j;h4h'f+gigi f hjfc a d d'e9fJgRhUh[fSd?cc 3&4      #!      "+1, ( 1 +%;LJZ`gben\YN:+3)"(#3|snnmq    +$9Yup rutu}| {x :=<;W]TQOPRRfMhGkCnExFvGtJkLlPnNmMnLpOtLwb`ccede{ccxaww~vttpxgz`tc|9-'!__.`EaKeCfNgUhX][{ h ! $*- .1 6;? @A *!"%)-.*MYB6:;&:.,!!."0*/:-C "7!B#J"V$g#w"$$N&$ _!i-*,Ӥ.>9+:"02+*N:a$=,0&1/08,"@-#/+-1//.6.<-@  " % + -+ .1 2 = 9:#874/-++)('&"!*;N* 4;9!)" !>=?+*'"' &"&+ J#*1,5+*9%8/9-:/;-<%=&<#;:)16 372-/##*!)$2++-6 (I#ô9. ),991&: & ,' '*-)(%$ 13 9 < >58%-/,2-923,%.203/./(.$! %0 / 543&%#5$6!8'"K!V#j!"#%%'(+-/ PKV T[$ lty~ } #$!"A$L#W%f$x#$%& !j/R6)1>0GOQZ?at{\:~2b!D#%(/11-(%"!6);0Nl<*0\TSQ{>,L):`٠*"I#P#cW[]` er| "{#|%;?LbwxX $'*/!/0')('''$**).!* 0+!)/(3%E$I![iw&2&'$.#4 F\ebjsv~~u|V$> sZ"${|'/8  9"!), 9&B .A)439 )";)"#:)#"2*:-a<&gBt7;"{3 *3)#):" +<"**2-x'fa!\!500=)98    hh9/1'%&1 53:;>IDLPSa^9duji~UK@ &9?K :]Q]RSSMR:S4R$STUTVUU'TISISR)PEG`Z!b"g(gXQvwOlgvW}XfYs[wOiOPy]J=cGiGxD}8;"$7B$?&2I LVbjqiyy,@;94 DE.?HKE$PPNVP 4C )F@GFL7> BCAO JEJ.m x(YMNw747/E2 +& + ' $ % ! "{ @h&햖I"曃(*'&%#%#%#/ (-%,%,&))')')',,,)#e:O3O(P FN*MNROR+ KhLGD7CB@O/J@J N>P4I(:*!):@"", 5)9 $,! S)+ 1+T౤ѩʬʒ’ 2%)  Y k+#*0N!5,+5  0+ɤēj;0#&(.23897998~6~9|:x;|=}=y;w?s@tBvDlGnDrDwAx@zC}C{E|FDCGIKKNQRQSUWXY[^aeehjjlmnrtvwy|~ud_YLD:8:6,&$)&"&%*%  ,K4!+; !!+2:ALZcgt~}zyvvrxy|~Tx 2)$"9ђ y z>|IRWYYQI6x"yBzOzF}Oa[Y\cfb[[][[WZQPV<4'$)'[ EnCtWr[xw{}y0zC{G~QVUPMF) &,)5!-10;1>0@3K4V3e3n4zbRB=:2)&.25465.'/210&*>F;I#.:$3 +- #' 1.400*+ +',8(?$=3=/>-E&Q<3^$ak"p#u!{$| ~#&&(.'*'!,! /;!*!* )1"I#R#>)11:":1gfh~k|opnnqsrtusuxx|}. 5"V-<QjPbQ_T]V_UeWgXaZ_\\]a\d]g[iZm\q\u^w`uay[|Z~X{X" 9K+vnstuwA2!#),-17{Y$4" ʒ6:+1))%!-A*a$  A+@)1 %&' (!8CLR!   ":-$@9 2; %(()013475 3 %A > :9u nC$zzKZ! "4') ) *2856689<> 3*8#)0% ) )"!B ʢH" 1J à'59++1#  #-*-3>F J INљ,$<ECL&'#!15 ? B%"$z$BB!  j#I:9 顺4B*)ٛT#:X2# lqYXV z <)3&+:bWZ]f my~{ tu ^yz{|}    &0%u vtsq2p@pHoQ]rYbqiqursu19vQ wxw(s/r2sGra]uIPgunuwx{Q~xer[N-"" vArIq_srvwxtft~veZL*Hs{MuMyL|UY~az_u^vcw|+/;-.+)Z}XSUTY~VSn4/s utro!p,o2n=n InA]pepiovqrsQuQuqqip]q2o'pput < "L&&N,N4L9P7R.V,U&R"RTJ2_:p *@x !*0;&'. 548 ?VO&~{  3 h ] QGNC= >IQWC.:!2=Y 92"FcEYDTEOGLLKPLMFN=L:L)DYR3Y"IRdDc:`6]5^0\,W+U-X,M9i%UBV8S5Q6U:O8eoq n enokfj"h'd/e1j2g=j!>cEfIjOhOfVc]iAJ90C)rjaylmknbK[AtootnmmfmVeMl?d2lh U)1r0w c VY[vw x @@>Zcr t v w  SA'b+4Qh?fJiLjTgZa[_TaL]MYJXDVGWOTUQQRZQ^ObKdGdEb K^A[D^Ea[+V)S RYRT%WPV[WGXKYSW^W`^N\Z^V\MZ^_X^c!^h!Zb\cedae[f`sAsHr_oaodmfjeoi-12*a˭uZvPvXw[z\{a|g}i@X`_begjmgfb\e'fS9*`XQXSIC@CKYN?:CI A M N P[ _ a h+R]cd e!c#d!a"Z$V'U"X [!O1d=*Q)G,T.V,A)<.C/Q1V2Q2Q2Z3]2bg1mhebfillm^KAGNVZ_dfsDtJtSuU B JNEO?fc__anh RTP!\"Yb_-D+R-V.M/TWIXQWYV]SYT\]O\T_V^X]Z[[f\e`dfaht\cXG{d~kx\vZhR7L K T\ɛ#\2J!jU2 |a5)$9fak;bR]SUUWXHZO]W_Q``d\k\sgvjxjykh|bgdnWb]h Y @0?3>?A?* =E.8ʜ'6&?$B&D(J)S*W([&Z)W(O%K"M GGC@!>"9458<>D=;<?I-*(.+-):2(Y326/A-;>qJlVkMlCn?r=m;k8j1l,q(t*u0w-z15K!ExA*|C2A4<E=?@AKS*RZZ >:QWBxC..(-0z,w)t'o kUqX\!]a1UQ PCLBK*T+I)N3W;G@O@5?@M@C6t5g6\:p:f9c9[7I6@7?5=5;?(:0677779284A4E)8;rcue9d``ձJSWZf [d1a0Y/U.a2)`#d%b)`dl[jlBl`i\I^_aZO&k-h lpp r,p@g Jl._mek$mkN|n o smrlMhȒgGt,n1n8qM7jȊ6 C14SbZcZuJIymQq Xl(]=%`>bCMfJhONOJMGRG[EY4+V0l4 m.o+ r. u271"I vIIc@GbGa@&Qh L&IEQ:kF0G4 G@EG"BK+@P"CW"+Z G!K&LHKEPDWLKZ2\9_h8Ie5c0nc*AkIkVM@MEIFI=H:I2CH.D,g?5>EbXb   OJ^gng Ǎ)L_#OZNURP[FlaQxU{ZBQTIYu>r;n;D:G7DF>^@^,BZY Q.(D*B$HN< eS iQLaO^G{W~` #m$UmUEZ_I`Z_d|V~f}nLjJYKPY@ZV/H0R/^0gSgkhqjtk)bDe>\=gn`mocbbo+r,j tu rc\uj#$C?E-Jm (r %j f M/)!E!+` D C 4 6&f"LY {RZ @P=@F>A3ASA PbR@DQ$D8CQBPQ9P#Q ,&**"x55}-s-w%@~%%%%%0-@-@-`5 555= = v=n=mD~DDD=__,[ [[]]$]+][[ a Y !] ]Ya[[,][ [[]]%],]_ __ ',(,1/`/==//==0//==//$/$==/&/./.=&=&/18]87=?=H=Q=Y=Y]>]@]-2=0=0/8/87:7:/B/B7_._<6$568=>DCLMRSXZ[&\7[Y]FWb)d\;U;M;C;;;4;`=`=`=`=`=a=f=e=cddclH@?GCC5L"* " * M &&%""cDTDGD?D2D*DDDDDbHcC[CX@/@^AfD^DTNbNGN?N2N*NNNNNcSTSGS?S2S*SSSSSYfY__eekkcN0dS fY qqww}}zwk1aJO|::8855334494e7.A.A6767/79A9BA?A@MDMETHVHW ;U L[OXN\PV LSwwTw[WkU<jDBjsLLJJKNL~DXwBFJJN~NR~RV~VZZ^^bfx^xZxV]VUONJV QNMKlWTQKkJcI`JJde@f@h;h3f/g$ihg hfgjh iji"j,i3j8hgf fgbd5b=d@cGb Gd@]3_*^ a__`^KQ PLM$Q*N1N9P:O9J0M%MKJKJM LO"N+O:NDF FDBD'E/D5B8C9H1I.K'L"J*I-G"JIG HIH<9 ;?@>#<9#<+>3=7<0B&AB@ BBA4 664.664. 11.- *./%.,+&.Q+/2160+0&221%jRi$(((5%9#?$H"K#&a)K>0$  &09;@DK9@KQ9+i!+-.K) #'-4L ? )   '/>I8I[eg0l0q0Gd ~BDETSTQRkkkk}_O_O]e]eZiZ857573355q\q]]iill::8849^i~_jq[ mZ54::;;9 kkll556 6 99 <@ A0 m@ m@h0 dc P,m@ Am@ Vm@ ZqkqkroroqqrrqqyyyyqqsslslnnsWrWYYr,<@ A<@ V<@ k<@ <@ <@ Rh6h6iRi68R867 64E4G6K6M4R4R7A6 97C>.>D>X@XoXvmvwCn.oo ol>?><@@qqpj @+@1@@@F@U@[@j@p@@@@@PUqFq@q1q+qq94yj shZZhhj\j \hehRMMIGGIMMRhhjWjXfjXjVkUnaZs') \iXhSWaXdgZfWZa[cn]wWxXo_ >% 8=9=K>_>u>=>Mo9n$ookres[p]i`hWaZ^\[_Yb]swXwXshfhigTThhhRRjYlbXf]uf[hec^eg`a\d8`r  ( EF4I6L4JL479Q97jQjYY9a9aYBY^aAaXa\ atUsSvRRSTVokZQQR~vssr j  gvgzgzh irisbsbr[PoPPPPZvZu ddcc"b\2^A]` `u h v|c|UR b"b9bAbWb[c!bdcLAMINg NrN|OM FAGg GrHi9j4m,o'p$tv{~o9p3t+x$|"y J/IN K~{* -E-M-X-c-l-&& A FFA NNS S ONS)S)NNAF)F)A3A3F>F>A>N>S3S3N=NSANNPbR@DQ$D8CQBPQ9P#Q QRRN OObY)RS)B"CBD`Q)EF BCD E3B;C>B>E:D3E>F>O5P3O3R>Q>SSNRMBa%$ '),'9(A*E*M*Jbc*jAl,c-X,Q-M,E,=-/*&,*+-%,#"$7"E#L!S#X#c%j#o$l"jr id XQ LE3 %!:(C&Q(U(9"0DLXeqw}meXLD:2$ -;ADLTXbo} rmfbXQKKD6 + # '6C /T1d0 -EjEfuuBjjBss-B-j/j/B-s-//sBBBgDgDBBsBDDsWBWclBlVnBn\BT`^fBRB\BaSU.XCUXFmKLdRCw.|}IEIEKKJEJNIXIVKNKNJVJ@0uuv N> & **. . 22 "     P 7 79@A0<@,<@A<@V<@k<@<@<@VmmEm0mmmffbb^^ZZVVRRNNJJFFBB $).38=BGLQV[`ejoty~EQDN1E1NEFEQVFTQfAuAAt\r^o`p_d[ax x w7yFyRxdrr{}gZ~dX &.8@IRW l [dmv@C[q jq pq q q r`z@s ls Ws @III,I0IAIEIVI-/BD W ln 0  q55-t-x%%U%VJ  ZWVXNNJJXVZLLLUUkXl[m_decaxii\f\t]whVgUY`ZbWfXhiZb_[dtz`wowkw gsdt[zgz@ozzizibIIKbKbJJIIKKJJ/@/88/`/88/`%/%88'/`-/-8'8//`5/58/87/`?/`M/O/`U/U8S8W/X8c/ e/e8c8g/@g8Ut et t0@x@fx@Vx V}Z}k}o}}}}okZVuxxx|xyxvxsxpxkxhxhubuaw_xZwoopkZZkkZT S0 ZkkZook7okZV]]^^qqrr~umuXukIoIIIIIgrsrsgggrrssrssrggwrvrvswsqgpgqrprpsqskgjgjrjsksegdgdrer_g^g^r_r_s^shPUh5h,hhhhaaZZTTMMFFF *F ,MMT,T,ZZa,a0aAaAZ0Z0TATAM0M0F ?F OaVaVZOZNTVTVMNMTF cFkFoFFFFF`cMkMoMMMM`cT0iT oTTTT`ZoZ fZaaaFZFaaxZFTEFEMhv}   v0}@@uuu,u0uAuA{0{,{{{{,0AA0, ,0AA0, ,0AA0,zE E E E Ou0O{0O O u0| 0PPPPFFF{Fuv "6*|F5r<&2r__9_A_Y_^[ [[]]$]+[0[7]]F]L]R[W[\_u[[ a Y !] ]Ya[[.a.Y- !].]9]AaB[C[UaUYT !]`84;6>5B7D5M7P5Q676][ [[]]%],[1[8]G]M]S[X[]]_ ___1_7_F_K_S_X ',(,15&<&C&M&T&6=CMSqtt5&<&C&M&T&l8qsqusTRNLDB><6$568=>DCLMRSXrj_ r j _ ` ` ` ` iP `   ssssjjj jb)b2bBbKbTdcddc&&&%""::8586788Q8R7S885533h3k k kk lli i^94_ ij4 &*+/48Y>[9]8_6`1`+_+_3]6Z8X>WATRR_OmMtJzFB=830+*("  -3:;!(-49kNkNll:X:X;;D<0qqyyyyqqmjAA< < AAggj'@@ @ C@)AE?VQ"+.1*3:>BY@8^6[8X@VLRbNsJ|EB")99a+h+q*y(w.u6p9b > 87al_t\~ZXVSOGB=5[Ae?m=t:XOYZbLiInER Rhhj j @hZZ[Z R T Thhhz.v4eB\P`>ieOS S W Ycdg EG3E4C4B3AGDHZHjB7>9@9j;j;@&@&j$j$@JZJ_=>@>>H>S>--(8L.Y8M=5<@<=:^.%^E ua ]/^>\HFP?MR>$@@$GH$IJ$MN#OTU#VW# 'G#G8G^<]:_7^2a/`2_6^;[CWOPLZK\dLjGnGsHqH&a˹ɡB `bc%c'e-f0e*c)`&b[`I3 )30!mWlbjci_gaf_daa``[^^\_}W%ɲYT£[! J<`") 1#:)+ кKҳ!RSV‘A!_'d`^bahblcm`}^bzixjfpJ1%CyS{[zT|W|UzQxOneQ` uitasVrSqSrMqPbWRQRRTT^_`rfrJtKwPzS_^_SZaXiWk]mflbjaebc^d &e!&i0h6jeEfOeXf(gWhVjbmwm-` m(` g5g g1d npp5g q.b&`1e3f5f-)AM9I[FcBdHe=!A<0$$Z`\X^RoJhWkNnMoNlXk_i\e]c^a\aWcR`Y]^[_hL{\a!*#1v_"x^${au\sTdc"!ilhdzZ2b:a<^?_A]B\CZEWI^H_GcIbJ`M`M\cN`Za]c`nSoPpOtZu_}[x[y^z`{cbdcgjffkgl{WyUxSuQtPP[8e>bMcIe_WcQdYfNl\kafftRw\xa{_}a_`cd%dc`KF;=< ; =><;;JMOKMJM@BPAISRLLK!L)M,L.L-J4J8I;J?JAIBJGJJIHI?ME G I K M NL@K?^>i?s>v=}=2`)>4B;A4A>@G@409$*- #F#9J!+326345576<4=2?5B5C7E5G6I5K7O5Y5+#$I#Z3)C~<:0"!==m6n/n(m"ljh$f ecb^Y#\.]5]NOPRUWY\^]RA!TSRQMM%N/N3M/L2KIKFCJ ^?j@r?w>w=9DRL$M-M0K7JAJIJRQa*^e-lwaQ_7g7q7IBFLf&(%"#7HO]nuy}~|xwu"&()('$!"*2JYjm|}}{yqponkA3jv!  'Gfrz#r~o|nuonpShKi;j6k3j'j$iYlZd[b)j%i[bZj[l]m^j^f^m_m`kamR5 OMP@Q8bZTRa - {UAVJAd=pg)tjs_r]rZR\ #3:;8mB8II:d9l:O<6D 7@7f6>E;k,7&9 7"+~"枣"fYXXY\`_"a ]Ge  ~} ^^]]]]_ \ \^^!`"`"`FcFcGcqpspsssw{{{}}}yyuuuuy}rpsw{QQ~  NMcc    MMLPPPP }}z{{|1CD' ]B `Q`#ba2B0g:hAgOfVfWgӤ3dA3̬/I*< n{-*}7h*g?e9f+b]^\uwecl{kx| uweceek{j?dw{9e7g+a*f\][bx|wcGd*g]_QQ?f_ ] ^8g6i  ~  %CA?$>m'D,B3E?DACF SPWPOMSh͂du9mIx)q0c lmtuyppHL|o47784 54#51564F5P4W6]5e6k5v6|56565656I5 656'4*60576<5?6H5I6P5S63232)362?3D4H3@2N3U2Y3^4d3Z2T4d4o3w43434343212~1u2n1f2_1N1D171-1 111 111i0/0g/R0B.;/+0/ 0/, .-(,7.D-T,_.j.v-,.-)+*p)Y*C(4*)( +*' ((#'1$C&R&`$l&z&$&!yhVI7 )!$"CP!X! %5?pg^O#06?HNZixv p d Z V R J A6 2 ,   * 6%7ETanvt@Q88::g==_=2=+==CsC2CCCC IIJ4IS4Š@NSfop|z|+&     zxusoqu | -0147@RVm{}{ytpmljha]  ! g I# ;>;=:974 52 . - +&" $,3 6 <=BEMUbcgmptx|  $&+-/37:@BK  %))!  +   % %         ' . .($ ! !"$"! !&+ -., + / 023430266%".!/('&"#4@IM?@:+%   ,OR U SS_  Y a h][^g\Y\`YUU_PNV G"A#J&5)) \ty || ~ ~yw{hkaW WdC4,'"((<30 21, !   Uft )-q«ɚ4# E,Iѫ  #%&+$unmoptrw|j!x$T0})mG9@5*,#8q|~,@>@V:!1"s9&);WbruJKI$HEIIHLJcKvLNNOPPOONM,MHNXPrSTTUVWYZ[Z[ZZXvXZWBW(X[Z)ZB\a]v^~`abcefghlnP+ <\9S!ldkRZRQQ{Q~OMMLxOrOnNpMmNcLkKkKlLlMoLsKf -M^MSLXJYJWLC -J,M` !+Ys[gZiYq[XZ@X7+ X' ZKLL K*L8L]MrO]^_[}YrZn[jUeYRXNX4X#YJ!K1JEMcLoOlPzR_\[v[cZOY?Y-Z :ٰ%"$!9D  #$&* ɡ  &B#+B99"-3038s;`ABFFEDB*=J5n0,*$"x$[%O*,-#-#+!(-'3$G"T fz!"v l!]"k-"5~4t6j7q=T=H?C?I>J6u, !h#W)-*)!z08fA:'='4(6(0.L1I9;"=?BDED A< 878 ;E-)3C ,K BA BCGH"HH G + .*/4/(1)212)/&2%5!"7#8,.I1.)0(/'6#5"1.B C>C $ &+ 4,;,-( $>HGI 8<E I MB@:877Z"!2I9U!)`1 I![Q:3Y!:1OF=8tOYJJnɢ! )!9)Qo)+^r!9Y_Aԩz \)I++ ,o$;}I":1Bp%0?y#Rq!-!xu2<#,q$i"* "`,'f3 ڝ+592H _hoqo|}~urqX~YJ;Fvkkjg Js>}QqVqWy_wtq}wehifjaVNH=FUwv ) #+(12)9'F2 \Z\^ _ )$BɴCJ I A @@ :K)3"3! )K,! $!W O"M!I!F"K YX3(+:Z\]YX [X"O'O%[ B ' &70B;4<SVXU!X)U&Y%X'K"G!M PG ```a `%`0:+^2]6]6\5\\\ __^_^*^)Z[[\ ml));1:$ҫC 0Kplsgvhwjylzk|j pirkvdzill10rmII omvl}qvpoqgpboanbn:ellk}f n *!)"+- 0*3* 7+<(+A#F$"N%,"*\!!- "IB 9":B99     #" #"')%*+/535 2(0%:=< IC?>A@B 8%7)9)G"IJ SQEaqp{!,* *1 -0021)")E-#G*@(:03-.0YzUsTgS_R\QWQOPGP@O;O7O0N/M(@J,>7;8;9:=9;E5Cə?80L)AP@MGNNNY1\OcN{QSZӣ[[1A2@:Ajcua_U^8S0H2G1E.D,C-I 86A ddcd)b?]+7@yjxWgURFQ9P3O.N.Vj^*E2D1I:F/N;;3684@2A,E1!./ !/#0*8/5D46?A!8GN4) ,P"R+R.V0S!%`_#`,b0].\+^)[*g1 *,h%2gCkl(o,r*u,x(x#s ru z |z#{&%!(*x#R@$1 Z,é)#$)BAE<BD=ED:P5O6P*T!V3f6f*b-]1j&ihst &3)'y|z{-+ 6>7@;??6E5C>G;6D9I8F4K>@>:O0T,V$]#a/e#f0jl    +!-057!85LFF>?>fD}DEgA,i1v> w:s/~;.:0/u3t0j.e8V9GDl6rAu?jGj;nHn9k9l8iBoDs8k7s4q?qHn1m/h:l0q;mF~=//53=;/.??D3FL?AG@684<:=4>F=4DMON2#cb$c(f(llm'o)Br(rLagL]KSHOJ|KOSb-Yb_u)Iv$suxki|!}#ˁ""!$,\'_,.]]$Q$NS* T. O1O,F;GB GJKM?6C/+? OC|J=~mHw Fq(Dq%Ut_wMb|vˁwygueEe+mW cL + 1 "M :@ > E LIP("c*`"k%mp,Iu,x#zO&\.S1Duh@||fHWk\Ğ] bg"k+x*"').vFizBEDFeE1a1e4m*y{}{bebIg,]U{nAC J OO3 2ZCCCnqgrkBInd-|n~q|fr|~TGbPIpQasiy }!!v#]02|!7j9a;WJQ9I@ PxNaY` \tY>L!ZS&B%A$O*)D!D!D!D!D!D!C,C,C,C,C,C,C,A8.KP%9 ;*CF ."6*+%^4'd8U6T?UCTDREE~-y5z,P8RCb7aAx2-}2~:OFDFV6U?VC]4_<_A/>.<.i= 8bHR PYjTr!t*&0 *2!A *!1#D !d١)J C>:c3:<>9CJQe4W`87@=DHFq9 2K ”}I* L гAKn1)|1+9*rFK}sI ZA-#_^_]d`__]][![%W,W4RCOJLMLOMOQJQLSJTNP[P`RdPlr ol k'i+i0g:h_8`/b,egb+`2`4_?\JZNZSXQVTTZS`db +)!2Sʪ *ijkjC1lTO!d-)3nVGP^dZj!a ^ ab_ՙ+-*ZUS cbPpSqRYOVRUUTWS\ZL[I_*a#bX;VAUETGRJ j!))*1-+*{z{}~ !     lhwRrOeaf_h^i`jbjkljmkolqm^]\"[(OKMMRaQ^SUb'c"kljhc,^F[QGQ Vk)#Zi9 ? BFILQRS Fy,ː9EY3'.KĖ49; N:04* R#Y@4%"|-<`)) =K- *M93,A *0"c YQNG@?DFBBCFFHKJNTRMLLNOQTQRURTXXYVZYZ[]`d_^ehlqniekpicabd`^[[]N"4 *c-lvpnqkgbJ@[YghkB@JOR=\-&ɫ}~|}uo ;1Xɪ: QRTR~PQOLLNNKIJJGFEDBA@?=̠{ =;8CLORTR]_fw|v} !+ +!51%$J++!>QP%' (*,(" ! ' &*, *-0 / 1 23647;9<>=> >@BA BEFE H I GJ MO PRPR ST$*4)%:#@*#*.0.02698<@@EIIMPST Y W\ [^Da[ Y W Q R RF 1 # 0B H )+;0$,9!=#=!- 5A- ; b*$0# 4  -q# 1%*TA)9:,u ` aX 0  C˭y{}|xvuqm`^ZWZ\XVSMMOONM<95-/.+*(7C*#[MM:1*)K!J4J >H)+#LE3j8Y2<1Z|}~7t^SON;;:9.xeEL  /!!"%#&)&'+-0020-.+-*)&%# $ "! !!%-/$49ʲ("! 67 A*l:gC)) 0l=l?jA73j<NH?L1BMILNJNIMIIKAL?MPOAKDKKI"#'%~*|(y*u*o/k1j0U7N9G=@=?<;<1?(B™ADC Eg d OM))M1n=j]Y@<>1?)?>$;)95697<8"54394=283+2%+>)*$'!5#;$@A.,@2D<C S7Q$N M2N7I;H3G&H781U,p&w$K%1/bYJl5&$#7 65:982U,3$I+!U$ADiJ^5%Jo -cJ,:# -uL1hD!I.RMPkQl/TcV[YY]`cggimnvtxxzz#gT52w^f1=30!IE zZ!Q1T?OEOi[j*Ykho@S  ]f\g[iANHMMK%Y"U4S;V1]+iLfInQjRfT`xoponn}vY|ZxKmCDCCN@m5s1,Q?J<,CT a.lN n hG02punMeȈ|Cj~bxOxHdyJzm n(2%4-M&fsF}r5lz2}0 vmE+gL FU W ]`|e#"y rv@{x@h&rvIh"n~o8C /L  n3 Oe~mYIOHVO_0-D(@%f%3k% )1"-;"JS"W[t ʋ #OXb9,#I+LznN|\~YVg|k~l}ozqsCw~qglƈhtcƏ,n*-QMJfGB5G4I-a"i&a8; A C K N 3bb ) 15 KO KJjgmmp ) 7C;@FAL<#Q<1{ۧ-_WaIe4g*i#lo#)1 yzhc2= 78-[]B|PR9;BG$ODNZ)o8#r9v5z4" ,K@H*4r\MYCH F EC&A*B8=G=R8h1l1v*)&&#!"!!^BlBm>lQH#LNPVVTS S&V*S+R.S0R=SEQRMSOQ\RdSdUVXP\V_X_[aaedhgiksoskken=n=l*k+ffgk&k%p$q#s$t*x46BGHK[imuxz{|sYY``YLEGP *GA) *\` ?]@eHeI_I\?\sdc`XRLCC;* se mve]OE> "%18AGOY .ksve `l`kaj`cYcTvTxWWTyRpMiHSH<0qHxHwJsJrI,57;<4ĻugXVSMJO@;3,)  $(-28:GNX^gospdZdpvwx~~|zyromkhigfc`^ZYVWWZ\]ZXVWZ]VTPMPSTQMOSTQOKIGGFGGH{FuGmFdG[FVGQGDH7G4I&HIH GHJ KL MOSTWZ]`a b d flq19#z{}} ~~  # DCBBA*A9?J=`;e;j9u9y66442024579;=?@CDEDFEEFzEuFmEgFbE\FTENFCFAG;F1G*F#GFE FE?!A?+?8=E=K=)4bfso2EN TD? +" 3JA"<^;c:k9p8y7}654321GB@,H%G/G6FMF\FjFwG}f|'SRQOVWZ[\Nq)&4$E#`!r)%&!B R[nLan>')H\iy!x!-ta_\^Z2t9 s!g#K#F"c tx_)gS; z9 y }#|"/IB5I=:75"\?@BDH&#;B:.$5D:>9"]TD/ 9;<= @>@ =432 .10 1('&#"!31 ="' %aB;1^Qgnla<,+%Yc!2:AJ)_Afnmi`^K>. c&I+D*8::H:!;3<[,32fKev+ +2!; 1ka_KPSA<1.S "uiAc=o=s?YPbSkUhXeWjZk]i]f`jclgiekfnjoljkehdlengokpdo^l[p]qczu+,~}mx "^xSw >p9BsQw^v[ylxjz}}paqeWg5d6c7`AbDgEx;m:s?e9e:`8^2g|u Hi/ L_OWLbMfOdNhOikkjdhYeTg]hche%djK`gYh^ichjfgog n[l9k5j$ji]^_ ffggg&h8h:9676547899 7/6D7:3F 58208>=<;?  & s tt 2VҤ8Z9P@U#e[ hV nPoYpMM[*AbW.#qXiZf[CVA[@^AU0P/_7\9\N^O\TZdZ W MEOPMSxB<&K=*;?GKKHKLRQ{BQR D,K2G,=FGD%J-,K#28E-&@F'BMDDEHHJOA*Y4+_;m@s tu}&$4;2<36'uoEhKIMDOC)JII MW`~*+*  ~ute a^jfRHEA@?<=62./ 0 (# " I"$!% )&)$-).2/61,3+;"1C!"I$+QQ"V ,*] _2<&-".+/0>DJMW[adc k #*'-J+&+"!-(,!*-,5+:)=,;/=092591"+B'#)J(!P*"R,S5W1[2X,Y&[$]$")#*[(Q4P+K.F,D-C5B(>'>3<7951=+7"5037-- 4,) k) ' 0 .,1/"2).+4+;1;27:4=,C-K,Q.R3S7T5W3Z/Y-Z(_'b(d* (%(#+*):*D%L%Q%d$k'+5;5 ;'=1@:9B;J3P:ZK`9[,b3m1m=F-op!q.t@v]wdvjwowwxhxqs s{tolZkLj=l\mej7i*i%ih2) #'+.l7@CBIKIO\bkquzˏ, . *J$'ON-I 1M HFGI}<~?Mx:Ȅ7C:AQOZU I-|J:~ma h(Ms%ZqetMlsTrCl R{UzW~E]~+c}j p|C{ 4z ,w%x"" ,,@0:@ʎ1vʊfpxbylI,,nŐa+wqq̓CgƐh<+no-o0f OqG{IamixsaaqVn*mbBJ+DbUDbdK7 +}* nJZg_m%m H)j,C,KɛV \ #d8 7"6,544>udrrIv0nq=%rItY""P=5/%"x8z9{L~cw{s|mwfsXqFp;q5s3t,v'ww4] !         ! % & ()04AISW^co  "&ZQM ]+Y)(      B  " % %#$ %'(*+,-02.++ / 1/  .ZF+  || ~wrp ruy<-'" ~zvrx{ |ruv}~} ~ .  %7J Z x yxX:.$ 1236A$ ;954"3 L,<),! N:#*< =+<ۡ:;' #  $)51:AGL ,)26 ,1&   ٪)L  P1"é2")  +(!%+$+/vs|vuz )l |~s~h|lzwy~wvwtrsqrtqrpiqXoQnVlYkDlGkDi:j9k;l6m0l7l8k:j8h@gLhXi`hai`ldlemgnmmpnumyn|morqtwxyz}*353},{/y*x*u!r$u$z!}-k 2*ѹ˰#!RAI){m#m8l{Hx xb)QCc K:|C xutӱy20)!:;:hCn q r$u$v$vʚx)u}~vwy P3 S \YW]aia_] d gl9 k^lW S Xrq x sxxpUbtjw yv u Q F  M ?97< D L P KG)# Q ]Zu>;peahukhjmjkpqvqqsv9<LIJ L O ] Ljilpmjigsrs  mmmѲ -\@Bu"3R | { z z|}4 | *|dsp03urq{} {pqqtspѩmmfndlal`k`hWiLh>g8h2k"%k bkh* :[ /:""ET - A%*d4 "$f aecb!k/i,h+f*e>SBSa!d,d@O/a:11e1)%5d8H<.BC=4:J8f6g4d1d4e7k3a3h7b;:<4=/?%@!ABSLRS\ 12[+13*9,0]&\[,QQO!N#O%N'PPOPLPVJX10([0\Q[ ZN!O%O/[*Z"XV $T)",":*");+ +A$1; )43%0-/'-&*()#'"&%$"! "  + !)!2)0%ʔ31,//"&<H›753*1005/E-M-Q7!LA:KH /8ޛ͔,-5 0 66"@+2:#.A )$*1+2#,!#',/ 2 ,5;<;.<«">5848:B>.=%: :75](C)P(N'A&6,J,B+9 -!9"A#N"N ?5G=F7 3? I V aCKYQ[ 3 < 3B 7BM0A1!A"JELNZ 9 I T39=DFM1B#2";(P)6/:-D)D6:" ))1I+J F E <7 36? G =)RT874)340C/Q?>#=$><9-998>7?8/6CGED"3-210?/G.L89 ;>FI?;.0Q1L8< ? G BHCFS9 *,++>,PM#M(J)K-H.G/F3G5E7C5A7B:?;>?<@@B:CG?DDFEC PJ=&<*@0=88B7G5I4L0S-T)U-W,X1VCA?M+O'HBCHBGAF@G@;5><8?C?BHKHKSQPV[MBMD5=C1-7,|"},z#vw!rw$q%y({-}4z0u/w2|5:>}9w8y:>D}@xA}BFMG{FKRXSNS|I|OwDxKqBtIoFjHhLoIqImMlQoLtKrOvLzNvPuSyP}RzTSXY\b]eb}[`x[t\y]v_sdx`yc{`~a|ccedgll)i|4{3>=~.")>!*b"da`acfhjl o qu vupnliefcbx!9_+1J2.:"K2: :!\B]:a6`3b/c'e%c&c"dd0k!9tb+a0SJLS:]]R))4: 9!d!+ $+I"zxskgfmeXWtZS&0=RJt9!I;I[uxe:1;uB*}#{ztr9b2@B+a*SSeZe]dcebh3):919@CZ#9l)jkbf@fJfcjpllll dd 9:!@+1)1+yG:|?95: ɡ;)<:!+J ni<* )!xbv]#ufmdq] F;<20 !5 \A!*+)=)"2 lbJWUM3',4/'! cdڒ J2I.A*2\bXjin^hb{Z|gklgehb]D16?1;=;QULIGAi^✡¿ mEµѥZTgFjDa?bRAQFPFX XWV%U*T,S.R5S=R@QB` _^([.Z7Y9YO>L:@2@b;0BD7CGHQLTMVPSSRVTYX\T_ScTeVjPkPnQoRqTtQxOzP|R}TRRSUSRSUXZc!`dee"d/d9e@gGiHjFkHlNlUl[namdnaocp]q[r^skrtrysrrttsponlmnnmkjheecbba`__^ mbT ZY4b?a@b>c=dGgNhOiKjTi[j\kajikjlhmfnhojnonronpsownynyowp{opzn}mm}lkmjvjxkk ukli_iXhTiRhPhJgDeDeGb?_ ?_9̙IR$ABB#T 3ɺ&"iL\T]U\Y^[_e^c^1ə+J )DaoS#ҡiIi_r^u\wXyV|VZ]^{a__``_U1£AjAJ`a `TRJQc Y*Z-Y1U-S2S5Q2O8N9L5J8J3G5F1C-B2A.>'<+;/< FcQKdVebfnfpg{fficAfDgJi?bl *H Wa Zi]jnlhnFdGd >C`]qUrVqXvWu[t\r]X~WZ[__gV/= 4!36CNY:Q0ia2'`:\Ga 0g_l`0@@``+<-=0>3A4B3C3=4>9CFBGZA]$D`N?V ,_ 1\ ZYM?OBXCzY~^w]WX1 \(X%kUh[Mo\ QVY]_E_+uZgV cZjj ~k znAd"` ``@`@bhkp&cpooIk"k QUUWmY[ItTxRzR4[ ࣲ |vrmf`]YWRIC?941*(& !  )B+(#$"-&4+=,E*L%T"[#`%f'n%t!z !&+-,+(o#²J%C#A!<"7&2$,$)!&""ܺ&)#2&h$(%j.67|6m8a7O8F8:7-9798/5 #))#%%%',)l2+7-@-BG*M'IR$Z$^(e(j'w |!"ˇ',,. ...-$|'Nu' p( j-s-|-G-e.[-Z(MS)M,CJ/V.+.&++-J-m , -(0%#.,0+&&,):/?.C/J*c-m,w'./ J%B*>';,-%!&,'n'x *f"$ #:-#&$J&f$f,e-e(o)* .(x",'/9~;r:c;H:,;:;JHI]F8G4F4FFCbBrCBA@[ZZr\h[ZZN[7Z!\ [\ MKzLhIVHIJ9I.H&I$H0F6E:;D4@1f+(k% "+|"|惆"xឆ {{z#{,|;xGxPxbSx[xIax,dxkxntxwxxłxxxwwɞv̜Cgƃvsnp-d^[fWLHGy5|+1~#{{ ||`dD(.8.AiDLOFVjY`gcjou}/ghĞxyJyJ|}Ghfurh~e~Y|T{My$JyD{iA{=|B/|$|%|C||,| {E{4 !#`#2! #)-29?BFHMV\`fknuwy! )+(#{"r&k+b,Z*S%K"D#?%9'1%+!% !&+-,+([a:Q0#;IB2!U%\#^!c"h&m$s$v!y""JRda\:&v#m&7$ (%5.67#628>7P8Y8e7r9798/5 #))#%%z's)lm+h-_-BX*R'IM$E$A(:(5'( #!"',, . ...-$#'N*' /( 5-,-#-G-:.D-E(ML)R,CU/I.t.y++-J-m, -(0%|.,0+&&s)e/`.\/U*<-2,('./ U%]*a'd,r%!&,'1'' *9"$#e-U&9$9,:-:(0)*".('",'/9!;-:<;W:s;:;JH IBFgGkFkFYC=B-CBA@[ZZ-\7[EZQ[hZ~\[\ MK%L7IIHVJfIqHyI{HoFiE:<2;8<];n<;YNZ[ZuL_(aO_bce:8=DE["h8 &;"%"I"&`&G(mJ%IP*,L.?1n31,."+%) 0l.y)Ɂ-̈2C,1g4?(R0eEn]D-UDGD;Ef0E!FFG EIFaCBiB!8a97h9?989G(Db8DbBDYE# ^\_O[J&^g9]B\S^^])j],t_C`˔_ɝa)Dm#8v(ul slv B&9IN|Zi陌뗧eL,D{n l.r~"s+ʆ'<,('/'-b^/3,I0'#^v\#n\de]]] H]?]6^+_#]] ]I^n^%_ϙa"D" BDE$F.E"-9DHDCPD[E2J *K*KKM K+M=HFGDNIVJO_J@oGsGwHa|HhI#bk_` ``+`#_` `%a`)a.b2ad7aD;a>_FaK_.OaiU`Za`bFebjjcpcscczcdɅcd/egehd _]J^J^#_G0` $hf%C^u$qipsWrBIv)%vC n,hbE(h8bMb(ek|f i~N`3I -U'i3p#I-3f(3-!344 53h3592ID3jN3iW5%j5p4az5@54+5j`4PPW]]%|~(~~ }%})|`1|I7|->|C|'L|R|IY|f]|-a|g|m{uyyyhxąxIxjwiv%vva@+j}(tpkgd ZVLH/D<5 1-& n4<@p{h{D]|Y|S}K}B{#>{9zE3z/z($z(zz{l| }f}N}N  $*a.5<@H NRVGaee(m*qFx|ijfhŸv"c9A&JTa)jmp.yb/ $) /srN'r-pm>qQqarlir(vn}qn m$}}e } }(}a$}+}.}2},5};}F>}&C}F}J|M|T{W{\z_zczfzaozrzvyyy+xexxwnwwhwcM{soeFbA]+URL IoB`?63D*'"$Kh  #.:DmMXaoAw 튏OhbktheYV SHDE*=:4f&C# QwWwNdrLkpwqzqLqcppKv@s!7p4p*prr qq4|  |vqkha[QK E?<1+(    (+,)}%s#j$a)Y.^*T(M$B#7&A,8)4$-"' % %'S" !."jb:"B!HQY`#f%m"v!$&$&$'|$x#l#Z%%7876567o8a7Z8W7T8Q7B709&7 87878 67bdgfca{^g`Sd9a"c_a 3c:;:8:v:[;G:(<;9CDFD_^x\b^I_0^_\]BBAC9Cu]^a [cZN[!Z[Z;$=M+ `_umPP^^%z'|||!y+yM3y<{iD|'K|IS{BZzld{lypywwvxz z#ydyLJ~wNm-i_[-SO`KG?;51A,(gA  B",&1@LDQ!U^b/fj|cC@Cnʔo~wf`RM@J<6e-'(*$ e  i&"*$6 ;,J}M\}`}mzrzFvzƀz˄{{Ȕ{GwSx sp(aHksh#b9mToD_oomnalyHjh] U7)- ) bd* 1|4|O>}'A}H}K}T}X}G[}a|d|g|lm{mp{s{dyz|zzCyeyy{{{i璌농~{x`qnnk,dka[KXbROIF'>L:730J-+)"&#a@  J#e&o/4/DNT Z`cntw   (+,)"%,#5$>)F.A*K(R$]#h&^,g)k$r"x z %'" !q"e"]!WNF?#9%2")! $&$&$ '#$'#3#E%%7 87656708>7E8H7K8N7]7o9y78787867bAd gfca$^8`Ldfa}c_a3c:;:8:):D;X:w<;9C DFD_^'\=^V_o^_\]BB AC9 C*] ^a [1-)-m !edptA2N-j @ f}K}>{k_x&g}z{!{ˑymyJxꚉb|wa^ZMHN1)N"8Lx$zd| |e|{}\zHFj# K#,o8Lr-:r,5rnw sdss4 "!}$y#x u%o&k!f_TOG@;2+'" "!   +-)&#%z,s-n)e#\"S%K+D-:,3)+%!&*,*'%Q[; !&& ##!&##"($0&9$?&E$HKN"S#X![!k&t)y'|($:RDJQ)v*l'U#P%!$5u'879m:\9L:?<);:< =<dfxhaeVaE_8a*f lnkg(h;x=b=RG-IAHNO N MLMFE.D8FBG]_a#_8]j^{`^_= >=G<.HM` [\?[`Z|\[=m>0> @?F GIJKKLMPP"NLJ3KHICHS=">?=<^?I"IGLM N OON5AK #. 00,,&+.+ 50.<1C/$M/NS* Y( c(l,s3G{0΀-+1M2ȁ&C5a4U3F7/9$6J7m: t(|%!n+jM8fEdRe]jlmxnEm+mk$ C{ yw i{YMv"Hk =o0z@t @h&&2I'"GJORZ]addkn"qOuHx/}dGBD.Ϛ)} ygl ` RdOLLCg?0k+n"H D.#/=@C O"U_kF}͂akn-L{~ygvm~/j~Z}S}J{G{EyBy;y7y$4y1y({${K{A{ zz(z4 " !"$&#' *%0&4!9@KPX_dmtx""!  +-)&#%%,,-1):#C"L%T+[-e,l)t%~&*,*'%ۻ !&&#|!y#|"w$o&f$`&Z$WTQ"L#G!D!4&+)&'#($))*3'J#O%~$j*'8 792:C9S:`eIaZ_gauflnkg(h;'===M<]==?>GrI^HNONMLMFEqDgF]G]_a|_g]5^$` ^_=>=Xo>@?FQGIJKKLMPP}NLJlKWI\HL=}>?=<^`I}IGLMNOONjAK #.00ˁ,,y+q+ j0.c1\/$R/NL* F( <(3,,3G$0-+1M2&C5>4J3Y7p9{6J7m: t(r%~ntjMgfZdMeBj3m'nEm+mk$ r .t 6{HHo"Wk bomq@v@h&y`IS"cG4m/I&O#cDi@gfcvbkiĖb p`D`":e+1c*c""bd"cc"i__^S^H`?EMPX!\chmvz +j)$#& -'0--3*<)@.D0N(Z&d'j+n0t1z/~*)+/0-)()2"#&)(%x$r&j)W%S$I#B&>*,,()#,H(t,C #.@,(@'h-&$1,25.I<."A2J2Q,mX+Ic+i1o5Ox40/D4@3f-U4k@8-3 88"2+787"`6:"9eAK9C@-BB A?vEQA$PNb+O@UISS,dOrVnUśRi{i`jFl0c \fh%C~g1|J^rƉyn-zG+fG"Ima#ax -3-1,17-bA1bK0[, f3s51O.J8g3}5d=N:)=:,"AC: 7@~=A%# Xdb(` 10.&1' / %.4& !y qlea`ZROG!C<72)%   +)$#&-x0r-l*c)_.[0Q(E&;'5+10+1%/!*)+/0 -)()2"# &)(%'$-&5)H%IL$V#]&a*s,9lB(j)|,W(+,\ #.@,(@'h-&{1s2j.Ic."^2U2N,mG+I<+6105O'40/D4@ 3f-J4k_8r3 88"2+7g7"?6:"9:AT9\@rBBʕA?)ENA$PNbtO_UILS,;O-VnUR i$i?jYloc\ɍf̟h%C~gn|UA-yn -%XtfG}I2a#ax͖-3-1s1h-b^1bT0D, 93,51O.J 8g3"5;=Q:)b:,}AC:˖7ɞ@!=A%#Xdbw` cOQR:X#U]h5oIUpnsy%Ϛ""iL1--&|3r2c3V0P,C(?,:446 p*`-N$;&6*@ / $-y.S*#*+#"+.#/{3r3c3`V1O.B)d?-D;559%/ $g/h,6);'J@ JO#T*G`-hp)fy.#+$*6.;)L)%R-2 2(& a1o.y1'# /%.$4#  #(,15=EHNSZdnuz (a)&!$!(',*6-@-E+L)Q$X"b#f'n*s)z&#"'()#y s n"h&e%f&V"MF!B'?)<':#851!/&(#&#ʲ"7&r%$ % "#%$( *i,-B,.%+C!((+,-/20E:1A/H/(O-T' [&d+j.`r.Iu)-|*%'#"I`$fZ)-U._2^,Ɉ+͐*h&ě,I,j$i2%w1i2aa3@W4L4C4+65j45)52(3 56ƕ/1 3#=<=/)<5@BB K=Z;faXGaEdAqA+uCexCA@nBH$h [c eM.cK^^cnm|iˎeŸfFzUA.t+dꃓ - .',!&71O-Z%j+p/'"' #!9-] l&r+*"Q( *&$&O *h"+b#!k9-P(] m&r+ !! "$*""')fj,Cp0#Y% M.62 '/N*L. -*(.#&9/R-]%l+r0## &,4# |wsnjbZWQLE;1*%  ()&!{!w's*i-_-Z+S)N$G"=#9'1*,)%&# "'()RB#& , 1"7&:%9&I"YKRY!]'`)c'e#gjn!p&w#y#+9EbYJ2"h&-%$z "#%$(*i,-B,ˆ.%+C~(w+,r/m0Ee1^/W/(P-K' D&;+5.`-.I*)-#*%'#"I?$fE)-J.@2A,+*h &,I,j $i2%(162a>3@H4S4\4+i5jk5v52(356 /1 3#=<=/va1ha!b\[g*U kqrGqleIl(h%*FpydNzi7|j-f~h c F&Ztʄ)"m.5bx0w[{{$|x)7@/NR.m4.~'lx.(n4e1U2 R6 F.=*65+9/!2A,- 1 383e& #&(**a0)@'K'U,,p-|&F#&),' #B@;vCdDU>aGG>E;A.A+*Ce'CA@nBH$h[ceMqcT^Ac1m#iefF%UAqt+; -.',~&h1P-E%5+//'" ' |!f-B 3&-+*"N( *&$&O*h"+b|!kf-O(B 2&-+ !!  "$* ""' )f5,C/0#F% R.i2'/N*L.-'*(.|&f/M-B%3+-0## &4 DRk-$).39AEILPTW_!fjpv{! 1/ )%%!((.0/:,@(H-R0e.s)w&|"!$*,++$x$s!l g"a(\+R(O$K E"A&:'7#/$,(&)!&! $&(++7(' "- 4L6c'!,'//3!52;/A-F0O4X5a3i1'r.|*ȃ&&)M12i0'+Iy-Bu.lx245r1j6a8E8 >4#95d-7 54 :.L5;J2:v8N5#-FC=-&D2J`?CI=TA_CrF}CA>>gBAh>JŊIuN\OHN:L%RBNP& J$]Lgr!k\.b/4j?iM_cZZCgg@uoC\^pn{_?Yof^g%w1t1J e' *=PvS@.FeZgsx}ih"$ ,"M. 6< 9F:#323>9E/L2U= `=a;c9(m3an1k}0h/9b9;Dt<#2R&Ga&D((C+M(P$T Z"^&e'h#p$s(y)~&! $&(++h( ' "-4L6c'~,x/p3!j2d/^-Y0P4G5>361'-.#*&&)M 12i0'+I&-B*.l'245-156>8Z8 a4#f5dr754:.L5;Jm:)8N5#-FC=-yDmJ``CV=KA@C-F"CA>>gBA7>JI*NCOWNeLzRBNP&J$]Lgr!k\qb/kj`iR_cEZC8g@*oC\^ pn$_`YofAg%ϟÚwntnJe'*bOvL_qYeE8,x" i7"$ ,"M.6<9F:|3m3a9Z/S2J= ?=>;<9(23a11k"0h/9b9;D+<#mRyGayDw+!6;;*H!((+',$0!*+, ".,8*D? J!"P%\*i&Ku"h|*% %,x3`3H2?,m/1+2K*T/A\- f)u*|)O+h'#b #k))*. . 6/C%Dn)*p%.'#f%Fk+3-:CF S$YuC}(=aUknh}b閣DpKUNa>N0NH2?hC NM)_ a#V<)k;|6b6˙6dJ= =8+62+<'D!A+_)j'p%p.,/&(+% `%F4%!"r"r-k$o>"D'(*"&"1,`B-p&n/,'k-$?"K4'bF(F`%r!'l&Ls-o (*J"+#" &4(>&D+F!_)j&q$r0*-%&$) >-'iW4 Eb  &*.3 7 <@GJSX^elorwy{~ *(<-$5":%=)E(K#S!Z&f(`&l#q z"! ! #( }tmh"c$_"\WS M!ó骳+%$(P('2"7"Z#e$i#C JʛMk I^@X/iI)Q%V&F_*jj*q"x&c#ɔ!/$g)hy,l,^/JS.JK.D-G9/h00f'' ""(#'$ )'i)})Br)ˏ%X*CM&,,+,ED@TIhJ(JΒ: z@zjgz`[IT-Oa'~I|f-ur\nQ]͇]h`ě#I\WjlXi}T%8o9aW;@J89706+4j4?$c`(TeSyr{Ɖot tb/KCPNS b=NCo=;40n;BD{JjC\=Z6I"D1F,C7P66# 41E86(=t(AeF@lGs]}fivN|gNu} "#y'm*aj&](X(R$I' B,:,4(G,'e+-('*$F !!&i *j,f-h42'3c=3H5&^6`6x6)4m3.+bk1T.#;ALF$YFlD)xDB/BVN}VjXmWVNT$Xilmv(yx ` RP~"?_/DmADz<2Ae6M 7( 4a..D&?-(8'A-I(N%!'&#$" :"/"B)J$O!"""n7)-)h(c!M'%$6&$O!J$B)F:"A."+# o"` ""/&9%B-I(O%%!%# ,5?j?c:U/H%>#34j ~rla]XPNEA8+)%   *ZL!$("/%6)C+M)P%T#Z$_)g,q(v$~$(*-+%#%*"")0#7":="E KSa"ikq!{ $#! * "m^W^R~JvIrInEhHYEU>O:G:C:< 89-1,.!**5 30-,:=;CIY_ْR@.VPJKBz:];V5M4A2:+5*0",+,!.'0(2*8.=0K/V2b1t7{9548=: 731.-.27 9>=?--, K"-'/)01 +%,'-).. ")9-#5,0)'&!&l,)?,I,BP&V%I[(c,l,r(x''{,u-ˀ),+. ).&&$'N. - ]/R/G0G<021- ,M"&C,2. &V+#<6JD8mN5 Z5(g4%s1~2M2đ79s:`;R>"U QyO@lU\U@Q]hLo&_oheIyd"^fpmzIoesO⊥"Dps@}|fkySx XbGM"J+IcK"_bn"A/K/U(]/l/v*ʁ.0ʖ(.5,)(b97Gk>nnli?i?h @ h @ k ? l ? k > k;W<W<V;V:U:U9T;T=UBTCGDFCFACAA@RIRIQHHIJ O I!E; @)<!*:[]` f3!t)f !]__``aabbccddeen0k0<! O#< XXVVUUWWVZ YZXY*X.Y3Z8YDUEX=VEZ)[1]4\=]D_E[FZBV#;"k<GDEEIHIJ LKNNQN RO @:-ú<L"g i1Kl 1)ha;T*81:@B[4iUCY`ZUTA*#F IM DT *[ dAfICJ#E BE L QNPLMSQLNcMOQT!TT@FB:F:IKMQLXO`NgLnIoEkBgBe?`?`@e@`AfA`BjB`CkCcDmDdEnEeFnFnG`GmH[HlIZIjJmSlElSkGkNlOkSjRpPp)qQq)rSr(s+s't)t'u'u&v&v#w#ws8sAt:tH sDsStMtSuOuRvRvQ W WX XY YZ Z[ [\\[[Z]]^^__ ` `a^^]``aabbccddeeffgghhiijjkkllm"mn$no#op&pqq'rr#ss tt uuvvwwxxyy$z&z{#zz{{||}}~~   _ :^`^j!"=TMJB ,QCADIIJ HF DF77'5-3/33152;3@3D5G5N4P6R4T0T/Q-T'S(Q+K*E,C*;+8,6,-+)(&' ) ! 5 66(5'5+4*4-3,3.2.231*140'0R181S2>2S3E3S4G4N3O4S5R/P/).Q.)-S-(,+,'+)+'*'*&)&)#(#(,8,A+:+H ,D,S+M+S*O*R)R)Q H HG GF FE ED DCCDDEBBAA@@ ? ?>AAB??>>==<<;;::998877665544332"21$10#0/&/..'--#,, ++ **))((''&&$%&%$#%%$$##""!!       @ $A?A53*ʝ %!*2DKѼRJ1!ۦ"!3  3I3, CP*-֩- 4 5 + ˵ʭE H K+ 9;:895a+ 0@Ż0+>70.27(ѹ0J#% L0#/-+,03F1 &46 0- "  & 1*)a%04?+>e<;;n/)'-1/A.K/O1S1I0G1E093O3G)&33.> )"";39ꚣ+R+#"+) *! hcM  F A +  )o-`7B(D"%#7K=hCD GG!9;FmKJJ  " ( 5 A G5AE % 60'(*J"KLK J$H(G)D$BABA A@K LMLOPTR!V$T,W5W>??@@AABBCCD; 6 ** ++!,,#-- .. //!-%%&%1&*&.'*'.(+(/),)/*/*1+1+3'6ei1 ddab!b,d0d8e:e?hAm=o6p)u$rut trq2q.rr!s stt,s1*t4ppo9on>nm@m!l@l+k?k*j?j)i>i'h>h:g#g$h#f:f#e3e"d!c#cj!mmllkkjjiihhggffeeddccbh=JQVg i"j ei dNIAKVH ?  EJ*               !'C0B۝E@B.% /2 4-& %) . 0 +*,0 5 /-@#C # 2*/4(/ D %1% ' # Ν13C $(" # 2)(5#++' .[˝D9I       *$*R,ڭ 71Y< #5h/n%rsMo iip'iI#Bl5;+ $ #d (,/ %L$ 4 J7!N-!-)`,(  .A1+g(A+& ! ()k"kmlkj i'jjk kPP4 g$ifb_][WWX#U&U*X1[1^.`4`9\:ZAXG\N`RcKfCkJlCp@tDxIxB|<}?{D}HJFEGKLIHE?:7:511("  mCmMlPlZk`mdmijniugwgvbxjwkymwnsowsytxsvwyzxx|vzwxtvttgves\sWvSyO~OLK}MJ~J{MyM{FzDxJrMsDdJiSjJlMlGsI.iHhPhGgFgNfEfLeHyE {HnBm\l^l`m]mbndoBnSoUnrodotpApwqBrDrHsLrQqhqwsxrwr]sus^tdtfudtktvuquwvuvwwuwxxuxxyw|wmumjlnlwkwknjvivsQ_L9ҳ* hiiFjGjkFkllBmmAnn@oo@pp?qq@rArssBtCtuuDvEvwwGxxAyy?zz>{{=||;}}F~~H|D H%I H F H K J KKKKIJI:IBGE942001&.(h hEg gCffBeeEddGccIbbLaaN`_/_^-^].]\0\[1[Z0ZY1YX/XW-V)V&`:`Q_:_Q^:^O];]N\<\M[@[KZCZJYFhrbqWrUsTuUwRxPzO~R[dgkqnwy}yxurs|qwrwsstytzr}rzuuv}vwwxxyyyzQzjyjxfxfyRyaxTxcwVwevUvhuUuhtUthsWshr]rQ{{P||P}}P~~RTxy|nW]ojglyPty {v]A%9 5IZFC*ZC.jGʣJ#}BA+.t8{:$w4Nl= k? h>c>aAGc*`)])aMȇC~0z8J6m8 6(5%35M0Ă.˄27w6q6Ep3+m7k0 i2h3 j3 g5f6d;"b9 l5k/@m6n<@n;ho6&ed$`$I`!"c ei miIkkjOkkjDg @f!fe&d+kr t tt"s +tw "xx"ʆʃb"I%,(&n6ň66ņ=@BY|]yb~h|Cn~z~gzƅuy~asnXt-S|oCmZncmlkrkvqRr[qcsfrlstwwpvonpek"Jmuz|u}xuyjydxkvyv|whwixyxlPsP4 7$962/-+''(#%&%*(1+1..0409,:*A(G,N0R3K6C;Js?wCyDxCvGyJxOxLvJwHtFtDgFeC\CWFSIONORLRKMMOJNJKMIMKFJDHJBMCD4J9S:JB=\<^<`=]=b>d?B>S?U>r?d?t@A@wABBDBHCLBQAhAwCxBwB]CuC^DdDfEdDkDvEqEwFuFwGuGxHuHxIwLw=u=j>@??@@@?AA@BABCCBDCDEEDFEFGGGHHAII?JJ>KK=LL;MMFNNHOPPQLD OHO%PIP QHQ RFR SHS TKT UJU VKVWKWXXKYYKZZI[[J\\I]:]I^B^G_E^9]4]^2^_0_`0`a1abb&b.c(8 8E7 7C66B55E44G33I22L11N0///.-.-.-,0,+1+*0*)1)(/('-&)&&0:0Q/:/Q.:.O-;-N,<,M+@+K*C*J)F8r2q'r%s$u%w"x z~"+47;A>GIOTUY[`a}_y`x\uXrQsLqGrGsXsZtItJrMrJu[u\vMv^wOw_xPx^yIy^z!z:y:x6x6y"y1x$x3w&w5v%v8u%u8t%t8s's8r-r!{_{ |_| }a} ~a~"]$ZXUHSIQL>'-?:7D,EHGD$BC-C"AA@@F#+)H+B?4*D""@'49:ı=!JH-1 $6 K,š6JILI2I1+a˱K49 2PUP &)'0<ú #)AKѰ12&@*ѫ28 =9=<@BD@?@=>?:E:ZF><@Pi<#)A #= 7;7"l6(<$@(BN)P(IS%Z^[1V,V9Q;PDUF,\B[? F>.D8K:$G4N<= ;? 8>3>1AG3*0)-)1MVWCZ_RNP0J8JP6mQ8 V6(W5%U3Q5MR0R.T2R7G6A6E@3+=7;0 9283 :3 75664;"29 <5;/@=6><@>;h?6&54$0$I0!"3 59 m9I;;:O;;:D7 @6!f5&4+kB D DD"C +DG "HH"UOOQSSVUSPTTbT"SIV%,W(\&nY6X6X6V=O@PB)|-y2~8|C>~J~gPzUu\yS~1sn(t-#|?C=Z>c=l;r;vARB[AcCfBlCtGw@v?n@e;"J=EJLEMxEy:y4x;vIvLw8w9xIx*ZJיZ :#@<>2=-!%9KI6H>IDK@O?RCSAP;Q:P3U2U.W,U'P%NS!VW%Y'[#]_` b!d%h(g"ddhieca_][_ ]\ YVX VO OLNQSVX\__b5@6U5W3_2l3q1y1~02579=;:l;b=^P"  G>6?G?6@F@7ACA9B=EBFJG@G8H8H9F9FEE?W&%  &;)      <|G}I|RTRTRK>:0.&#}#|,}0|0}}~0~0///00#1&R+RRQQ8R9R>S=R=PiD/15639  6>6J7>76V65Y54]43s322w13n3f8>89?9;::w:g:>;a;GM>I?L?I@K@HAJAGBHBDCDCD 6> AJ<)E(=(F'>'J&?%A%B&F&K%G%K$J$L0G01G12F23A34?45>56;67<78<89=9:;:;9;<7<=5=>3>?4?@4@A6AB8BC9CD8DE8EF7FG6GH6HI5IJAI?I:J?JK?KLLaY`Z_\^^YMMMRPT L L?MM>N!N>O$O>P7RBP2P&Q2Q&R2R'S1S'T1T(U-U)V,NNOO PP QQ R R S S TT UUV VW VVWW!XX%YY&Z[[\\ZZ$[["\\ ]]^^__``aa bb cc!dehed " 3D\#0NYZ Z[[ &BI2/-Ƥٙ(=#A]=C=*'7j-B[8/.3--+,'1$/(/*+&-#-(++'-!.),(..11=* 9+ + !< =?ABCB?==>!>$=# >??@@AAB;&»aK9!2*IY<*9%A4=ˠJ@,"P>N6O.M4I5I3L/N(L*I2D3A.E0I/>->*?"@)B-D+H,K)F+A(U+ ""D2$,C#͝C KSTUNRUWXY#Y!Zb]`be#T ٺ9a JܻA@FMKPU[]]UJKI F <&19ʕjNҲ+L,4+( '* .0,,)'(+($$&)*'$"(' %&,I,%! ! "( ',84=:;9;: 9;<#mF&B"dJ&F/A,C4-e0,)')B3B68i97GB >UYVX`) -n.,5,k8*;)K<,b>-?+B.F0'H-L>->0+B-DJ1B+5<"59+(a.,@/-+,+ -0 3 J6 8D eEoGJ/MOjST+@('%"C))A"(B(C'777361G*% H!.l5>?~ELMQ08<:31956P=P4 B;;I3Y9;!<2!>*ZJיZ :#@<>2=-!%9Ks6r>sDu@y?|C}Az;{:z32.,'z%x}!%'# !%("   y yvx{}_@`U_W]_\l]q[y[~Z\_acgedlebg^fUgOlJnCo:m;kFiHfHeEe<ZI![V]L^I^E]J]G\N\H[I[TZUZRhP"  fFf:gGg8hGh6iGi6jFj7kCk9l=oBpJq@q8r8r9p9pEo?&%  P;)      f|q}s||~|~|uhdZXPMI=:;@}M|V}Z|Z}@}@~Z~Z<`Ja>a`V`_Y_^]^]s]\\w[]n]fb>bc?ceddwdgd>eaeGfRfIgNgIhMhIiLiIjKjHkJkGlHlDmDmD `> kJ ?? @@ AA BBCCDD EE FF GG HH II JJIIHHGGFFEEDDCCBKKLLMMNNOOPPQQRR8Q#Q8P8P9P1P#O0O$N$N0M*M%H,P3SS7TT7UU6VV6WW5XX5YYGX7XGW9WGV:VEU;UDT=TES>SER=RFQ>QJP?OAOBPFPKOGOKNJNLZGZ[G[\F\]A]^?^_>_`;`ax!x>y$y>z7|Bz2z&{2{&|2|'}1}'~1~(-),xxyy zz {{ | | } } ~~   !%&$"   ! " ]D#0x  PBI2/-ƤٙR=#A]=C=*Q7j-B[b/X3W-U,Q1N/R/T+P-M-R+U'W!X)V(X.[1g* 9+ + !f giklmliggh!h$g# f!f ee dd cc bb aa``__^^]]\\gghhiijjkkle&»aKc!\*IYf*9%A4=ˠt@,"z>x6y.w4s5s3v/x(v*s2n3k.o0s/h-h*i"j)l-n+r,u)p+k(+ ""n2$,C#͝m u}~x|#!#~ ٺ9a tܻA@pwuztus p f&1cʕjNҲ+L,^UR QT XZVVSQRURNNPSTQNIFECCGLRQ OP,IVOKIF DCGKF J J LRJQVb^gdeced cef#mp&l"dt&p/k,C^-eZ,S'SB]B`8ic7ql h`S WnX,_,kb*e)Kf,bh-i+l.p0'r-Lh-h0UBWDJ[B+_<"_9U(aX,@Y-UVU WZ ] J` bn eooqt/wyj}~U@RQOLCS)k"(l(m'a7a3`1GTOJHF!Xl_hi~ovw{f_]Z\be\_a`PgP4 ?204&SAATB)4$ )ɜ:B>?CA> A?<@C B EJKIEC@=53-.(# >H[ a!o }#"$%'!}sf\TPHD H !)PGCOBPAR?S @ N A C C M F>)H" J"R#M$K&N'K'J&L&F%K%E$J$D#L#B"O"C!K!C I AH?G >>= =<<;;::998 87 76 65 54433223344511011"2!2#3#7%0 0//..--, ,+"+*%*)G)(I('C'&D&%C%$A$#@#"A!= =!A";"!;! ; ::96554799?=>@A@>= > ? @ ? ? >><;IIG43 3 2 1. $,&-)(    :D>C?C?JAJBICID G C E*)*E+)+F,H,F-H,C,*-A-*.B.*/*/+/-/C0.0D1B1/2/2B4D3@3?3<304=4162445;566;6878765)@@A 3%& +'-(. .(/!/(0#0)1$1)2%2)3'3)&"!!  ` o v]R:B<<==778<;u" "{bqCZBV@BF2< (2*:-90=1=2?,:*>(4%6!-$8':)@)D+A.?1B3A2-;#!(.* %#$# -5:6=9 ; 94 974738 4 - 251*233I/> %042/+&-11Z1 #ө #% #'&#%"% " D !5)<3;= ? =?<)(0S,$IF*%Bí   Z!  T&[D   T$a+j1<0 2. + .0+ ' ,-& !   $  !Z1= :8 5 6 !/0%#.0B,/&!L!&/$)-/*&'cC @C64 n/9o=2379J 9 7e(9'*<*-?%! $$e00/)i"$  ,M# ' F+/)". ., /(1akh bD  a &.H%*h%' %*&1))5 ,607)!2-bd O'< C;B7<@7C<F;DMB@LAD[frveVN% {qhwMU\gn tne_TI -587:<:30+$#+#-$8263:$:&;';':(:(6%67752.   `9 G+42l'"&"##PP4 204&SAATB)4$ )ɜu:uBs>r?qCoAm>jAf?d|H}[ao}~yvppsts}ussft\rTrPrHqDiH !)qPqGpCpOoBoPnAnRm?mSl@lNkAjCkCkMjFe>)}H"JRMKNKJLFKEJDLBOCKCIA~H~?}G   "!##%  "%GICDCA@A==A;;;~:~}:}|9|{6{z5zy5yx4xw7wv9vu9ut?ts=sr>rq@qpApo@on>nm=ml>lk?kj@ji?ih?hg>gf>fe_C^?^C]?dJdAeJeBfIfCgIgDhGhCiE)E)FHFHC*A*B**+-C.DB//BD@?<0=124;6;886)@@A %& '( (!(#)$)%)')~~`ov}]}|R|{:|B|<~<}={={z7zy7yx8xw46-8:@DA?BAy2-;}~~zy{!y(z.z* |%|{{zz}#}$~#} x-v5r:o6q=n9l;h9f4k9n7r4s7u3q8l4j-l2p5t1u*r2o3`3I/>i%f0c4^2\/[+\&\-_1c1]%Z1gifc`_f#ɛSa%k#o't&u#w%r"o%l"hD 15)c@>> = : 0FQEQFSG T G R G R F Q M I IRSooppquv v w w x |}y iT`UUX^Y^Y]Y]] _ ]Y c`@#)P,UCV Z b g i #kdp u {ňĊ MDIE n= %8="3"K P FC\_ -cHhqv e| Ʉ *4bJM9L/J5q sts u wz{|}|    "#)% %*4610('(%*/6AB>G:7400640/.054220//69-:/B1C5@9B'%&''&'(),-'/)0*1,1/5' YYYY))bcklkkj ji ih hg g _9 qpppoop pq qrrsst tu uvvwwxxyyzz{{||}}  #rr y +|h|~ DO@ą"a !k'#(+'#%08@`:2d d]DXpqb .hin oFwjzc Ƀ/ghĉ JJ#~*G'h(f'273.$*,i@=B7^%[CVT,Z_Ea\4=%1͹F̯&. ,+, * (%$ #"#    "#)% %*4610(' ( % * /6AB> G :7400640/.054220//6 9 - : / B 1 C 5 @9B  ' % & ' '&'(),-'/)0*1,1/5' @P@0 =<43445 56 67 78 8 @ .///00/ /. .--,,+ +* *))((''&&%%$$##""          #-- & +#h#! DO @"a !k' #(+'#% 0 8 @`:2; dBDG/.= .7i1 0F(j%c /gh JJ#!*G 'h(f'273.$* ,i @=B7A%DCIK,E@E>C4d"˺D ګWZUU PL KNMPNJGG C A ? A@=9 87 533/- -( &$ "!  cdO]P]P^O^N_]a_aa b e !YNZNYLX K X M X M Y N R V VML00//.*)  )  (  (  '  #"& 6K?JJGAFAFBFBB @ BF <Q #)O,JCI E = 8 6 #4d/ * $ R[IZ nb %gb"l"T O Y\C@ -<H7.) e#  *45v$ 3 ++} #+25:) $  "   # + 25:<?AGJP.0-*( $   ))((&%%$$%%# #       !!    #  $  & - # 0 ' 3)5*5,7.8/90?1C/GZfowx _iwZ-R\A5aEIʛ@YRP/C1:;2 B #83f.(( G%I$a""ia!b+b9> BHMOJ"g  ! !8h@DIJj6i3%*'a @+j(  4 " m 31111111112111233333333333131313131313333 32211111111122333333333313131313131315 312222111211111122333333331313131313155555 322222111112233333333331313131313131342 ] {u32B2223Q221q11q11q1q1q2q222333332222232B2223Q221q11q11q1q1q1q111333121222111121132B2223Q221q11q11q1q1q1q222332221111232B2223Q221q11q11q1q2q2q222333333222232B2223Q221q11q11q1q11q111333321222111121132B2223Q221q11q11q1q11q11123322111111112 321C11A12Q2A11q11q11q11q111AA1221212121212121212121C11A12Q2A11q11q11q11q11A1A2221212121212121212221C11A12Q2A11q11q11q11q111AA1221212121212121212121C11A12Q2A11q11q11q11q11A1A12212121212121212144 |b211112211111111111AA1221212121212121212121111221111111111A1A12212121212121212122211112211111111111AA1221212121212121212121111221111111111A1A222121212121212121444$ O; +=8E 655A446421qqq11q2q2q23343231322121112 645A4555543q1q1qq22q333343232112121 7554A4565444q31q2q1q12q233333112112113233 6654A5465544q31q1qq12q33332321121112123 554A5465442q23q1q1q13q333334323221223 644A5565323q1q2q1333333331222121112 645A4455543q2q11333323321112111111121 61554A5465543q21q2113333321121112113233 7544A5565443q2q1q1123333332112111123 645A45655112qq1q13q3334334231112236OW 222A122A21443q313q11211q24q33232223212233222487 444A343A342q13q43q322132211233244554 !332123A33A33444q43q11124211122111121211121 666A566A66513121252443211111123213466 444A111211A2121q23455433432111222131341316676 !55333A23A3444q44q43q243443232333132213454 33323A1213A131444q44q23q4333443332112123141414231DzM444A344A1454q424q25r541q414244438181818191:2:494958766665241524151211222AqAAqq11qq341221121121349594:4:291818181814344424141q55r4q2424q544A1434A44;<6462736261766676778q65q5217q1717q88616A656A66252424222131415151535462615q166r42q424q5791A:::A:;992616114211423213211323245qA6qqAA13qq111111221211;<;::A::91A754q4242q6r65q161625453515141312122242425666A566A61887q717q15215q68q776766676162736264<;4% o yK Aqqqq Aqqqq Aqqqq AqqqqB qqtqqrAqqrtArwAqqqqqq qssqrArqqrBqrutqqqqq qtsqrArqqrBqrutqqqqqL6q qqqrtvqqrqqAqqq qrrqqqrtsAssAqqqBsAq qquqqqAtqsAvqArqqqqq qsqsrArqBrqqurtqqqqq qqqtrvrqqqAqqqq qrrqqqrtsAsqAsBqqAsq qqqqurtAqqvAsqqrAqqqq qssqrArqqrBqrutqqqqq h  Aqq Aqq Aqqq Aqqq@ \<@ @ @ @ @ @ @ @  3G qqq qqq qqq qqq Y qqqaqsrAqAqrAqsrrqqsqqrrqq rrqaqsrAqAqsqsrrrqsrrrrq qqqaqsArqAqqArsrrqqsqqrrqq rrqaqsArqAqqssrrrqsrrrrq4  y0211A1123211q11qqq1122221212122112211A1123211q1qqq11112222121211211A1123211q11qqq1122221q1211A1123211q11q11q11q1112211211A1123211q11q11q11q11121q211A1123211q11qq11211A1123211q1q14g  c@[Aqqqq1AqqqqAqqqq1Aqqq1AqqqAqqqAqq1Aqq1Aqqq1Aqqq1± da Aqqqq Aqqqq Aqqq Aqqq Aqqqq Aqqqq H* 111 11 1 11 11 114^ !w. Ew':F  Aqqqq  Aqqqqqq  qqqq  qqq Aqqr Aqq qqq qq       A  A      *I r222111121 r223214 11112213a q3213r22r5r32s3s25s4r51u3q5s251s22222r135q531411132111811 q256r31r21r22s12s42s4r23u3q51s415s2152r4221q32511121641112121 q13232r6r5r32s3s24s21r6u3q121s2152s516r441q61222411162111111Z;H qqrqtqqrqqrqqrtqsrqwsrqqqr qqqrqqtqqqrqqrqqqrtqurqxqsrqqqqr qqqrqqqtqqqrqqrqrqrtqwrqwqsrqrqqrqq qqqqqqqrqqqsqrsszsrtqrqwrqrrsqqqqqtrrqqrq qqqqrqqqqrvrqtrqqrqqsqqtrttqsrsqsqtqrqqrrqqsqrrrrq qqqqrqqsrwrrqtrrqqrqqrrtqsqrrqrrqqrtqsqtqssqqqrqqq qqqqrqssqwssqrrtqqqqsqqqrrsqrqqqqrqqqrqqqqqqsqtqqsqqr qtqqwurrrqqqqtqqquqqsttqsrrrqqqtqqrqqqrqrrqs tqqssrrrrqqtrqsrqtqqtsssqqrrqtqqrqqqq qqsqqrrqqsqsrtsqqtrrqxqqrrqtqr qqqqqqqrrqqqrrqqqrqqrs qqqqqqqqqqqqqqrs qqqrqrr qqr 1]Bs rrq$ tsqArrsssr! qrrsrAtutssqsqqqq! qqrqrsrtrrAss|rtssrqrr! qsqrwqrtuuAssrrxvrrrq qsqsqrrzuAtwrvsszqqrrrq qqqqssrqsrssrqArtqsvqt{qrsuqrsrrᇑrqqq srrqvssrrurqrrsr{ur|rrrrqq sqrrrtsqurqᒃqxsr|qsrrq sqrrqrsssqsᔂsrq srrqrr rqq vQ  Aqqqqqq qqqqrqrqrq ÑÒqrAqqqqrqrqrAqBtsqAsqArr qrAqqqrqqrqqqqqqqrqBrqqrBrvq ÒÒqsqrrssqqtsrvqArusrsuqx sqqrrqsrqrqqqstuqxqqrByqrxqsqqxuq ‘Aqrqqssrtssrqqqwrrqqqyqqqqqrqsqrvrs qrqrsrqqtssqrrwrrtuxrrsqsqstrr sqqqrwqsrqvtsssrrusqxqquqqsqrqrr qrusrqtssrrqrqtqtsqqr  ssssqqsq qqrr45?/Y! sqtrrA! srrAtrrA! rqtrrA %B]A 79??2?7?:5A 57<??1?:8A 84?68?:?2A 8?:2?9?: oaaaaaacaahaAAAAAaaAabaAaaAcFcCaaCcAaaaaBccACcAaacAcCACaaAaaqqAqq AAAqqqqqq X AƒAAqqqqq  ‚Aqqqq  AAq  BAqqqqqqq! AAqqqqqqqrAqqqqqq! AAqqqqqqqqAqqqqqq4"  KM&OBOBrOAqOArOqrOqrNqBMqMqLqIqKqIqKqHqJqIqIqHqGqFErDqqDrCqAqqrAqqBOFqOEqqODqqODqqOCqAqOCqAqOBqOAqOAqOqOqNqEsMqMqLqKJrIqqHrGqrFqqDqBCrAqrqOLOKrOJrOIqqOHqrOGqrOFCqOLOCOBqCqOAqEqOqGqNMrLqqKrJqrHqAqGrBFqDqCrAqrq OHqDOHqDsOHqErOHqFqNFqFMrLqqKrJqrHqAqGrBFqDqCrAqrqOIqOHqOGqKJrIqqrHrMGqrOFqqDqBCrAqrqOGsFErDqqrDrCqAqqrAqqBOEqOHOGqOHqOIqHBsArtqqrqrAODqNtDqNsEqMqFqLqHqKqIqHrGqFqEqDqBArqqrqrA{ZGONqMrKsJtItAGtFqrDqqqCsqBuAtsrGqGqAFrBFqIONqMrKsJtItAGtFqrEqqqDrqCtBtAssFrFqqFrAFqIONqMrLsKsJsAIsBGsFqrEqqqDrqCtBtAssFrFqqFrAFqIONqMrLsKsJsAIsBIsBGsFqqEqqqDrqCtBtAssFrFqqFrAFqIONqMrLsKsJsAIsBGsFqrEqqqDrqCtBtAssFrFqqFrAFqIONqMrKsJtItAGtFqrEqqqDrqCtBtAssFrFqqFrAFqIONqMrKsJtItAGtFqrDqqqCsqBuAtsrGqGqAFrBFqIONqMrKsJtItAGtEqrDrqqCsqAutrqHAGqBFrBFqI :sqqqqAqAqqqqAACBqBAqqAqAABBC uEuCyBttBrrAssArrArrrrqrqrqqqraqaqraqqqqrqrArrArrAssBrrBttCyEuEuCyBstBrArArAsArArArArrBrqArqArqqArrbArrAaqqAqqArqBrArArArBrArAtBqBsBstCyEuEuCyBrBtBqDrArCsArDrAqDrrErqDrqDrqqDrraDrrDaqqDqqErqErAqDrArDrArCsBqDrBrBtCyEuEuCyBsCtBqGrAqqGsAqIrAqIrrJrqJrqJrqJrqaJrqJaqqJqqJrqJrAqIrAqIrAqqGsBqGrBsCtCyEuPABDAAAAABqAABqqAqAqAAAAAqABABAAAqABqAAAAqAAAAArAqAACABACACAqqAAqqAAAqAqAAAAA {t)qqqqqqqqqqqqqqABA)DDDBAbAqbbqaqaqaaqaqaqbAaqaAaqAABBaqaaaaAAqAbqaqaaqaqbbAACaCaAAaaqaaAAaBAaqAqbaqaqqaqabqaaqbAqaB&BAbAqbbqaqaqaaqaqaqbAaqaAaqAABBaqaaaaAAqAbqaqaaqaqbbAACaCaAAaaqaaAAaBAaqAqbaqaqqaqabqaaqbAqaB+CBAqCqBqBqAqAqqABCCqBqBqAqAqq4lmE *Fa rqrrrqqq qqqqqqqqqqqqqs  rrqqqrqrqqqqq qqsqrqqq  qqq sq qqq qqqqqq F{ qqqAqqqqBAqBAsCCr qqqqqqAsBAsCCr qqqqsqAsCCr qqqqBqqBAsqCCr %@X; 79??2?5?:1; 57:?>?:4; 82?66?:=; 8?:?9?6    ACEBBAAqqqqqqq  ACEBBAAqqqqqqq  ACEBBAArqrqqqqqq  ACEBBAAqqqqqqq  ACEBBAAqqqqqq4 Kb 7  qrsssrssuttqqvrvrqtrssususutzvsqvsqutrttrttrstrrtr qqssrssstrvrvswtvsqvsquqtrsqtrsqtsqsurstqrttxrwv russsstqstqsuqsqrrrrqqsrsrswssstssqutswsqs qstssqtqrrrrsrqssrsq qsqvrssqqrturrssqqqsrrsusrtutvt qqrqqtsr  qqqqqqqq1111111 qqqqqqqq1111111 qqqqqqqq1111111 qqqqqqqq1111111% !r"r"rq$rr!'r!!!(r!!!&&q!!!!&#+!!&"a.(abb,&!j#"$a$"a!baabbb! 111112114122751::291Q5Q12321RQS1S421QbUbW41RQQQbReQQT1USQabQRQQQQ4 ]5+!1"$$#""!$"!!%1!(!!$$!1!$"%1#'##!!$'#2%&%%#!"1!#!!#%"!&!1"!1)$""!"%$"$1"'"1'%%"!"1&$!"#""""!!"%1'&"!!$!#1&1#"!!1&""!"1'"!"!"#!!"!!!!1#!1"!""!LEBGHBF,'!((!'+((#$*&#%&"&#+!$$!%)+##(,%%(-)'!',)#&'+!**&-**#&.**/%*+/%++/%+"(/%++/$+,/$,,"/$,,/$,,/#,-/#--/#--/#--//"//"//"//"5+&1##%%!!%#!#'1$"&!"#!1"&"#1(!$"!!#!!'!#(&""',##!1$&$#$1"#(%%"#&!"!%1$!&#!%1&(1"&'%'$!!&3#1#%!%##%%1%!'%%!$"#1$!"!"&#!!1#$!#!#$"!"!"!BFGGGGF"/!&##&!!/""$'$#,$$#'"$"/!&'##/!))/!**/*(!)/)!)+.+),!.,)$'.,),-,),-+*,-,+,,,+"*,-+-,-+-+-++.+/++/*,/*-/*-/*-/*-/*- P////!//-//,//'#//.//,//!#!/',NOL///////!///!//,//)#//("!//$!!//"/%!+HOOD/////////-!//.//.//*//+//'!//#/!&+!DOOH/////////-/////.//+//,//)!//#"*-&&!OGOD $?Y<)/$%+*OGOGD<"/%/$++OBOGK</$/$++JOGOC</"/$++EOGOGP!"$!!!!!"q!!"qq!q!q!!!!!q!"!"!!!q!"q!!!!q!!!!!r!q!!#!"!#!#!qq!!qq!!!q!q!!!!!+#"!q#q"q"q!q!qq!"##q"q"q!q!qq4 I xi " bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb" aqaqaaqaqaaqaqaaqaqaaqaqaqqaqaqaaqaqaaqaqaaqaqaaqaqaaqaqaaqaqaaqaqaaqaqaaqaqaaqaqaqaqaqaqaaqaqaaqaqaaqaqaaqaqaaqaqaaqaqaaqaqaaqaqaaqaqaqqaqaqaaqaqaaqaqaaqaqaaqaqa" bqbqabqbqabqbqabqbqabqbqaaqaqbqbqabqbqabqbqabqbqabqbqabqbqabqbqabqbqabqbqabqbqabqbqaaqbqaaqbqabqbqabqbqabqbqabqbqabqbqabqbqabqbqabqbqabqbqaaqaqbqbqabqbqabqbqabqbqabqbqa p% " aqaqAqrrrrqaqaqaqaqaqaqaqaqaqqqaqaqaqaqaqaqAqrrrrqaqaqaq" qaqaqqaqaqqaqaqCrcrarcrqqaqaqqaqaqqaqaqqaqaqqaqaqqaqaqqaqaqqaqaqqaqaqqaqqqaqqqaqaqqaqaqqaqaqqaqaqqaqaqqaqaqqaqaqCrcrarcrqqaqaqqaqaqqaqaq" aqbqbaqbqbaqbqbGgbbgaqbqbaqbqbaqbqbaqbqbaqbqbaqbqbaqbqbaqbqbaqbqbaqbqaaqbqaaqbqbaqbqbaqbqbaqbqbaqbqbaqbqbaqbqbGgbbgaqbqbaqbqbaqbqb)K qqa a zxxz4  lA< x~z}qz{yx{ryv}txv{rwstusq wrs< ruqqwurxsq|qvrqu}sqs{r}qyqvqq < ws{yyuysqtuzq}s~|qxy tt< u|t}qs|srt~~r}|q{yxt a% |tvvqwqqurBrqEsADqqqCCtqEBuqG }xrq|qrrsqqrrqqqtqAuqCuqEBuqG vyszqrssryqvrqssqsqrrqCuqBABuqG |vs|urtrrsrsrqqssqDrrqCCsqEBuqG _= tyssrtrtqqqrtqsrqqqrqsArqqDAqDDCHH ttuztqsxqqtsqrqqrqrrqqqCqDABCHHrztsr}u}rqqqr|qryssqsxrqqrrtqqrAqrqqqDqqqqFqFBqDFCHH uxvturrsrsqqxrruqAsqqABqqBqDqDGCHH4 G553qqqqqqqqqqqqqqqqqqqqqqq qiqa1a1a1a1aqaaaaaBBqcAAq AAqBBqq1111qAqaqAwBAAAAAqCOJAAH/3qqqqqqqqqqqqqqqqqqqqqba1abcb1cqa1bq1a1b1ab1c1aBDFHJALCMBAA1OAAB1OqA1OqAqqq12qqqqqqqqqqqqqqqqqqqqqqba1abcqb1cqa1b1a1b1ab1c1aBDFHJALCMBAAOAABq11OqAqqqq:2qqqqqabqb1aqaaq1a1aqqabb1aq1aaa1aqA1abBcBcD1aqEaFFGqGAJK1JKKL1L K1L2Lq2Lqr121KBBqsqq:.qqqqabqb1aaaqq1a1aqabb1aq1aaa1aqA1abBcBcD1aqEaFFGqGAJKJKKq1LqqLrqqqqq11Kqrqqqqq98abca1a1a1c1a1a1a1c1a1aB1aB1cC1a1aD1aE1cqE1dFcFbGHqqHqIqIIqqIJIIJJIJ1JJJ1JJqsqqr2Jrqqqq11Jqqsrqqq:5abca1a1a1c1a1a1a1c1a1aB1aB1cC1a1aD1aE1cE1dqqFcFbGqHHqIqIqIqIJIIJJIJJJq1Jrq11Jqqqq4e 4444333322221111 L988Ac9Ab8b9Aa9a;R;QR;R;Q:QQ:R92QQ244Q2161991:===1=1=2=2=3=3=q3q<2988Ac9Ab8b9Aa9a;R;QR;R;;QQ;R:1QQ92Q8442637372727371=1=2=2=3=3=q3q<2988Ac9Ab8b9Aa9a1;R;QR;Q;Q543>422?2211?2111?11?111?11?11?11?1?āA<ǂ1>AA1?1?111?3?1?11?‚A=āAA;21AA:11AAA81AA824AA1?1?31A?33?42?5131>733=;=;?:1..?2226734911;4254118123113624217115152261426;618119116154;14333821:24651:53623322116231197237>52>1152711>43111121?>326114=421>191139?61321;?21311:1?51342?3323212?13523?2112123?<2632?11111<1?381?91621?7631<361=5141113>8312963424232321114113415111261224411124112122139717112512952912691151:161541438?62:5712:1<6>2112624m qqqqqqqqqqqqaaၑqba1aaa1qaaaBbBqaFsEAAADB qqqqqqqqqqaaၑqba1aaa1qaaaBbBqaFsEAAADB q񔁑qqqqq񒁑qqqq񓁒qqaaqBabaAeBs1Bq1ABCADAC qqqq񒁑qqqq񓁒qqaaqBabaAeBs1Bq1ABCADAC qqqqq񑁑qqqqqqq񓁒bB11AtBBBG qqq񑁑qqqqqqq񓁒bB11AtBBBG qqqqqqqqqqqqbB11tABBGB qqqqqqqqqqbB11tABBGB "9R bqabbacaqc babqbacaqc bqabbacaqc bqabbaqcacw0 0 rqqqqqqqsqrqqqqqqqqqqqrqqqqqqqqqqqqqqsqsqrqqqqqqqqqqqqrqqqqqsqqqqqqrrqsqqqqqqqqqqqqqqqsqqqrqqqqsqs4  @x qqqqurtAqaqvAsqqrAqqqq qqquuAqaqtAsqrAqqq qqqqurtAqaqvAsqqrAqqqq qqquuAqaqvAsqqrAqqq4.* j b53qqqqqqqqqqqqqqqqqqqqqq qiqa1a1a1a1aqaaaaaBBqcƒAAq AAqBBqq1111qAqaqAwBAAAAAqCOJAAH/3qqqqqqqqqqqqqqqqqqqqba1abcb1cqa1bq1a1b1ab1c1aBDFHJALCMBAA1OAAB1OqA1OqAqqq12qqqqqqqqqqqqqqqqqqqqba1abcqb1cqa1b1a1b1ab1c1aBDFHJALCMBAAOAABq11OqAqqqq:2qqqqqqqqabb1aqaa1a1arabb1aq1aaa1aqA1abBcBcD1aqEaFFGqGAJK1JKKL1LK1L2Lq2Lqr121KBBqsqq:.qqqqqqqabqb1aaa1a1aqabb1aq1aaa1aqA1abBcBcD1aqEaFFGqGAJKJKKq1LqqLrqqqqq11Kqrqqqqq98abca1a1a1c1a1a1a1c1a1aB1aqB1cqC1a1aqD1aqE1cE1baqFaFbqGHHIqIIqIJIIJJIJ1JJJ1JJqsqqr2Jrqqqq11Jqqsrqqq:5abca1a1a1c1a1a1aq1c1a1aB1aB1cqC1a1aD1aqE1bE1baFbFbGqHHIqIIqIJIIJJIJJJq1Jrq11Jqqqq4 . 6Kb6  6  6   6   6   %7Gqqqqqqq "*qqqqmqqqqqqqqqqqqqqqqrrqqqqqqrqqrqqqqqqqqqrqqqrqqqqqrsqqqqrqqqqqqqqq"cqqqqqqqqqqqqrqqqqqqqqqqqqqqqq1qqqqqqqqqqqqqqqqqqq ABB1qqA1qqqqqqqqqq ABCCCAq1A1Bqq BFGGqBAqA1Bqqq GCqBABBqA1Bqqq EBLBDqqq AGBJBDAA :p AFGEDA AGBJBDAA MACDA AGBGBAA4  <k 7311A11AA1ABA1ABA1111 731AA11AA1ACA2BA23 31A1111AA1DA1D1111 31AA11AA1ACA2BA234P9_k !"##""!a!a"" $e&d%e!$g#h#h$b!d(c)b(c #c#""d$!"d$!!e$!!e$!"d$!!e#!g"!e!a!!e!a!!"b$'# $#"!!!!!!!!!""""# !!!!!!!! qqqrrqqqqqrrrqqrsqqr  % LLLLLLLLLKKK LLLLLLLLLKKK. KKKKKKKKKKKK KKKKKKKKKKKK. IKKKKKKKKKKK IKKKKKKKKKKK. KKKKKKKKKKKK KKKKKKKKKKKK4S h Q >).2q4q5qq1qqqqq1qqqrtq1rqrr1qrqr1qqqqqqqq1qqqq1r1sqr1q2qqqqq1q1A2rAAq1q1A2qaB2q1q112aB2q1122A11A31A121AQ3A1A11q1AqQ3A5C111BrQ34AAA?A111qA1rRA21rAAr55A11q1qQA11qAqq2C1qAqqqBAAAqqqDCGCCGBACIDB1OGCA1BLEA1ODJB1AHEA1OCM37F6D4C.2q4q5qq1qqqqq1qqqrtq1rqrr1qrqr1qqqqqqqq1qqqq1r1sqr1q2qqqqq1q1A2rAAq1q1A2qaB2q1q112aB2q1122A11A31A121AQ3A1A11q1AqQ3A5C111BrQ34AAA?A111qA1rRA21rAAr55A11q1qQA11qAqq2C1qAqqqBAAAqqqDCGCCGBACIDB1OGCA1BLEA1ODJB1AHEA1OCM16F5E4D3.2q4q5qq1qqqqq1qqqrtq1rqrr1qrqr1qqqqqqqq1qqqq1r1sqr1q2qqqqq1q1A2rAAq1q1A2qaB2q1q112aB2q1122A11A31A121AQ3A1A11q1AqQ3A5C111BrQ34AAA?A111qA1rRA21rAAr55A11q1qQA11qAqq2C1qAqqqBAAAqqqDCGCCGBACIDB1OGCA1BLEA1ODJB1AHEA1OCM15BC6D5D4A  77a7b7b8a7b7b7aa7b6a6a6q6q6a51a51a51c51a1a42a2a41b1a444333322 77a7b7b8a7b6a6d65aa5a151q51q51a42a42a42c42a1a33a2a32b1a333222211 76b6b7b8a7b7c6a6d65a1q5a151q51b42aa42aa42a1a41a2b32a3a32a3a3222111 98a8b9b9a8b8b7aa7c6a6aq7a61q61b61aa52aa51b1a5b2a41a2a41a2b433322211 :9a9b:b:a9b9b8aa8c7a7aq8a71q71b71a62b61a61b5353b544433322 ;:a:b;b;a:b:b9aa9c8a8aq9a81q81b81a72a71aa71a1a62a2a62b655544433<;a;b1a1b?a2a?1c:6b:6aa:5d:4b1a94aq1a93cq1a93a22a92b1a92a2a82b2a83a2a86a86a87777766:8:8:8:894a493c2a192b1a2a193a1b1b95a1b84aqba1a83dqd1a83a1aqae83a3qd83a7b273b7a37:c7:a7766::::9999984a684b585b4386b32a84a2a31b75b1a3b732d2a1751ba1ab752abab74qe67qab681qa::::9999988867871489751378q752q3q72a3a372c4qa65b1q2a63sa1q1br1q ::::99999888887777766713a3a3b2ab4b2b1b4a4b1a5b3a1b3c3bc3a1caa2A1aaaa2aA1aaaa1aAaaaqa1a1aaq11aaqq1a4b3b1c4a4b1a1a3b4ab1a2b4aa2a3b3ba2a4b2a1a1a1b7b713a3a3b2ab4b2b1b4a4b1a5b3a1b3c3bc3a1caa2A1aaaa2aA1aaaa1aAaaaqa1aaqaa1a1aq1qaq1a5b2a1b5a2c2a5a2a1a1b4b2b1ab4a1a1a2a1b4b2a2a2b8a1b713a3a3b2ab4b2b1b4a4b1a5b3a1b3c3bc3a1caa2A1aaaa2aA1aaaa1aAaa1a1aaqa1a11a1qq1b4c2a2b3a1a2b2a2b1a3a2a2a2a2b1b3a2a1b1a1a3a1b1b1b:b45  Y/"b/aq.c$&ca#c"f"ci"crhq"cte!bq"cte"q!cte!cre!ce!bqbd!crfq!!c"rc!b&qb"c(b!b)b!a*a"a(a!#a'b!#a&a"#a!&!#a(!#*/"b/aq.c%&ca$b"f#bi"crhq"cte!bq"cte"q"cte!cre!ce!cqbd!crg!c!re!c$rcc'c!b(b!b(!a!b!("a!b!'"a!a#'!b!a#'!!a"&!"&/"b/aq.c-ca%&e$b"g#bhq"cre!bq"cte"q"cte"cte!cre!de!cqbd!brfq!b"rc!c%qbb'b!a(b!!b(a!!!a(a!!b&b!!a(a#!'a#!'a#)/"b/aq.c-ca$&e#c"g"bhq"cre!bq"cte"q"cte!cte!cre!de!fd!cqcbq!!b!rcb%c!b%c!!a&c!!"a'b"!"a'a#!"a'a#!"b&a#!#a&a"!"a%a!!"%4o *CJ31a1a1c1c3b3a2a2c2c2b2b2a2b2ac2q1a2qq2q2q3a3a3a3b2aa2a1a1a1aa2a3aa3aa3a31a1a1c1c3b3a2a2c2c2b2c2b2a2a2b2qb2qa2qa3a3b3a3a3b3a2a1a1a1a1b2a3a31a1a1c1c3b3a2a2c2c2b2c2aa2aa2aa2aq2bqa2qc2a3a3b3a3a3a1a3a3a3a2a2aa2a1a2a31a1a1c1c3b3a2a2c2c2aa2aa1ba1ab1aba1aq1a1aqq1bq2b3a3b3a3b3a3a1a2a1a2a2a2a2a1a2b1a31a31a1a1c1c3b3a2a2c1d1abbba1c1aa1caa1cbq1aq1aqa2qb2a2aa2a1b2a1a2a2a2a2a1a2a1a3aa3aa4aa3a31a1a1c1c3b3a2a2c2c1d1ab1ab1ab1aba1aqa1bq2aqa2qa3a3a3a3a3b2aa2a1a1a1a2a3aa3a31a1a1c1c3b3a2a2c2c2b2c2aa2aa2aa2aq2bqa2qc2qa3a3a3a3a3a2a2a1aa11a2b3a3a31a1a1c1c3b3a2a2c2c2c2b2b2a2a2qb2qb2qa2q3a3aa3a1a3a1a3a1a2a2a1a2a2a2aa2a1a2a31a1a1c1c3b3a2a2c2c2b2a2a2c2ac2qq1a2q223aa3aa3a1a2a1a2a2a2a2a2a2a2a2a1a2a1a3a1a3b1a231a1a1c1c3b3a2a2c2b2a2a2b1a2ac2ab2q2q2r2qa2b2a1a2a1b2a2a2a2a1a2a1a3a1a3aa3aa4aa3a4 (In!3C1C1BA1B1A1B2A33q2r2s2s2qq2qq2qq2q2q212222333222111233q3"3C1C1BA1B1A1B2A33q2r2s2s2qq2qq2qq2qq2q22222233333211122q3"3C1C1BA1B1A1B2A33q2r2s2s2s2qq2qq2q2q222222222122212222q12"3C1C1BA1B1A1B2A33q2r2s2s2r2r1r1r1r1111‚22223331212121121121q312!3C1C1BA1B1A1B2A33q2r1t1s1rr1r11s1s11122222112121233q43!3C1C1BA1B1A1B2A33q2r2s1qr1r1r1r1r1s111‚22223322111q233"3C1C1BA1B1A1B2A33q2r2s2s2qq2qq2q2q2r22222233332211q223"3C1C1BA1B1A1B2A33q2r2s2s2qq2qq2qq2qq2qq222223331212212122q2212"3C1C1BA1B1A1B2A33q2r2s2s2qq2qq2qq2q2q21222222222122221212113q1312!3C1C1BA1B1A1B2A33q2r2s2qq2qq2qq2q12q2q2222222221111212334q34 *Nt'!211q111322222222222122223332221112333"211q11132222222222222222333332111223"211q1113222222222222222222212221222212"211q111322222221‚111111’22223331212121121121312!211q111322211111111112222211212123343!211q1113222211‚1111111’22223322111233"211q1113222222222222‘222233332211223"211q111322222222222222233312122121222212"211q11132222222222212222222221222212121131312!211q111322222222122222222222111121233434 .[J!"!A!Aq!!A!#""""""""""1"!""""###"""!!!""#q#""!A!Aq!!A!#""""""""""""""""#####"!!""q#""!A!Aq!!A!#"""""""""1"1""±"""""""!"""!""""q!"""!A!Aq!!A!#"""""""!²!1!1!!!!’""""###!"!"!"!!"!!#!q#!"!"!A!Aq!!A!#"""!!!11!1!!!!!!"""""!!"!"!"#$q$#!"!A!Aq!!A!#""""!!²!1!1!1!!!!’""""##""!!!"##""!A!Aq!!A!#""""""""1"1"""‘""""####""!!q""#""!A!Aq!!A!#"""""""""""""""###!"!""!"!""q""!"""!A!Aq!!A!#""""""""""1"!"""""""""!""""!"!"!!#q!#!"!"!A!Aq!!A!#""""""""!"1"1"""""""""!!!!"!"##$q#4 wm7q  A  A      A  A  A~dY6  A  A      A  A  A  A c   A  A    A   A E'y b]  AqqqqA Aqqq A  AAq  AA ! AÑAq  qq" AÑAq  qq" AAACAAAqA  A Aqq" EBBAACAAAAqA AA A AAqq" CCAqAqAEBBAACAAAAqA AA A AAqq CCAqAqAEAACAACAAAAAqA qqqq CCqAqAEAAAAACAACAq qqqq  ACAAEACAAAAq qqqqqq ACAAEAAAA A Aqqrrqq4t B{ 61262835442613825 35221635473861735 35716837435612523 52831624453862126 :i?32=A261A2 21qqA?4q?3qA261qAq1 qAqA12BADq?4<131q2 1AqqAAAqB?4<131q2 1qqq 1222A1223333q34q44q44q4332122121222222323221 2444A3445532q123345q5555544141414142515151524343 D44412121211112122334555q55q55554441414242415152525q25252427L44444333A2334444q44q44q44q4444433131313132414141423333 s 2a1cebbbaa1b11a1321q1q1qqqqq43177 2a1cebbbaa1b11a1311qqqqqqq43177 2a1cebbbaa1b11a1121r1rqqqqqqq43177 2a1cebbbaa1b11a14221q1q1qqqqq43177 2a1cebbbaa1b11a1q1qqqqqq431774s-Ersqr qtsqqqqqqrqqq qsuqqqrqqrrqqrqqqqq qqs qqtvqrwrqtqqqsqqqrqrrqqqqqqqqqqqqrrqqqqqrrrqsqqrtabqqqqacqqaaqqbrrqdqAqaqAqrBqrarAdqcrBqbqcqqAAqir1asB q1aqqAAqqqqq11sABq1qqAAA1rABqrABAsABAqsABAqqBABqqBAAABBAABCAABBAAqACAAAqAEAqAAAAqBBAqBqAErsqr qtsqqqqqqrqqq qsuqqqrqqrrqqrqqqqq qqs qqtvqrwrqtqqqsqqqrqrrqqqqqqqqqqqqrrqqqqqrrrqsqqrtabqqqqacqqaaqqbrrqdqAqaqAqrBqrarAdqcrBbqcqqAAqir1asBq q1aqqAAqqqq11sABq1qqAAAq1rABrABAqsABAsABAqqBABqqqBAAABBAABCAABBAAqACAAAqAEAqAAAAqBBAqBqAiErqrq rrq srrqqq q rqqqqq qqqqaqqaquqqbqrqbqAqarqAqbrBqrarAdbqrBbqqqAAir1qsB q1qqAAqqqq11sAB1qqAAA1rABrABAsABAsABAqqBABqqBAAABBAABCAABBAAACAAAAEAAAAABBABAErqrq rrq srrqqq q rqqqqq qqqqaqqaquqqbqrqbqAqarqAqbrBqrarAdbqrBbqqqAAir1qsB q1qqAAqqqq11sAB1qqAAA1rABrABAsABAsABAqqBABqqBAAABBAABCAABBAAACAAAAEAAAAABBABA $1AqbAAaqaAAbqAAaqaA 3[qAAA1aa!a1q!aqbqbqbqbAqAA1aa!a1q!aqbqbqaqcqAAA1aa!a1q!aqbqbqbqbqAAqA1aa!a1q!aqbqbqcqaqAAqA1aa!a1q!aqcqaqcqaq +LkqAbbaqaqbqbqbqbAqbbaqaqbqbqcqaqAbbaqaqbqbqbqbqqAbbaqaqbqbqaqcqqAbbaqaqaqcqaqcq,,rqqqqqqqqqsqqqqqqrqqqrrqqqqqqqqsqrsqqqsqqqqqqqqqqqqqqqqqqq4  Pj tursq1qqr1tq1qq1trqqt1qqstrst1rt1qqqqqq sutv3ssr1tr2q1t{rrrqqsqqrtsqrrtsrq rtrrstqvtqsrsrsqsqqsqqsuqurvrwrwrwrxqqwrqtrqrur qtutqqqrqqtrssqqrrsrqqqtssqsqqqqqqqsqqqqqqrqqqrqqqsqqqqtqqsqq qtusrsrvsqq qvvxxtsyusyyuqqq iVoO2 t 6111121121121212113133111153211a11a41a3a21b221b2a1ab21ac2ba2ba12aa132121412412112131a34a323a213a21b2111b12a12a12aabbbbc!!!bab!!baaab!!ab!!!b!!a!!!!!!*11111112111111212112214111811223a3a1a1b11aaa1ba1ab21aa11111a12111411122a1412a311a3111b11b111aaabbb!!b!!c!!baaa!!!a!!!a!!-1111111111122111112222311141223a3a1a1b11aaa1ba11ab21aa111111211411122a1412a311a3111b11b111aaabbb!!b!!c!!baaa!!!a!!!a!!'a12a12aa1122111111111a1a1111aa111a111a11ba1111c31a112a121b21b211a1b11!b11c!b!aa!!!!'112131111112214112121113a1111ab11a111a111aa1111a1a111111122111212211aa11a2b1ba1b1abacabaacbba1112112112311311111111112a112a111121212121221a13a111a1121b1a11aacaa!a!!aa!a!!!!!11111111a22a11a1211a111111111a23a12aaaa1a21a112a112121a1a1a311b11a!a!1a!a"!4J   'D %%$#Bq$q$s%r%r%q&&&&%%!##&‚#b"aa!aaa"cb!! %%$#Bq$q$s%r%r"%q&&&&'''#b‚"a’!aaa"cb!! %%$#Bq$q$s%r%r%q&&&&'''#b‚"a’!aa"bab!qrၒs %%$#Bq$q$s%r%rq"!qr"r"q"q!!#ł%ƒ'#b!"aa!aba"db!! %%$#Bq$q$s%r%r%q&&&&''&$Âr!sb!rba"db!!zZ> !/a.ac.-a...///!/!B/B/A.A.A-AA*aB)cB*!B/B/B/////%b'$ab!a$!#abb#!$cba"!##q!"!!q#$ /b.b/b/.////!/!B/B.A)aAA(cB)qB/B/B/B/B/B/////%b'$ab!a$!#abb#!$cba"!##q!"!!q#$ /b.b/b/./(a"'d!(#+BB,A-A/qB/B/B/B/B/B/B/B/////%b'$ab!a$!#abb#!$cba"!##q!"!!q#$!*a$a*a#ba(b%)a!a#a(a!a#+a#/("'s"(#+BB,A-A/qA/B/B/B/B/B/B/B/////%b'$ab!a$!#abb#!$cba"!##q!"!!q#$#*a)a*b#a'a"#ba(a"a#&a"%a.//("'s"(#+BB,A-A/qA/B/B/B/B/B/B/B/////%b'$ab!a$!#abb#!$cba"!##q!"!!q#$!/a)a!a"ba$a"a"$/a)!a"%a)#a+("'s"(#+BB,A-A/qA/B/B/B/B/B/B/B/////%b'$ab!a$!#abb#!$cba"!##q!"!!q#$!/a.ba//a$a&a"/!a(a#(""a$qb"(#+BB,A-A/qA/B/B/B/B/B/B/B/////%b'$ab!a$!#abb#!$cba"!##q!"!!q#$!/a.e.-a...///!a/B/B.A)aAA(cB)qB/B/B/B/B/B/////%b'$ab!a$!#abb#!$cba"!##q!"!!q#$f8 !%q$%B%%%%%%A%B%B%B%B%A%A%A$B$!B$!1B$3A$3$3$1!$1"1$2!1$1!1#q!1#q!2#s"1#s"1!s"1q"! "$q#$A$$$$$$A%B%B%B#!B#AA#AA#!A#B#B#!1B#!2A#!2#!1$1$1$2$2$2$1!1$1!1$1!1#q!!q!s!!q $q#$A$$$$$$A%B%B%B%C%B%B%B%B%B%1B%2A$2$2$2$2$1$1$3$1!1$1!1!"q!!q %q$%A%%%%%%A&B&B&B&B&B'B'B&B&1B&2A%2%2%2%2%2$1!1$1!1$1!2$1"1!"1q!!r %q$%A%%%%%"%A&B&B&B&C'B'B'B&B%2A%2%2$!2$2$2#!1!1"q!1!1!r!1!2!r"1"1!q!"1!! %q$%A%%%%%%A&B&B&B&C'B'B'B&B%2A$2$!2"q"2!r!2s"2t!1!1!r"1!1!#1!2""1"1!!"1!! %q$%A%%%%%"%A&B&B&B&B&B&B&B&B&1B&2A%2%2%2$2$2$1!1#q1!1#r1!2#r1"1!s"1r!! xM #q#q""b"aa"c#c$a!!q!q!q"q!q!a!a!bb!‚ba!! #q#q""b"aa"c#c!"a!qq!q!q!b!a!bb!aba!! #q#q""b"aa"c#c$a"!q!q!qqb!a!bb!aba!! #q#q""b"aa"c#c$a#""q"q"r!q"r!q"q!qa‚baba! #q#q""b"aa"c#c$a#"q!q!q!qa!b!a!ab!ba!rs!r4 4aq4b2c3c334211q1qq1q1A1C2B21A1AA1A1Aq1A1A1A354 o i< !3aq3c2b2223432q2q2q2q2q2q22212A12C3C3C31A3A2A3A1B3A1A3A1q2B1q2A2s2A2s2A2s22q7 "4aq4c3b3334543q3q3q3q13qA3qA31333A13B14B14A14A4A4B4B4B3A1A3A1A3A1A31q31q31s7q 4aq4c3b3334543q3q3q2q2q22222A2B3B3B4B4B4A4A3C3A1A2A1A2231q7q 3aq3c2b2223411q1q1q2q1q1111A1B2B2B3B3B3B3A1A3A1A2B1A2A2A2A221q7r 3aq3c2b2223121qq1q1q11111B2B2B3B13B3B3A1A13A1A1q2B1A1r2A2A2r2A21q217 3aq3c2b2223432q1q1qq1111B2B2B13B2q3B1r3B2s3A1A1t3A1A2r2B1A32A2A22A21217 3aq3c2b22231211q1q1q2q1q1111A1B2B2B3B3B3B3A1A3A1Aq2B1Ar2A2Ar2A2s21r7 D} 3aq3c2b2223411q1q1q2q1q111311A1B2B2B2aBa1a1aBb2aBba1AAAA1BA 3aq3c2b2223121qq1q1q11111B2B2B2aBa1a1aBb2aBba1AAAAq1BAr 3aq3c2b2223421q1q1qq1111B2B2B2aBbq1aBr2aBas1AAtAAr1BA 3aq3c2b22234322q2q2r1q2r1q2q11qAC2B2B2aBb1a1aBb2aBba1AAAA1BA 3aq3c2b2223432q1q1q1q1111A2r1B4s2B3r2B2aBb1a1aBb2aBba1AAAA1BA ": 3aq3c2b2223411q1q1q2q1q111311A1Bb1a1aBb2Bba1BB1B 3aq3c2b2223121qq1q1q11111Ba1a1aBb2Bba1BB1B 3aq3c2b2223421q1q1qq1111Ba1a1aBb2Bba1BqBr1Bs 3aq3c2b22234322q2q2r1q2r1q2q11qAaCb1a1aBab2Bba1BB1B 3aq3c2b2223432q1q1q1q1111Aar1Bb1s1aBar2Bba1BB1B o 3aq3c2b2223411q1q1q2q1q1a1a1bb1‚ba1AB1B 3aq3c2b2223121qq1q1q1b1a1bb1aba1B1B 3aq3c2b2223421q1q1qqb1a1bb1aba1B1B 3aq3c2b22234322q2q2r1q2r1q2q1qa‚babaAC1B 3aq3c2b2223432q1q1q1qa1b1a1ab1ba1ArBs1Br 3b2ab1a1abb2cba114  G< F)\ #3b1c1cc1A11112B2B2C1D1D1D1ABaa2AAA2C2B23333333222111q2233 $3b1c1cc1A11112B2B2C1D1D1D1ABaa2AAA2C2B2333333333321q11223 $3b1c1cc1A11112B2B2C1D1D1D1ABaa2AAA2C2B2333313131313122212q22212 $3b1c1cc1A11112B2B2C1D1D1D1ABaa2AAA2C2B2333333322121222q2221131312 #3b1c1cc1A11112B2B2C1D1D1D1ABaa2AAA2C2B2333222222222212121q3343 #3b1c1cc1A11112B2B2C1D1D1D1ABaa2AAA2C2B233332222212q1112333 $3b1c1cc1A11112B2B2C1D1D1D1ABaa2AAA2C2B233333333332111223 $3b1c1cc1A11112B2B2C1D1D1D1ABaa2AAA2C2B23333333212221q222212 $3b1c1cc1A11112B2B2C1D1D1D1ABaa2AAA2C2B233333332212122q22221131312 #3b1c1cc1A11112B2B2C1D1D1D1ABaa2AAA2C2B2333332221121213q13443 ]Q$2a1a2ca11ag11AA11222AA1BB1BB1F1BqA1A1DA1BqA2C2A2q222121212121212121q2q12121212$2a1a2ca11ag11AA11222AA1BB1BB1F1BqA1A1DA1BqA2C2A2q222121212121212121q212q121222$2a1a2ca11ag11AA11222AA1BB1BB1F1BqA1A1DA1BqA2C2A2q2221212121212121212q1q21222$2a1a2ca11ag11AA11222AA1BB1BB1F1BqA1A1DA1BqA2C2A2q22212121212121212q12121q21214$2a1a2ca11ag11AA11222AA1BB1BB1F1BqA1A1DA1BqA2C2A2q22212121212121212q12121q21444$2a1a2ca11ag11AA11222AA1BB1BB1F1BqA1A1DA1BqA2C2A2q2221212121212121212q1q21444 ?m$2a1a2c1aaa1aaa1bb1c2232C1BB1ECBA1ABCB1D1D2C2222121212121212121q21212q121q22$2a1a2c1aaa1aaa1bb1c2232C1BB1ECBA1ABCB1D1D2C2222121212121212121q21212q1222$2a1a2c1aaa1aaa1bb1c2232C1BB1ECBA1ABCB1D1D2C222212121212121212q121q21212q12q$2a1a2c1aaa1aaa1bb1c2232C1BB1ECBA1ABCB1D1D2C2222121212121212q1212121q2q144$2a1a2c1aaa1aaa1bb1c2232C1BB1ECBA1ABCB1D1D2C222212121212121212q1212121q444$2a1a2c1aaa1aaa1bb1c2232C1BB1ECBA1ABCB1D1D2C2222121212121212121q2q1212121q4q4  \d U #31q1raa1b1b1a112q2r2r1q1q1s21q1a2s1q2bsa2ar2b3a3a3a3333222111q2233 $31q1raa1b1b1a112q2r2r1q1q1s21q1a2s1q2bsa2ar2b3a3a3a333333321q11223 $31q1raa1b1b1a112q2r2r1q1q1s21q1a2s1q2bsa2ar2b3a3a3a313131313122212q22212 $31q1raa1b1b1a112q2r2r1q1q1s21q1a2s1q2bsa2ar2b3a3a3a333322121222q2221131312 #31q1raa1b1b1a112q2r2r1q1q1s21q1a2s1q2bsa2ar2b3a3a3a222222222212121q3343 #31q1raa1b1b1a112q2r2r1q1q1s21q1a2s1q2bsa2ar2b3a3a3a32222212q1112333 $31q1raa1b1b1a112q2r2r1q1q1s21q1a2s1q2bsa2ar2b3a3a3a33333332111223 $31q1raa1b1b1a112q2r2r1q1q1s21q1a2s1q2bsa2ar2b3a3a3a3333212221q222212 $31q1raa1b1b1a112q2r2r1q1q1s21q1a2s1q2bsa2ar2b3a3a3a33332212122q22221131312 #31q1raa1b1b1a112q2r2r1q1q1s21q1a2s1q2bsa2ar2b3a3a3a332221121213q13443 my$2121s11ac1aa11aa222qq1qq1qq1qr1rr1rrssqr1b1b1a1a11a1212121212121q2q12121212$2121s11ac1aa11aa222qq1qq1qq1qr1rr1rrssqr1b1b1a1a11a1212121212121q212q121222$2121s11ac1aa11aa222qq1qq1qq1qr1rr1rrssqr1b1b1a1a11a12121212121212q1q21222$2121s11ac1aa11aa222qq1qq1qq1qr1rr1rrssqr1b1b1a1a11a121212121212q12121q21214$2121s11ac1aa11aa222qq1qq1qq1qr1rr1rrssqr1b1b1a1a11a121212121212q12121q21444$2121s11ac1aa11aa222qq1qq1qq1qr1rr1rrssqr1b1b1a1a11a12121212121212q1q21444 O-$2121qq1qq1q1aa2c232s1rr1u1rr1rr1rr1u1t1c2a2a2a21a21212121212121q21212q121q22$2121qq1qq1q1aa2c232s1rr1u1rr1rr1rr1u1t1c2a2a2a21a21212121212121q21212q1222$2121qq1qq1q1aa2c232s1rr1u1rr1rr1rr1u1t1c2a2a2a21a2121212121212q121q21212q12q$2121qq1qq1q1aa2c232s1rr1u1rr1rr1rr1u1t1c2a2a2a21a21212121212q1212121q2q144$2121qq1qq1q1aa2c232s1rr1u1rr1rr1rr1u1t1c2a2a2a21a2121212121212q1212121q444$2121qq1qq1q1aa2c232s1rr1u1rr1rr1rr1u1t1c2a2a2a21a21212121212121q2q1212121q4q4` B  , %aq%b#c$c$!a$%#"""!!q!qq!qq!qq!s"!r""r"q!q!q!at!s!"q! %aq%b#c$c$!a$%#"""!!q!qq!qq!qq!s!q!r!"r!!"q!q!q!at!!s!"q %aq%b#c$c$!a$%#"""!!q!qq!qq!qq!s!q!rq"r!!"q!q!q!t!!s"q %aq%b#c$c$!a$%#"""!!q!qq!qq!qq!s!q!r!"r!!"q!q!q!at!!s!"q > #qa"b"c!c"AA"B"B#A#A#A$q#qq"aqr"aas"aar"aa""c""b!b!!a!a!a!!c"!c!#!a" #qa"b"c!c"AA"B"B#A#A#A$q#qq"aqr"aas"aar"aa"a!c"!b"!!b!!a!a!a!"!c#!c!%a" #qa"b"c!c"AA"B"B#A#A#A$q#qq"aqr"aas"aar"aa"a!c!ab!!b!!a!!a!"!c%c!%a" #qa"b"c!c"AA"B"B#A#A#A$q#qq"aqr"aas"aar"aa"a!c"!b"!!b!!a!a!a!"!c#!c!%a" u#*qa)b)c(c)AA)B)B*A*A*A+q+q+q+qq)Aqr)AqA"AaA!AcAF!bAE!!bAAs!bAAs!b!!AFc"BAc!#AA!a"$F&B*qa)b)c(c)AA)B)B*A*A*A+q+q+q+qq*Aqr!&Aq!A#Aa!C"AcAD!AbAArC!!bAArB!b!AD!b!"AAB!c#BAc!$AA!a"%CA&qC*qa)b)c(c)AA)B)B*A*A*A+q+q+q+qq)Aqr)AqA"AaA!AcAF!bAE!!bAAs!bAAs!b!!AFc"BAc!#AA!a"$F&B*qa)b)c(c)AA)B)B*A*A*A+q+q+q("q(AAs$"Ar"BaArAcAsC!bAE!!bABrbAAsC!b!ADA!c!AAA!c!"BA"a"#AC$C r $$"#a#aA#$$#"A"1"1!1!11!21A!1A!aA"A!cA!A!b!FA"b!!EA"b!3AA!b!3AAcFA!cAB"a!AA&F(B$$"#a#aA#$$#"A"1"1!1!11!21A!1A&!aA#A!cA"C!bA!DA"b!!C2AA"b!B2AA!b!DAc!BAA!cAB"a!AA&AC&C1$$"#a#aA#$$#"A"1"1!1!11!21A!1A!aA"A!cA!A!b!FA"b!!EA"b!3AA!b!3AAcFA!cAB"a!AA&F(B$$"#a#aA#$$#"A"1"1!1!1"!3AA!2A"!aB!cA2A!b!C3A"b!!EA"b2BA!b!C3AAc!ADA!c!AAA"a"AB'CA)C xV#q""b!aa"A""A"""!$$$$$1#3"3!2!2"1$1!$1!1$1#q""b!aa"A""A"""!$A$$$#1!!3!3!2!!2$1$1!$1!1$1#q""b!aa"A""A"""!A$$$#"1!A3!3"!2$2$1$1!$1!1$1#q""b!aa"A""A"""!$A%%%#1#3"3"2#2$1$1!$1!1$1 p@#r#r!s"bs"b"c#a"b!b!!a11ACCB!B!A!!A!A!A#A#r#r!s"bs"b"c#a"b!1b1!aA11AC!C!B!!B!!A!!A!A!A#A#r#r!s"bs"b"c#a!b1bA!a11ADCB!!B!A!!A!A!A#A#r#r!s"bs"b"c#a"b!1b1!aA11ACCB!B!A!!A!A!A#A $q$###a#b$b"a!b!a!a!a!aqa!asa"ara"!qb!qqa!q!qaq!q!qaq!q#a%a$q$###a#b$b"a!b!a!a!a!aqa!asa!arb!a!qqa!qqa!q!qaq!q!q!a!q#a$q$###a#b$b"a!b!a!a!a!aqa!asa!arc!qqa!a!qqb!q!qa!q!q!!q$q$###a#b$b"a!b!a!a!a!aqa!asa!arb!a!qqa!!qqa!q!qaq!q!q!a!q#a "qa!b!cc!!!!q"r"s#qq"t"s"!r"!"!!"!"111q!q!!#""qa!b!cc!!!!q"r"s#qq"s"s"!r"!"!"!!!²1!11q!!!!"#"qa!b!cc!!!!q"r"s#qq"t"s"!r"!"!"!"ò1!1±1qq!!r!!&"qa!b!cc!!!!q"r"s#qq"t"s"!r"!"!"!!!²1!!11q!!!!"#4 e  BqAAAAqqqrqqqqq”A BAqAAqqqqqqrrrtq7+ ~‘|13Ñ|271~93;B1q&t?2q/"s57u3rq/!s4AA3BCAA"GAAAAA1AA!AAÏÏÄßßr58AA243AAq72Aq4131Bqs21;sq>rtsqqr3tqAACBAADAAAAAAAAAÏÏrßsßq!!B"#Cr"'BqA--rrt/-uqssq(EAABFAA$AAA…ßß ABB’AAA”AqqqAqr’AqAqqqqqqqqr7+ 36>q%s?2q/"s5?2q/!s4AA39AA"AAAAA1AA!AAÏÏÄßßrqs?2s?2q>qAAAAAAAAAAAAAÏÏrßsßqrqrrt/"/"qq/"AAAA/!AAA‡s"߈ß+ qqqqdqaraqdq1214661!1!1!2!1!12!1srr4`' )#""""r"""""""""""r""""""""""r"#!q!!r!!w!qq!qsq!qsq!qrq!qsq!qsq!qq!w!!%%/#/$/$/$/#/$/#/#/%r/$qq/$qq/$q/$q/"Aq%A&"&"q'"'!''"'"'!#'!!#&!!!#&!!#&"!!#&"!!!#&q"q!!!#%r!r!$$$$$#########"""""""!!!!!qq!qqrqAAqqq!s!qAq!s"q!!!q!q!q!q!!""""""""""""! d!c!aba!b!b"""b"c"aa"aa"b!c!c!ba!a!!!!!!!!"""""!"!!! "!!!C!!""AA#A"q!!$!#!!q"!!q!q1!2!!11!A1!!!1!!!1!!1!!!!!!!!!!!"!""#"q!qq!A!qA!qA"A"B#A#A""!qq!qq!qqrqqqqqr!qr!qq!q!!"""#######"Q #!!rrrqr qqrqrqqq rq !!# #!! qqrrrqqqqr !!# #!! !!#40 #0',211A1123211q11qqq112222121212222122211A1123211q1qqq1111222212121111212121211A1123211q11qqq112222121111313343211A1123211q11q11q11q11122222121112233211A1123211q11q11q11q111223333221233211A1123211q11qq111222121212222122211A1123211q1q1112221212121111212121211A1123211q11q1122212121121313343211A1123211q11q11q11111222221211112233211A1123211q11q11q11q11122233321112334 211A11121312211111q111q111123444331314211A112322221111111q11q111123343331455211A11231221q111111q1111123344444445211A112312211111q11q1111344333342111A11112312211111q11q11111345555542 ] {u32B2223Q221q11q11q1q1q2q222333332222232B2223Q221q11q11q1q1q1q111333121222111121132B2223Q221q11q11q1q1q1q222332221111232B2223Q221q11q11q1q2q2q222333333222232B2223Q221q11q11q1q11q111333321222111121132B2223Q221q11q11q1q11q11123322111111112 321C11A12Q2A11q11q11q11q111AA1221212121212121212121C11A12Q2A11q11q11q11q11A1A2221212121212121212221C11A12Q2A11q11q11q11q111AA1221212121212121212121C11A12Q2A11q11q11q11q11A1A12212121212121212144 |b211112211111111111AA1221212121212121212121111221111111111A1A12212121212121212122211112211111111111AA1221212121212121212121111221111111111A1A222121212121212121444M/:__W__WOOC R R R RA ARA ARA  ARA  ARA  ARA  ARA  ARA ARA ARA ARA ARA ARAARAARAARAARAARAARAARAARAARAARAARAARAARAARAARAARAARA ARA ARA ARA ARA ARA ARA ARA ARA AR R R  OOC__W__WThis is what is left of the shovel the workers used in the boiler room.4T-/:__W__WOOC    R 7 R22 R1 1 RA12 ARA11ARA1ARAARAARA2ARA1ARAARAARA2ARA1ARAARA2ARA1231ARA11121ARA11111ARA111111ARA11111ARA11111ARA111ARA2ARA2ARA11ARA11111ARA1221ARA122ARA1112ARA1121ARA111ARA111ARA 2ARA 1ARA 2ARA 15ARA 22ARA 21ARA 1ARA  AR2 R2 R     OOC__W__WThis is a long piece of sturdy string.46/:__W__WOOC    R R R RA ARA ARAqARArARArARAstARAwu ARA|v ARAz ARAx ARAqu ARAqs ARAqyARAvARA yARAr ARAvARA w yARA{ stARA}ssARAzstsARAyrxARAzrxARAryARAryARArzARAryARAyARAqyARA~yARA|yARAqxqyARArxARA xvARA ARA q ARA v ARA AR R R     OOC__W__WYou have a handful of metal scraps that you collected from the area around the engine.4%/:__W__WOOC    R R R RA ARA ARA ARA ARA ARA ARA ARA ARA ARA ARA ARA ARA ARAw ARArARAARAqwARAqqARAq ARA qARA ARA ARAq ARAqARAtqARAq ARArqARA}ARA ARA ARA ARA ARA ARA ARA ARA ARA ARA AR R R     OOC__W__WThis is a very sturdy paper clip!4f/:__W__WOOC    R R R RA ARA ARA ARA ARA ARA ARA ARA ARA ARA ARA ARA ARA ARAA ARAA ARA ARA ARA A ARA q ARA Bs ARA AFs ARA qF ARA rCARA DsARA AGrARA JqARA F ARA BARA ARA ARA ARA ARA ARA ARA ARA ARA ARA AR R R     OOC__W__WYou have a tasty looking slab of ham. It is making quite a mess of your pocket!4`0:__ROOF     AAAAAAAAQAAQAAQAAQAAQAAQAAQAAQAAQAsAQA qs AQAs}AQAs }qrAQAsqAqtAQAqsuAyAQAu~rwqAQAqvq|rtCAQAqw}rAwAQAqqtA}qAqqrAQArt|rsqAQArqsqAQA qtxrAQA sqArAQAsrq AQAw AQA AQAr AQAr AQAAQAAQAAQAAQAAQAAQAAAAAAAAAA     OOF__RThe fresh catch of the day is in your hands! Mmmmmmmm!4| n z                                                                           " &                           # #                                           (       %(   -   .....   .   .....   .   ..-   -   .   !   4j       +      0  5      5   [    +###%Q##&#&P### )-;[[[&[j4$4Q'7'.'? 4< G(j(k_b!)_+/%6#F!)_+/%!6#F!)_+/%)6#F!)_+/%2x6#F!)_+/%2j6#F!)_+/%@e6#F!)_+/%E`6#F!)_+/%Sd6#F! ) _+ / % W\6 # F ! ) _+ / % ]N6 # F ! ) _+ / % ]@6 # F ! ) _+ / % ]26 # F !)_+-%6C#PQ! Q/l Q=i Q@e  ( QC\ QF_ QE`  ( QS]  Q]3 O  (pedede(pe_e_e HE$E$E$E$E$E'_{$E$E$E $ E $ E $ E $ (q !! Be ''cBeee ..B e eee e e e 4i4i Be(o !!Bcee ''Beee ..Beeee 4i4i Be(j(k! W0R"WiJAll hands are on deck as you approach California! To the gold seeking passengers on board, it is the long-awaited promised land!Everyone cheers for the captain as he guides the ship through the "Golden Gate."The shoreline is covered with lush green plants.What a beautiful sight!!The bay is filled with boats of all kinds from every country.But they seem to be deserted ... Everyone on board is sure they are too late now!!Energy levels run high among the prospectors on board.They know there is no time to waste!The captain takes you across the bay and up the Sacramento River.The boats and ships are too numerous to count. It looks as if they are stacked on top of each other!!No one on board wants to miss the sight of sailing through that "Golden Gate"!The railing is lined with passengers!!A loud cheer goes up from the crowd on board as the ship enters into the beautiful bay!!It makes a chill run up and down your spine!It is a sight you will not soon forget!!The south edge of the bay is lined with small buildings. There are a few boats and ships moored at the docks.That must be the settlement of Yuerba Buena, soon to be called San Francisco.It looks like the ship you are riding on is one of the first to arrive!!This brings a little glimmer into every eye on board!!The ship isn't moving fast enough! If the captain passed out oars, you would gladly row, if it would save one minute!! You are ready to start panning for that CALIFORNIA GOLD!!There are 95 points possible so far (not including the points for reading Psalm 23).There are 100 points possible so far (not including the points for reading Psalm 23).You have %v3 points out of the 100 possible. Don't give up!You have 100 out of 100! You are right on trek!!You have %v3 points out of the 95 possible. Don't give up!You have 95 out of 95! You are right on trek!!4T Olwxz{!)x+/%56=CXF!)x+/%56=CXF!)x+/%v86=CXF!)x+/%v96=CXF!)x+/%uD6=CXF!)x+-%?6=C#PQ7!)z+/6%xz!)z+6%{e! #F / #/ 55 /$K $)z+/6%mm# /! /)z+%r^6# d8d8  /$K   $  )z+/6 %fq#   / 6 - /){+%ma6 #){+6 %khL# VTVT /$$K $Be(e) H Q5 (+Qv8 Qv9  (QuD (+QjB Qq, Ql*  (+QdA  QcA  QaR   (QXT  QVT 55#: 55#: v8v8#: v9v9#: uDuD#: q:q:zxq: q/q/zxq/ l*l*zxl* d,d,zxd, d7d7zxd7 cAcAzxcA aLaLzxaL aRaRzxaR XTXTzxXT v-v- jBjB m*m* d7d7 aPaP XTXT v-v- Bee v/v/B  wEwEB  jEjEB  l@l@B  q;q;B   l*l*B   d7d7 Be cAcA Be aPaP Beee e!e2l2f$5 t-The first stop on your journey is beautiful Buffalo, New York!You gladly get off the stage at Buffalo and embark on a Great Lake Steamer.Lake Erie!Cleveland!Toledo!Detroit!Lake Huron! Lake Michigan!In Chicago, a city with a whopping 20,000 inhabitants, you disembark the Great Lake steamer only to board another water going vessel, a canal boat. This will take you to Peru, Illinois, a ride of about 100 miles.After Peru, the next leg of your trip will be aboard a river steamer which will take you to St. Louis via the Illinois and Mississippi Rivers.It may seem unbelievable, but you have to change steamers again in St. Louis!You are glad to discover this will be your last boat ride (not knowing that in a few short weeks you will long for a relaxing boat to ride).You board another steamer in St. Louis and ride about 390 miles up the Missouri River to Independence, Missouri.Hurry up and wait! You'll be in Independence in approximately two days!You don't look long before you find the "Long Island Joint Mining and Stock Company" camp set up just north of Independence.With a great deal of anticipation you enter camp!!You are on your way to Independence!4; <=  l_x}zx5zxx6zxm9zxm-zxi+zxg7zxbCzx`OzxY[zxV\!)x+-%6=CP!)x+/-%IV6 =CF!)}+/6 %!)}+6 % !!)}+!!)XC!)_+/%6 CX>#$P6 )+-/%7k# / / $"#Qdd P#F /+ "/<#)}+6 % L#8O  P)}+/6 %#   / + " /<#)}+6 % L# %% /$$K $ H aa /$$K $)}+/OP# /v mn/</ 6 %#FQ PUYWX V Q88Q6 %&#FQ#P#Fn oKo8Q xe'hh O aa  /$K .  $UYWX V O88Q5 6 Q#GP $e2e68O  P OF )}+/#)}+6 % L#G)+-O%&# 9GL # )/IO eMFAA8UJ O)}+/LLI Fe3e5UMe)hh Q Q Q Qm Qg (+Qazxg QX  QQZ  QJX  Q>I  Q=C  Q*@ Q%9 Q0 Q. Q, Q% Q% zx zx wwzxw mmzxm aazxa V~V~zxV~ QrQrzxQr QfQfzxQf QZQZzxQZ FTFTzxFT >I>Izx>I 8@8@zx8@ -@-@zx-@ #7#7zx#7 "6"6zx"6 --zx-  % %zx %  qq `` QgQg GUGU =D=D -@-@ 11 %% Beeee B8Ue e tt Bee aaB  QeQe Bee =H=HBeee e! #7#7 Be(  % %Be-e.e/l6 nV>v8W)xZ V It is 2,100 miles to California, but after only a few miles your company, and every other company heading west, realizes that the wagons are too heavy. You begin what will be the start of a continual process, lightening the wagons.The traffic is very heavy leaving Independence. There must be hundreds of wagons, usually pulled by six to eight mules or oxen, on the trail.The trails become deeply rutted, making passage difficult.Wagon axles break, wheels fall off, wagons sink up to their axles in mud. If they cannot be pulled out, they are abandoned.Forty-five miles down the trail, the trail forks. To the south is the Sante Fe trail; to the north, the Oregon-California trail.Very few take the southern route.It isn't long before the first Indians are encountered.The first Indians encountered are the Shawnee and Potawatomis. Much to the surprise of most travelers, and disappointment of some, they are very friendly and helpful.Crossing the Kansas River!You are now approaching the land of the Pawnee Indians! This is the tribe of Indians that is most feared by the travelers!!It is necessary to keep a keen watch at all times!!The plains teem with buffalo! Herds of them stretch as far as the eye can see. Wildlife is extremely abundant.But the traveling masses do little to preserve their surroundings as they make haste to the West.While traveling the trail you find that those who have gone before you have left a trail of litter and garbage.If there was no trail, you would have hardly noticed; you could just follow the trash. It is a sad sight.Also along the way, you find discouraged travelers heading back home in their wagons.The first major milestone is Ft. Kearny. It was recently built by the U.S. Army to attempt to keep peace between the Pawnee and Sioux Indians.Travelers look forward to Ft. Kearny for various reasons.Some just want a place to mail letters; others are interested in how many others have passed before them; leaders want information on the condition of the trail ahead.Ooops! You fall from the raft into the strong current. You are swept downstream, never to be heard from again.When you left Independence, you had this gnawing feeling you were leaving too early.You were right! Your wagon sank up to its axles in mud!There was nothing you could do. It was just an accident!40 <?  l |x}b)zx5zxx6zxm9zxm-zxi+zxg7zxbCzx`OzxY[zxV\zxIV zxIV ! ) x+ / = 6 ! ) x+ / = 6 ! ) x+ / = 6 ! ) x+ / = 6 ! ) x+ / = 6 !)x+/=6!)x+/=6!)x+/=6!)x+/=6!)x+/=6!)x+-%6=CP!)x+/-%:I6 =CF!)}+/6 %!)}+6 % !)}+6 % 8P3!)|+6 %F!)|+6 %F!)|+6 %F!)}+/% 6 CF!>#$P6 )+-/%,[# / / $$#Qzdd P#F / /<#L# ,, /$$K $ HWX V CnCnP88P CnCn (/$$K(@ +$P+/#c)L#G) +-O%+6 # 9GL+#,#IO )}+(/I$,-e&Fehhc)8W8 CnCn+UMOc)eeee$$$eeee(hh8Y_ ePLL2ee/$$K $Oe*hh Qz Qy Qqx QBn QAf Q@d Q;a  Q9]  Q5[  Q/T  Q,S  Q*P Q$O Q$L Q!L QG QE Q> Q> Q; Q6 Q. Q, % # :  % C # : v~v~% v~# : lsls% ls# : anan% an# : VnVn %VnC#: KnKn%Kn#: AhAh%Ah#: AfAf%Af#: 9]9]%9]#: /T/Tzx/T $O$Ozx$O CCzxC 99zx9 22zx28Pu BnBn /$$K $/#IPB   >b>bK $ 2X2X/#IPB   *P*P K   $ (O(O  /#IB    JJ  K $#I ##P  v~v~ gngn VnVn BnBn 7[7[ (O(O >> 11 Beee gngn Bee MnMn Be e >> Be(e) 11Be-e.e/l/ ` f|\Qvd9$ The trail is wide and easy to traverse. The Platte River provides an ample supply of water. Between Ft. Kearny and Ft. Laramie the company should average 17 miles per day.The upward slope is so gentle that the animals barely feel the grade. Discarding those unnecessary items in Ft. Kearny really paid off!The captain advises the rest of the company that this will be the easiest part of your trip, so you had better enjoy it!!Due to the lack of wood to burn for fires, the common fuel substitute is buffalo chips.They burn well if they are dry. If they are damp, they smoke a lot. If they are wet, they are next to fireproof!One of the main obstacles between you and Ft. Laramie is the crossing of the South Platte River. What makes this crossing so difficult is that the river bed is like quicksand!!The trail ahead will take the company by the most prominent landmarks of the trek and, also, of the West!Ash Hollow!Courthouse Rock!Chimney Rock!Along your journey you have encountered a few Indians and they have all been friendly, so far.But just like pale faces, there are good and bad Indians.You have just run into some of the bad!This is just too gruesome to watch!!These Indians saw the beautiful mules you selected back in Independence and wanted them.And they got them, at no small price to you!Every member of your company paid the price.Your trip has only begun, and the animal team is getting weak.When you left Independence, there wasn't enough grass on the plains for the animals to eat.They are too weak to pull the wagon.These Indians came out of nowhere! There was nothing you could do.All along the way the wagons have been getting lighter. But climbing the gentle slopes of the North Platte, your captain finds it necessary to lighten the load even more!The captain also takes note of the need to increase the care given to the animal teams. There is much tough terrain ahead!Ft. Laramie is another military station along the way that weary travelers long to reach.Once they arrive, many meet with great disappointment. They are unable to acquire many of the articles they desperately need, such as fresh animals to replace those that have died along the way or those that will not last much longer.You could have all the money in the world and it would be useless. They just aren't available!!4:<Alwx}zx5zxx6zxm9zxm-zxi+zxg7zxbCzx`OzxY[zxV\zxIV zxIV zx:I zx:I !)}+/6 % !)}+6 %!)}+6 %!)x+-%q6=C!)x+/-%.?6 =CF pp P#F / /<#L#>#$P6 )w+-/%#P# / /$!#Qm Qk Qi QV QO Q{M QxE QvD  QuB  QlA  Qj=  QW3   (+QMB QLB QJH QIH QCV QBW QW QV Q ^ Qh H iizxi aazxa UUzxU yKyKzxyK pApAzxpA e8e8zxe8 `3`3zx`3 W3W3zxW3 M?M?zxM? FKFKzxFK BWBWzxBW 7W7Wzx7W ,W,Wzx,W !W!Wzx!W WWzxW  ^ ^zx ^ ^^ tAtA `3`3 JEJE j> Be e Z3Z3B eee e!e" BWBW Be2  a a Be!)x+-6=C8E%W8G %nd# !)x+/-%"=6 =CF XX mdmd P#F / /<#L#>#$P6 )w+-/%R# / / $#QY Q\ Q_ Qld qdqd8E H Qjm Qdn Q`s QZt  (+QTi  QOi  QFM  QCL  Q<8 Q+/ (+Q @ QI QK Q i Qk Qo Qt H [[zx[ ddzxd }d}dzx}d rdrdzxrd jkjkzxjk aqaqzxaq ZtZtzxZt TpTpzxTp MgMgzxMg F[F[zxF[ FOFOzxFO =F=Fzx=F <:<:zx<: 3/3/zx3/ +/+/zx+/  6 6zx 6 BBzxB KKzxK  V Vzx V  b bzx b nnzxn dd jhjh TzTz F\F\ <=<= -/-/ KK kk dd Bee rdrd Bee jkjkBeee TvTv Be ELEL Be -/-/ Be  3 3 Be#  h h Be(e)l)Tuo2tQYour wagon train is now entering an arid stretch of land!! It will be fifty miles before you or the animals will be able to taste the refreshing cool water of the Green River.Every container is filled to the brim with the life-giving water that will be so valuable for the next few days.The trail across this desolate wasteland is strewn with dead oxen.The animals, as well as you, are parched and desperately in need of water.During this section of the trail, the going gets tough. There are no rivers going your direction to follow.It is just seemingly endless miles of gravel, rocks, sand, dust, steep hills to climb, and difficult descents.As difficult as it is to keep on going, you have to keep those big wheels turning!!The trail gets slightly easier for a few miles as you follow the Bear River. This is a welcome relief.Here the trail forks. The southern route is called Hudspeths Cut-off. That route is slightly shorter, as the crow flies, but it misses the stop at Ft. Hall. Your captain takes you on the northern route toward the fort.Fort Hall!After leaving Ft. Hall, the company follows the Snake River through a portion of Idaho.A common landmark is Steeple Rocks, two pointed columns of rock prominently standing two to three hundred feet in height.It is a relief for your captain to see this landmark come into view. He lets everyone know that the company is right on course!4@i `abcdbb!()`+()b+-6%`#QW!)c+%fg#:! ) d+ - / = % 46 # F ! ) a+ - % 6 # T !)a+-%6#T!)a+-%ba#T!)a+-%xO#T!)a+-%FI#T!)a+-% u#T!)a+-%#T!)a+-%Qw#T!)a+-%I_#T!)a+-!)a+-^^^^^ + :ccߐd/ ߏ$  ) a+ - % 6 # T _Xzm $  Q= Q+ 6 :(!)`+/-6%@XC#:!( )`+/( )b+/-6 %+XC#!( )`+/( )b+/-6 %/XC#::(!)`+-6 %MoXC#G!)a+-%J# ! ) a+ - % V# T ! ) a+ - % F# T ! ) a+ - % @# T $  e34)%t#Qt %#Q $4)%p#Qp %#Q $  ;QFg qh{h$ ;"ccQFg # QAj QT} Q}K $Zee  j j+>e fu nu jm n'u j"m (`Cu YX^u _n}u _Xzm ~nu im iu iu =NM_ EA[M WN|W fue nue jme) n'ue j"me* (`Cue YX^u _n}ue _Xzme+e, ~nue ime- iue iue =NM_e EA[Me WN|Wee~e  &  e&e& e&e'j jm j"m _Xzm imJ jme) j"me* _Xzmee+e, ime-e(eGe< ^R{mee5! ^R{me!Ee!e=.=]Z]...sNe#C ^R{m+$ ;"ccQFge!e5eQe.Z  e/Z e0.=e1]e2e4 e6)e7e8 _Xzme:e;e9]QQe<< z?d Cs":aD( I   P s  % k Ship after ship arrives loaded with people determined to strike it rich!The buildings of Sacramento line the streets.Sacramento's a popular stop fer folks headin' to the hills in search of gold.Sacramento has many buildings. You need to be closer to get a good look.Of the many hotels and boardin' houses in town, this one, "City Hotel", looks, perty much, the nicest.This building was definitely built in a day. It's just some canvas stretched over some poles with a wood storefront.Yer outside of the Eagle Theater.This building is one of the few in town that looks like it's gonna be 'round fer awhile!Yer right outside the stage coach office!Yer standin' smack dab in front of the Eldorado Exchange!This is one of Sacramento's supply stores. Many folks lookin' fer gold get supplies here.This establishment's name, "The Elephant House", comes from the phrase you often hear from gold seekers. If you've seen the elephant, you've experienced the "GOLD RUSH!" and the hard times that come along with it.The less reputable businesses of Sacramento are housed in these buildings!New buildings seem to go up every day in this part of town.These buildings all look shoddily made.Sacramento is a beehive of activity! But just like any other city it's made of streets and buildings.These dodging codgers are so busy, they ain't got the time to talk to you!This stage is top notch. Yer ridin' in luxury!Ya watch the buildings go by through the stage windows.The stage is headin' to Sutter's Fort!It's too late. That stage is headin' to Sutter's Fort!Inside this rather dimly-lit building you see a stagecoach, all hitched and ready to go.Yer lookin' at the Sacramento River.The stage has already left for Sutter's Fort.Ya jump on board the stage bound fer Sutter's Fort and yer on yer way!Yer in the stage.Yer in an empty stage.There are people all over the place!Yer inside of a building made of only canvas!Yer inside of the Eagle Theater!Yer inside the stage building. It looks like the Sutter's Fort stage is prepped and ready to roll!Yer inside the stage building. The stage area is empty right now. There's a stage schedule on the wall.Yer inside the Eldorado Exchange.There ain't no fort right here, this is Sacramento!At this point in your journey ya don't need a ticket!Ya got two healthy legs, walk!If ya see a door, go through it!Ya just got off of that thing!You've been on this ship long enough. Go ahead and disembark!You may need supplies, but you can't get them here.You see no stage coach right here.The only interesting thing about these tress is they are in California!Some of these wagons head east into the hills.The hills lie to the east.You see no schedule right here.According to the stage schedule, the stage should be leaving anytime.According to the stage schedule, you have missed the one and only stage to Sutter's Fort!How are ya gonna to get there?4y4H!)4+-%h#GPB!)4+-z%Z|%Uz|LM%Rj#P 9Z%eZ Ql Qn Q n Q%m Q3l Q:k Q>j QAi  QCh  QFg  QRf %lvL UfZf%vL ObTb%SsL LZNb%#sL LTNY%aM NSYT%jaM ZT\e% WM `Ub[%4=Z p 9%PRz  o 9%w|eQe%eee eee'eX 0 4ee7a77k e(e)ooaoe** Vl#F ;Ya ain't got no mule!Ya might try that somewhere nearby!Yer outside of Sutter's Fort on the edge of the wilderness. The road in front of the fort heads east through the wilderness to the town of Coloma.Newcomers to California would sometimes get valuable information from folks in Sutter's Fort.Many gold seekers, after a short stay at Sutter's Fort, head east through the wilderness along the American River.The road in front of Sutter's Fort heads east along the American River to Coloma.To the north of Sutter's Fort is the American River, to the west is the Sacramento River.The American River runs east through the wilderness.To the west of Sutter's Fort lies the Sacramento River.Across the river lies unreachable wilderness.The town of Coloma ain't in sight right now. Coloma is half a days walk to the east of Sutter's Fort.Diggin' ain't allowed here! Do that somewhere else!!No shovel, no diggin'!Ya needs to be in the water!4 ?Gacdb:3!)d+/6%<#CXF!)c+-%|#Q4|!)a+-!)a+-!)d+%W\#CXGL!)d+/%mqCX6#F:! 0 4)G)a+-# 9qcc:/$ : Q:{ Qfz Qhx  F  !)a+-%lv#GQ~{ Q| $%}#Q5} QU{ Q} $%{#Qz Q-w Q{ $3q6 3r8 lqpq:I lqpqK ; rqrq% :X So\q%5s :N rr : 0 4 % T+%TM 0 4 s} :%^bK s{ :%^bK nn : 0 4 %d+%aM ox :%J]K :%RjKX 0 4eee[eeQ+Q++Qee)e))e 'e  e %e \\QQ\\\\..QQ....e QQQQe\\\...e7a77k e(e)ooaoe**Vl3c":>&\sYa ain't got no mule!Ya might try that somewhere nearby!Yer on the south side of Sutter's Fort. There's a road in front of Sutter's Fort that follows the American River to the town of Coloma.This is green, wild grass!The Stars and Stripes are flyin' over the fort!Sutter's fort is an impressive sight. The fort's main corral is built onto the south wall of the fort.The road heads east into the wilderness.A never-endin' stream of wagons use this road.They won't stop fer ya!Ya cain't see the town of Coloma from here. It's quite a ways east along the American River.There's no river in sight right now, but the American River lies north of the fort and the Sacramento River lies west of the fort.Wilderness surrounds Sutter's Fort.The fort's south gate is always open. The gate leadin' to the fort's corral is open only when it's bein' used.The fort's main corral is built onto the south wall of the fort. There's a gate in the corral wall.Just walk up to it!Diggin' ain't allowed here! Do that somewhere else!!No shovel, no diggin'!Ya needs to be in the water!4FGad!)d+%A@#CXGL! 0 4)G)a+-# 93W83W3X6 3X6 [[%=qR *X*X 0 4e ^0^4%SV #U#U%PU \\%rL 0 4 ^h%JWK ^h%JWK SS%vL T %=h+Z%SRKe(e(eee eeQ+e7a77k e(e)ooaoe**V&d%PYer on the south side of the famous Sutter's Fort! Just to the east of the fort is a cemetery.The fort cemetery is just east of the fort!This water is the water supply for the folks that live in the fort.Yer gonna see a bunch of bushes like that before yer through!Ya didn't come all the way to California to look fer granite; yer lookin' fer GOLD!!!Yer gonna see trees all over the California landscape!Just look at that flag against the California sky!!Sutter's Fort is a mighty impressive fort!That mule that's been followin' ya 'round cain't fit thru the door. Ya gone and left him outside!Diggin' ain't allowed here! Do that somewhere else!!No shovel, no diggin'!Ya needs to be in the water!4 :zr]zS = fhb!b"!)f+/CX%G;F6!)h+/CX6%O#:!)h+/CX6%gT#:!)h+/CX6%U#:!) L+S+# 0 4=  ) ) RU 6 RU 8 FQ c!;:I FQ;K :; c" dJyU c!;:I dJyU;K :; c" zKW c!;:I zKW;K :; c" Y`%aO a &3O R`%aT a ܗ&3T %oS B%S C%S 0GPG%XrLA dJyU FQ zJW' dJyU FQee zJWeee  c + WW|#<$<ec fWdeeQ+e [e "e Zde .e \ee\'\e zJWe QQQQe7a77k e(e)ooaoe*.e+ 0 4=+XL|i'@  Z^If this critter is supposed to be a guard, he's a poor excuse for one!! It looks like he's nearly asleep!Yer gonna hafta get a little closer!"Yer welcome to take a tour of the fort, but there are only a few folks still hangin' 'round here."There's a guard sittin' in a chair by the door.Through the south gate ya see the gate to the fort's main corral.This is just an empty room. The guards watch the gate from here when it's rainin'.These are the guards livin' quarters. A quick look at this mess and you've seen enough!This is the famous Sutter's Fort!Sutter's grass is green as can be!There's nothin' special 'bout these windows!Not a real bright idea. If ya tried that, he'd probably have ya strung up!It's just a normal door!As ya look through the open south gate, ya see the gate to the fort's main corral.Ya can see the area to the south through the gate.Ya cain't! It takes a whole bunch of guards to move those gate doors!"Most folks have gone to the hills to look fer gold! They hurried off and left their belongin's unattended, but ya ain't gonna find nothin' useful.""Seems like the only things of any use these days is a gold pan, a shovel, a lantern, and a trusty mule."The guard outside the door don't take kindly to yer snoopin' in his quarters.The walls of the fort's main corral are visible through the south gate.You don't need anything here!The lazy guard takes one look at you and says, "You look as green as grass, stranger! I imagin' ya just pulled into the fort. Let me give ya a few pointers."Diggin' ain't allowed here! Do that somewhere else!!No shovel, no diggin'!Ya needs to be in the water!Just walk up to it!4  = bb!b"b*zRz%SzPRzSc !)+/6X%wR# 1!)+/%dU6XC#:!)+6%jH#!)+6 =%`#!)+/CX6%]#:!)+/CX6%%]#:!) P+# 0 4=  P`m X P`m Y ) ) Q` c!;:I Q`;K :; c" !Q=` c!;:I !Q=`;K :; c" `Q|] `Q|] r x&22c*$   +/8%gU#2F I $  +/6%wR#G  +/8%g\#I  +G   *! r xF +/I $ +/6%wR#G `Q|]*cee\1;$ x %jP a ܗ&3N %PP C ) `Q|]r x&e   K > $ `Q|]rxae   K > -$ `Q|]rxe   r x&b Q] !Q=] EQ] `kB Q]eeJ !Q=]eeJ EQ] e 1e/ `keeJe k   `Q|] 1 r x& rx rx rx r xr x.    e 1a `Q|]Ue  r x&rxr xe Y `Q|]Me  r x&  e jynyb 1Z 0 4K 0:Je!/{ce"e# Je(e'e$ 4e!e enynnynynnyZyvZnyvyInyI 1 bVkVe& e%e* !Q=]e)e*dZddd `ke+e-nyy 1 EQ]e/e0ZnyZynyy 1e1 EQ]e2e0k EQ]e3e47a77k e<e=ooaoe>[e?.e@"eA.eB*)*eCZ*Z)*eDQ+eEeF**)*)*eGIeHI !Q=]e5eIZZZ2Z)ZZ Q]e6 2) Q]e7 R !Q=]e9 Z !Q=]e8 RR EQ]e;  EQ]e:  r x& 0 4=JR)bOT`/E<A#[ S t  ]  B n - Y  N 'Sx#JhThese are the livin' quarters of John Augustus Sutter!This is the fort's candle shop!Whew, is it steamin' in here! There's a fire roarin', some metal glowin' and a blacksmith sweatin'!!The gunsmith's shop is an excitin', but unecessary, stop on yer tour of the fort.Looks like there's a blacksmith's shop in the corner!"Can'tcha see, man, that I'm as busy as a one-armed paperhanger with an itch!""If you'd excuse me, I best be gettin' back to my work!""Hold on there, son. You ain't from the parts around, say, New York, would ya be?""Well, I declare! Hello there, uh, uh... Blast it! Uh, young fella.Good to see ya again!"yea or nay %g69It's awful loud 'round here. Better get closer!%g69"%w1" what?"You wouldn't be from Brooklyn would ya?""Yer last name ain't by chance uh, uh... Dern it, uh, uhhh..."Enter last name %g69"Yeah, that's it! An uh, yer first name wouldn't be, uh, shoot, uh... Uh, uh..."Enter first name %g69"That's it! And, uh, ya got a brother named uh, uh, dag bern it! Uh, uh..."Brothers name %g69"Well, I'll be! I cain't believe it! Lean over here uh, uh, young fella and listen to me close.""I cain't be talkin' too loud 'bout this kinda thing.""Never you mind, that ain't it. I musta mistook ya for some other fella.""I gotta message fer ya from yer brother. I ain't got no notion of his whereabouts, all I got is a message.""He won't tell nobody of his whereabouts, but he gave me this to give to ya.""Ain't got no idea what it's fer, but he wanted me to give it to ya."The soot-covered blacksmith hands you a branding iron.Now you know yer on the right trail to find yer brother. He must be on to somethin' big! REALLY BIG!"He wants ya to know that in these parts he's known as uh, uh... He's known as uh, uh, James, that's it, James!""Pardon me, young fella. My mistake. I thought you was someone else!"Ya got to have a branding iron if yer gonna do some brandin'!Ya got yerself a branding iron there, but ya got nothin' to brand!This mule already has a brand on it!Ya take the red-hot iron and place it firmly on the mule's left rear haunch.It sizzles and stinks, but the mule takes it on all fours!You've got everything ya need to do that but a hot, glowin' branding iron!Ya gotta get closer to the fire.Ya put the branding iron into the depths of the coals. It comes out glowin' red!!Ya took too long, the branding iron cooled off!Ya gotta be closer to a mule than this!It ain't surprisin' to see candles here, yer in a candle shop!There ain't no candles 'round here!The gunsmith is gone and, as always, the guns are safely stowed away.There ain't no gun right here!"Hang on there, fella. I'll be right with ya!"Leanin' against the wall is a branding iron.Ain't no branding iron in sight right here!Ya already got a branding iron!"Keep yer sticky fingers offa that branding iron, fella!"The man is a blacksmith and he's sweatin' up a storm!Ya see the blacksmith workin' inside his shop.There's no fire burnin' in the candle shop.That is John Augustus Sutter's personal property!Even though it's John Augustus Sutter's personal %w2, there ain't nothin' special about it!Ya don't need that. You've wasted enough time here!This is what you'd expect to see in a candle shop.The metal glows when the blacksmith takes it out of the fire.The blacksmith builds a hot fire in this fireplace.Diggin' ain't allowed here! Do that somewhere else.No shovel, no diggin'!Ya need to be in the water!The grass is kept short by all the animals!These doors are fer walkin' through!The fort is fortunate to have so many windows!Just walk up to it.Just outside the blacksmith shop is a wagon wheel.Why? It's busted and the blacksmith needs to fix it!Yer inside the walls of Sutter's Fort!There's nothin' to tie it to!That'll never hold it!A grand idea, but fer what?The roarin' fire is a dandy place fer heatin' up metal objects!You don't need anything here!4P= hb!b"z Vz3RzfV!)h+/CX6% ]#:!)h+/CX6%3]#:!)h+/CX6%f]#:!)h+/CX6%]#:!) O+S+# 0 4=  ) ) Q` c!;:I Q`;K :; c" QJ` c!;:I QJ`;K :; c" RQ}` c!;:I RQ}`;K :; c" ~Q` c!;:I ~Q`;K :; c" Q3`3f3f&3Q ax%O y%dO %LS[ Q` QJ` RQ` Q`; Q`eeJ QJ`eeJ RQ`eeJ Q`eeJeZpp RQ`eeZPP RQ`ee[e .e "e .e Q+e 7a77k e(e)ooaoe* ]Z0000  ]=ZepePeA Q`e e 0 4=J]>Y)Kpw. "?This is a bunk room for the hired hands. They've gone and taken everything with 'em.This is the hat and boot shop for the fort. You've got a hat and you've got boots.This is an empty entryway!The sounds of the blacksmith shop come from one direction, the smell of mules comes from the other.You've already got one and yer literally attached to it!What %w2?The boots on yer feet will do just fine!The animals keep the grass short!These doors are fer walkin' through!Do it!Just noraml windows to let the light inside!The walls of Sutter's Fort surround you!No time fer that!These are normal hats.Of course there are boots in here, this is a boot shop!This is a handy entryway fer folks needin' to use the hat and boot shop or the wood shop. Ya got no need fer them.There's no doubt about it. There are mules nearby!Diggin' ain't allowed here! Do that somewhere else!!No shovel, no diggin'!Ya needs to be in the water!You don't need anything here!4= bbb!b"z Xze ze !)+/%#:!)+/CX6% ^#:!)+CX6%\#LG!)+/%MfX#F!)+%u`#:!)+%dj#:`!)+%X#:!) R+# 0 4= ` ) ) QCeG 6 QCeG 8 P` c!;:I P`;K :; c"E ;G)Qq Qx F;I ;Qiߗ K :GQm| )+/(F4' F   G Q ܗ&3P R%R S%yRE Q` P7fF 4@f^+ Q`eeJ P7fFeeJ 4@f^ee  sEc 0    `     ZZZ{{* 0 4e{e ce\0 `JE: `   a55^a5^5a55^5^5^a5^a555a5a5cES # "c ^"   a ^ ^a ^ ^ ^ ^ ^a ^a  a   a a WEG      r 4 0{ee/ 'e [e!.e""e#.e$Q+e%e&Ke'7a77k e(e)ooaoe*Ke+ZKKe-\e,WaW^W^aW^W^aW^W^aWW^aWWaWWaW . P7fFe0 e1'e2aaaa^a^a^aaEQ !s< sn"  =JF X44N+^v#;Bk9Pm U t ( The man says, "Ya don't have a gold disk!""I'm busy tryin' to get a mule fer ya!"The man says, "Ya don't have a gold coin!""I'm the man that watches over all these fine mules," says the man.The man says, "Ya don't have a gold flake!""It's gonna cost ya a bit of gold to get yer hands on one of these beauties!" says the man."Ya already paid me once. I don't really think ya want to pay twice!" says the man.The man says, "That measley gold coin ain't gonna land ya one of these mules!"The man smiles and says, "I'll gladly take that gold disk off yer hands. It looks priceless!""All right, I'll just take a little of that gold ya got there and give ya a mule!""Ya ain't found enough California gold to buy a mule with," scoffs the man."What would ya want to do that fer?!"Ya gotta get closer fer somebody to hear ya."Come on! Get outta there, ya lazy good fer nothin' mule!""Outta my way!""Sorry, shorty. I have no more mules fer sale.""I hope that there mule helps ya strike it rich somewhere!""Well, are ya gonna get that mule, or let it run away?!"Ya grab hold of the rope 'round the neck of the docile mule and take it away! It willingly follows you!If ya want the mule, yer gonna have to get closer!Ya already have a mule!There's a man watchin' over the mules.Everything made here in the wood shop is made with lumber from Sutter's own sawmill in Coloma!From here, all ya can see is the jail.Ya know yer in the middle of the corral area 'cause of the aroma. These are nice lookin' mules!A mule might come in handy in these parts.Ya don't have any money.The animals keep the grass short.There's nothin' unusual 'bout these doors.Lookin' in the window reveals nothin'.Do it!The walls of Sutter's Fort surround you!This long, lean, lanky man is watchin' over the mules in the corral.If it weren't fer this corral, these flea bitten varmits would be all over the fort!Diggin ain't allowed here! Do that somewhere else!!No shovel, no diggin'!Ya needs to be in the water!There are a couple of barrels sittin' on the ground just outside of the wood shop.That man ain't gonna let no one open that gate!Ya got no need fer a barrel!The man laughs and says, "That gold flake is worthless in these parts!"This mule don't look that bad!The jail is never used. The solution to crime 'round here is a good, strong rope and shady spot!There's a sawmill in the town of Coloma.The town of Coloma lies east of the fort.You don't need anything here!4= hlb!b"zXzf^zl!)h+/CX6%h#:!)h+/CX6%fh#:!)l+/CX6%s#:!) M+Q+S+X# 0 4=  ) ) T+k c!;:I T+k;K :; c" PTuk c!;:I PTuk;K :; c" ~Tv xT}d Tw c!;:I xT}d ~Tv Tw;K :; c" l%tQ % Q %S %~S ;JDJ%]MU T+k PTuk xTn ow5 T+keeJ PTukeeJ xTn oweeJeeZOO ~Tvee(ee[e!.\e""e#.e$Q+e%7a77k e(e)ooaoe*<<DZDDe+ 0 4=J Q:\*_vThis is the most fermented place in the fort! This is the brewery.This is the fort kitchen! Nothin' is on the stove.This is the fort's shoe shop. The boots on yer feet are all ya need!The smell of mules is obvious here. There's a small mule corral not far away.Shoes? Ha!! Shoes are fer sissies! Real men wear boots!!What %w2?Goin' outside makes it easy to get to the cemetery.There are definitely mules near by!The animals keep the grass short!There's a opening to the outside of the fort. It's a short cut to the cemetery.There's nothin' unusual 'bout these windows.Just walk up to one of 'em!There's an opening in the fort wall leadin' outside.Diggin' ain't allowed here! Do that somewhere else!!No shovel, no diggin'!Ya needs to be in the water!There ain't no food prepared here!You don't need anything here!4 L= hbb!b"!)h+/CX6%T>#:!)h+/CX6%Tj#:!) N+P+R+X# 0 4=qC  ;; ) ) sw 6 sw 8 $=Ort ( ( EBEB F>HA ( H>H> ( d=r, ( ( ;= c!;:I ;=;K :; c" Bjkl c!;:I Bjkl;K :; c" m%R %^R m% N %^N %LP.e.em g> ;+; ,;= ;;G g>e ;+;eeJ ,;=eeJ ;;eeJe q F>g>eeZ ZqeMLdLe [ (TwThis here's the cooper's workshop. Casks, barrels, and other items are repaired here.This is the fort granary. Seems logical folks would store their grain here.There's nothin' goin' on in this part of the fort. There might be somethin' nearby though.The supply of grain is beginnin' to dwindle. Harvest is coming soon and it will soon be overflowin'!The barrels and casks are repaired and then stacked against the wall.Ya cain't do that from here!These barrels and casks belong to someone else.The last thing ya need is yer pockets full of grain!Diggin' ain't allowed here! Do that somewhere else!!No shovel, no diggin'!Ya need to be in the water!The grass is kept short by all the animals!Nothin' unusual 'bout these doors.The windows ain't important.Just walk up to it.There is nothin' important about these walls.You don't need anything here!4 s= ib!b"zMG!)i+/CX6%MQ#:!)i+/CX6%tP#:!) M+X# 0 4=  ) ) MPtT 6 MPtT 8 :ADP EGWS XAjN c!;:I :ADP EGWS XAjN;K :; c" kAS c!;:I kAS;K :; c" ` ܗ&3V a &3T  %L+W D#D %=+ZU :EeP fDyO tPyP zDS5 :EePeeJ fDyO tPyPeeJ zDSeeJe zDSeeZ zDSee(e 7a77k e(e)ooaoe*[e?.e@"eA.eBQ+eE ]Z0000  ]=Ze\e '\e 'e e 0 4=Jhr1G|:QmJThrough the gate ya see the fort's cemetery.This room is filled with bunks. Many weary workers have slept here.Yer in the entryway 'tween a couple of rooms. To yer left is a bunk room, to yer right is the lumber room.This is the lumber room. The wood here is cut at the sawmill in the town of Coloma.The room is filled with lumber.Ya cain't do that right here!All you'd get outta that would be splinters!No time fer sleepin'!The Sutter's Fort cemetery is just outside the gate.The gate doesn't need to be closed.The town of Coloma is located east of Sutter's Fort.Sutter's Mill is located in the town of Coloma.Diggin' ain't allowed here! Do that somewhere else!!No shovel, no diggin'!Ya need to be in the water!The grass is kept short by all the animals!These are just normal doors.There's nothin' unusual 'bout these windows.Just walk up to it!The walls of Sutter's Fort are all 'round, but there's nothin' unusual 'bout that.You don't need anything here!4O = fibbb!b"z{\zQD!)i+/CX6%4U#:!)i+/CX6%KQ#:!)i+/CX6%S#:!) M+ Y\ %Z6# L.k 1zfPzfV!)f+-/6X%\L#zf\ 0 4=  Y\eS L.k Y L.k XI  P\MKN%^W ) ) XRhT iOT QT  6 XRhT iOT QT 8 S\ S3X  6 S\ S3X 8 J:X c!;:I J:X;K :; c" 0F 4F|$|F|F|F|F; 0G 4G|$|G|G|G|G 4Ee^4 0Ee^0 8X|Ee^8|Ee^8|Ee^8|Ee^8 4 m 0 n%P+X6] {6{]{ {x 0 4|i 0 ^0TG ne 4^4TGe| ^8TG|e| ^8TG|e| ^8TG|e| ^8TG|eerejkEEEEEE9eZ 0 4 8eEEEEEEeN\0e\4e|\8e|\8e|\8e|\8ee eKeQ+ee7a77k e(e)ooaoe*e++X{yp,7NkYa ain't got a mule to leave here!Ya let go of that rope you've been holdin' onto and leave that lazy ol' mule behind!What a relief to finally be rid of that spirited, zippy, and robust mule!These mules look the same, but with yer frontier savvy you'll find a way of telling 'em apart.Yer just not close enough to get a good look at one of these brands!Ya already got a mule followin' ya around!Yer right next to a couple of mules. Which one?Ya grab the piece of rope hangin' around the mule's neck and it begins to follow you!Yer gonna hafta get a tad bit closer to one of them smelly rascals in order to get one!!Ya let go of the mule and it wanders away!Yer in the Sutter's Fort corral and it's full of mules!The mule that was following you is too far away. It will stay in this part of the corral.These here fences are fer keepin' the mules contained!The walls keep the mules in the corral.The ground is hoof-trodden.Diggin' ain't allowed here! Do that somewhere else!!No shovel, no diggin'!Ya needs to be in the water!None of these mules are fer sale!4 58= !) [+%SBrfx# 0 4=  9 + ++ +K %PU`e`V +/ 0: 00: ?0k: z0: 0: ;D .;LD ];D ER %E9R JE9R ER S)^ :e :EIRe F_Zoe [_ooe l0y:e vERe _oe 0:e ;De S^e M;\D >[Qeee[ee(e 7a77k e(e)ooaoe*`kk`kk`ww`wwwk e!e" 0 4=f L]&r9St2]w [rThe stones here are roughly hewn; some are old, some are new.These stones are hard to read unless yer spittin' close to 'em. Unknown 1844 J. S. Jern Born November 27, 1806 Died August 31, 1848 Katya M. Brosinske Departed this life on May 19, 1846 Aged 53 years and 21 days Josiah Daly 1847 Died in Infancy Here lies a man whose crown was won by blowing in an empty gun William Able died June 19,1847 aged 24 years Marie Elizabeth Hanforth and infant daughter Died 1848 God Knows Why Hezekiah Smith A Millwright by Trade 1819-1845 This is what I expected, But not so soon. Jose Sanchez Born 1792 Died 1846 Dr. Samuel P. Upton Laid to rest July 1848 Aged 56 years Office Up Stairs Thomas O'Flaherty A fine friend and a loving father 1800-1847 Virginia E. Holden Moved to a better place on May 1846 At age 19 R. L. Burdett 1791-1846 He did acts of kindness and charity as stealthily as some men commit crimes. Here lies Lester Moore Four slugs from a 44 No Les no more Little Arrow Died April 1848 Prudence Blackman 1800-1847 Gone, but not forgotten. Here lies an atheist All dressed up and no place to go 1809-1848 The adobe fort seems well-built.Them mountains in the distance look grand.The ground looks fertile.The grass is quite lush!It's just a dirt road.Yer standin' in the cemetery of New Helvetia (Sutter's Fort). This ain't a very lively place, but it may be interestin'!Incredible idea!! But somethin' could be a little better!Ya ain't got a letter!Diggin' ain't allowed here! Do that somewhere else!!No shovel, no diggin'!Ya needs to be in the water!%g694Efb> >c )o)o ݗ8c 8 )o)o iZ`ww`w?e4 ,reree!)f+-%Q# e^e }e } e e `e e 7a77k ee e Z ee`e$   $ eeg0Pg9Rdf,Pi to return to the cemetery.You must be a genius!!Ya take the letter from yer long-lost brother out of yer pocket and hold it up to the tombstone.Yer already doin' that!That ain't a bad idea, but it'll be difficult 'cause the letter's still in the envelope! Hold it right there!!! Through the holes in the letter ya see these characters: R 2 1 O O M .Ya ain't even got a letter!Hmmmmmm...a cannon on a tombstone...interestin'!Hmmmmmm...Psalm 23...ain't that a book in the Bible?The name on this here tombstone reminds you of yer pa, Marshall Wilson.The tombstone reads: Psalm 23 Wilson Marshall Died January 24, 1848 Mourned by sons James and Jerrod A place in our hearts is reserved for you always The engravin' ain't fancy, but a body can read it, and everythin' is spelled right.Believe me, this is the best position for the letter!Ya already got the letter!There ain't no letter to get right here!This tombstone looks like it was made in a hurry, but somehow seems unique.The letter's already in yer pocket!Don't dig in a cemetery!Ya ain't got no shovel!4hb bw Mie&c cge'ccge(c cge)ccge*c cge+c cge,c cge-c cge.c cgec cg@{$ifA tribe of not-so-friendly Indians caught you by surprise!This swift current has ended your dreams of fortune!This is one powwow you would have rather missed!You may have visions of gold, but stuck in mud is what you've got!Next time leave when the time is right. Your animal team thanks you!It seems that young oxen would be better...but things aren't always as they seem.There is little you could have done. In the desert, these things sometimes happen!!An early winter storm in the Sierra- Nevadas ends your trip here. You were so close...It is no easy chore, maneuvering down these steep grades!The desert was too much for you this time.4 K<Elwx}zx5zxx6zxm9zxm-zxi+zxg7zxbCzx`OzxY[zxV\zxIV zxIV zx:I zx:I zx.? zx.? zx"= zx"= !)}+/6 %$Q!)}+6 %*D!)}+6 %'F!)x+-%6=C!)x+/-%B6 =CF  P#F / /<#L#>#$P6 )w+-/%V# / / $#Q Q Q$ Q% Q1 Q2 QzD QrU  QiY  Qga  Q_d  Q[m  QTn QOv QLx QKz QGz QE{ QA Q>  (+Q3  (Q0| 2 (Q%z2 Q i Qh Qe Qe (+Qb Q c Q e Qg Qu  Qu  H $$zx$ //zx/ {9{9zx{9 yEyEzxyE rQrQzxrQ jYjYzxjY ddddzxdd [l[lzx[l QqQqzxQq IzIzzxIz AAzxA >>zx> 33zx3 5|5|zx5| 0|0|zx0| %z%zzx%z  n nzx n hhzxh eezxe  g gzx g rrzxr 55 rOrO `d`d MxMx 5|5|  p p gg ** Be mYmY Bee HzHzBe e e e gg Beel"S pbFrom Steeple Rocks your team continues westward.About ninety miles west of Steeple Rocks, you encounter the Humboldt River.The Humboldt River is a real lifesaver. It is more like a mud ditch than a river, but it preserves life through 300 miles of arid, hostile wasteland. Tombstones of unfortunate travelers and carcasses lie everywhere along the trail.Although the Humboldt River supplied water to people and animals passing by, there are now other factors to challenge the company.Fatigue is taking its toll on people and animals who must walk day, after day, after day, breathing dust and pulverized dung. The continual complaining of company members is adding even more tension.There were also "Diggers," Indians of the Shoshone and Paiute tribes. The Diggers steal and kill the precious oxen or mules possessed by the traveling teams.Goldseekers who have lost their animals are also resorting to stealing animals from other companies.Here the trail forks again, requiring another decision on the part of your captain. The choices are the Lassen Cut-off or the Truckee Route.Captain Buddy decides to take the Truckee Route.4X;8<plx}8I8 8Izx5zxx6zxm9zxm-zxi+zxg7zxbCzx`OzxY[zxV\zxIV zxIV zx:I zx:I zx.? zx.? zx"= zx"= zxB zxB 8 zxzx#zx/!)}+6 % B!)}+6 % D!)x+-6=C8I% 8 %,# P!)x+/-% K6 =CF!)}+/6 %O! ) + / 6 % O!)+6 %6F!)+/6 % +C!)+/6 %+C!)+/6 %%+C!)+/6 %3+C!)+/6 % HC! ) + / 6 % HC ! ) + / 6 % %HC ! ) + / 6 % 3HC  }9}9 P#F //<#L#8V ZSZS /$$K $O# I ) #QFLP###### # #  (+/IL e-eehh>#$P6 )+-/%a# / / $#Q$ Q& Q( hQ,h H Q8 Q{9 Qz; Qr>  QoB  QcF  Q_M  Q]P  QIV QE[ Q=] Q3 Q4# : +pe_e_e H zx ""zx" ,,zx, 77zx7 u>u>zxu> jFjFzxjF _M_Mzx_M TVTVzxTV IVIVzxIV ?]?]zx?] 4f4fzx4f 3r3rzx3r 3~3~zx3~ ,, ye2w gcvl M$Y kZ~b wcl  /BK gcvleM M$YeN kZ~beO wcleO eP /BeQeR gcvleMeS   e gcvlYh heee Hhh e'e(e)e*e+e,e-e.he1heeh heeeeee9T gcvlHh heee Hhh e'e(e)e*e+e,e-e.he1hhe4e9^T gcvlHh heee Hhh e'e(e)e*e+e,e-e.he0hhe5e9m%m]%$x]m%C gcvl7h hee Hhe8he/he7he6e9^^^^^^^^^^^^H^HU gcvlIhehehehhe3 Agceeeeee hee: e?e)eLeK eJeIIIeHeG eFZ  ,|9eEeDKeBe@eA0K00KeC=eW==)``))eT[0eUZIZZIeV<<<ZZ<DZDeXeYZeZ ]Z0000  ]=Z ) )00 0)0 )e[Z)Z)e\e]@e^H i @@Wi J JX < ??U@@YWWYK KV l_A^J;, l*?I ` P  E O % e j&P"?p/d+h,#hThis is the camp of the "Long Island Joint Mining and Stock Company". From the north edge of camp there is a great view of the Missouri River and the plains.You find the man who appears to be the leader of this company and introduce yourself to him."Welcome to the 'Long Island Joint Mining and Stock Company', Jerrod!", bellows this seasoned-looking man. It is grrrreat to have you join us!"My name is Captain Buddy; that's right, Captain Buddy! I'm going to do everything within my power to take this company safely across the country to California!""You're a bright-looking young man, Jerrod, and I have an assignment for you.""When the plains are turning green from the growing grass and the mud is beginning to dry, we need to make haste to the riches in California.""But in order to do that we are going to need a fine team of animals to pull these heavy wagons.""I am charging you with the responsibility of obtaining these animals. The company fund will pick up the tab.""Head south into Independence to find the teams and report back to me when you have accomplished your mission."That is very generous of you, Jerrod. But you have done your part. Keep your eyes on the plains.There is no need to contribute any more. What we need are some animals!You don't even know this man. Hold your horses!"Before we get too far, Jerrod, there is something you need to know.""The company fund is running low. I am asking all of the company members to contribute everthing they can so that we can all make it to California as soon as possible.""Thank you so much, Jerrod!!"You report back to the Captain Buddy, "I think that it is time to head west!"Captain Buddy bellows, "OK men. Our scout Jerrod has determined that it is time to break camp and head west!""Let's hitchem' up and movem' out!!"You report back to the captain that you have secured a team of animals and they will be delivered to camp later today."I trust you have selected the right animals to pull our wagons across the country.""I have another assignment for you.""It is up to you to determine when our company should head west.""If we leave too early the plains will be muddy and the wagons will sink to their axles......and the animals will not have enough grass to eat.""But, if we wait until the plains are fully green it may be too late. Then we will face the gut-wrenching thought of encountering an early winter storm in the Sierra-Nevada mountains.""Report back to me when it is time to head west, Jerrod.""How can we do that, Jerrod, without a team of animals?""Where are the animals, Jerrod?""How is it going, Jerrod? Do you have our animals yet?"There is no one close enough to talk to.You reach deep into your pocket, retrieve all of your remaining cash, and hand it over to the company captain.What is there to tell him?What is there to report?That is a little presumptuous on your part. Shouldn't you find out what is going on around here first?"You can't do that with us until you make a contribution to the company fund.""How can we do that, Jerrod? I'm waiting for you to secure animal teams to pull our wagons!!"You are not close enough to the captain.You should give that to the captain, but he isn't close enough!Talking to this man is useless. He's sound asleep.This man is engaged in an intriguing conversation with the captain.The man sitting on the logs says, "Hello, youngster! I'm glad to see we've got some young blood along on this trip. We are going to need it."The pig roaster says, "I got me a pig roastin' on that there spit. I kin hardly wait ta sink mah teeth into it."You don't have a ticket. You gave it to the man at the livery in Brooklyn!There is a pig on the spit over the fire.There's nothing quite like the smell of a wild pig roasting over an open fire.There's a barrel over by the fire that weary travelers sometimes sit on.You are young and vivacious! You don't need to sit down!!You can't do that from here!"Leave it alone, greenhorn! That's my hatchet!!"There's a hatchet stuck in the log by the fire.The spit is stuck through the wild pig which is roasting over the open fire.Every camp has a campfire!There are many logs lying around camp.Just one of the many trees in the Independence area.Since tents are so mobile, you will see many of them on your journey west.These are the wagons that will take you and your company west.This man looks like a born leader!This man is sound asleep.It looks like these men are involved in a deep conversation.This man is sitting on a log enjoying his pipe and the fire.The man is watching the wild pig roasting over the fire.There are several folks around the camp.You are not close enough to the %w2.You'll spend plenty of time in a %w2 once you are on the trail. No need to do that now!!It is typical Independence grass.How, or why, would you do that?Enter what?It's not done roasting!It is a very nice pipe!Just let the man keep his pipe!You're having the adventure of a lifetime; there's no time for that!You can't do that; they are company property!OK. Go ahead and listen!There is a good view of the plains from the north edge of camp."Excuse me, sir. My name is Jerrod Wilson. I'll be going to California with you."4Rl ~bz~/Iz~o!)~+ /%aX#FL!)~+%1mX# !)~+/%nX#Fz~n!8O)) # d/Id1 d/I 2IK  BB ܥ&2u C &3rr hܥ2/2/&2+t  p b&t &C7N [tqV b&t1 # "e \cz~n$ &C7Ne [tqees b&t e eZZsssssH b&t1 e# "e \cz~n$ eeL c+y Snu <>S2 c+y ee Snue <>See e)ee eeIIe eZ eKee00K0KeeJes eZZJe=`e=)`))e#[0e ZIZZIe! ]Z0000  ]=Z ) )00 0)0 )e[Z)Z)e\@e]l]? =mQzLB_~!X]1 The man reading the book says, "It is a beautiful day to just relax and read a good book."The man says, "We better enjoy this relaxing setting while it lasts. Once we are on the trail things will be different!"If this man were conscious, he just might talk back!This man is out of breath from chopping wood.You are not close enough to talk to anyone.It is average in size with a black cover and the pages are edged with gold. It appears to be slightly worn out.You can't do that from here.You already have a Bible and you don't see another one."The going will be tough in a few weeks so I'm enjoying every moment of this easy life!"You graciously receive it and say, "Thank You."There are three people around here. There is a man sleeping in the tent, a man relaxing under a tree and a man working hard with an ax.This man is reading a book.Sweat runs down this man's face as he splits wood for the fire.This man is sawing logs of another kind!He is just enjoying a beautiful day under the tree!This is the camp of the "Long Island Joint Mining and Stock Company." From the north edge of camp there is a great view of the Missouri River and the plains.These are the wagons you and your company will be taking on your journey to California!Tents are the most common dwelling place on the frontier.This is just another tree around camp.There are logs lying all over. These are just a few of them.Every camp needs a campfire!There is a man swinging an ax.The ax is not yours.The barrels are used for resting weary bones by the campfire.You detect the faint smell of roasting pig.Sitting down won't do you any good.The man is attempting to chop the stump into firewood.The man is creating a stack of firewood.Just leave it there. It will help the woodchopper think he is getting something done.You can't read the %w2 if you don't have it!You'll spend plenty of time in a tent once you are on the trail. No need to do that now.This kind of grass is all over Independence.How, or why, would you do that?The man continues, "Since we'll be traveling together, I'd like to give you something. Here, take this book. I'd like you to have it."You'll spend plenty of time in a wagon once you are on the trail. No need to do that now.You're having the adventure of a lifetime; there's no time for that!You can't do that; they are company property!There is a great view of the plains from the north edge of camp.4 Ql C~bz~Y !)H܂&#OLPT!)H܂&#OLPT!)H܂&#OLPT!)H܂&#OLPT!)H܂&#OLPT!)H܂&#OLPT!)H܂&#OLPT!)C+%#F!) #ZG . ( %:      6 * ޘe 1 -eeZ$Z$Z$Z$C 7eZrrZrrrrZZ2 &eZ2 & eZ@ 4hi  e@ 4 hi  e33@ 4 hi eC 7 hicݗ e/ #  eZ33= 1ehi eZ@ 4ehicݗ e\e#\\ee$eereKejx~e ee  2   e!Ke%l%UL'b;yNpR5 The man says, "Hello, young greenhorn, what can I do for you today?"The man says, "You've come to the right place for that!""This is what I have to offer you; mules, young oxen, or mature oxen. Which would you like?"The man says, "This is a lovely time of year in Missouri!"The man says, "What a beautiful day!"The man says, "Mmmmmm! I love that aroma!!"The man looks puzzled and says, "You already have a team of animals. You don't need more animals."No one is close enough to hear you.The man says, "What type of oxen; young oxen or mature oxen?"The man says, "These mules are mighty fine animals. I hope they will do a good job for you.""I will deliver them to your company camp before nightfall."The man says, "What about `%w1?' Speak to me clearly son!"The man says, "What about `%w1 %w2?' You're not making sense son!"The man says, "These are very strong, young oxen. I hope they will perform well for you when the going gets rough."The man says, "These mature oxen are weathered, tested, and true. I am sure you will not be disappointed."You don't need to open the gate.You need to get closer.There's a rancher in the corner of the barn watching the animals.There is no %w2 out here!It is just an old barn. There is a rancher in the barn watching the animals.This is the corral just south of Independence. There is a rancher in the barn watching the animals.The rancher keeps the mules in this corral. He also has oxen, but they are in another corral.There are animals in the corral.In the distance you can see a few buildings that make up part of Independence.There are a few trees in the distance.What about %w1?You're welcome!It is a corral gate.Nothing special about this lock; it just keeps the gate closed.If you do that you just might get kicked in the jaw!4Z -l ~!)~+%x6FL!)~+%b6FL!)~+%"d6FL!)~+%0{6FL!)~+%0d6FL!)~+%>d6FL!)~+%>{6FL!)~+%>6FL! ) ~+ % K6 F L ! ) ~+ % K{6 F L ! ) ~+ % Kd6 F L ! ) ~+ % Xd6 F L ! ) ~+ % X{6 F L !)~+%X6FL!)~+%h6FL!)~+%h{6FL!)~+%hd6FL!)~+%xd6FL!)~+%x{6FL!)~+%g6FL!)~+%!{6FL?///////// / / / / ////////?///////// / / / / ////////?///////// / / / / ////////?///////// / / / / ////////?///////// / / / / ////////?///////// / / / / ////////######### # # # # ########!) #ZIIIIIIII I  I  I  I  I IIIIIIII vCr<222&&22%2D%%C2C2`%`C2_&2s'2O&22N2e%NC2d2%{Ce@A[B%%? ee e (e e0ee==)``))eT ]Z0000  ]=Z ) )00 0)0 )e[Z)Z)e\l\~Z p PYou are on the edge of camp overlooking the plains.In the distance you see the Missouri River.These trees are identical to the rest of the trees in the area.The plains are still brown and muddy from the cold, wet winter. There is very little grass.You are standing on Independence ground!There will be many more just like these!Your keen eye has noticed that the plains are growing greener every day. The mud is beginning to dry.The plains are covered with fully grown, beautiful, green grass.You'll spend plenty of time in a %w2 once you are on the trail. No need to do that now!!You're having the adventure of a lifetime; there's no time for that!You can't do that; they are company property!47`l b!)+-%g6 X#F!)+-%#k6 X#F!)+-%:u6 X#F!) +%i#j eejj+"je$eOe*ejje e jGOe $ej,#je $ee Q:uG Q=u QG QV Q^ w Q#kG Q0k Q=u QG QV Q^QgOG Q)q w))    ) #jejceej  e*)* * )* *)* * )**)**)**)**)**)*Oe ce O) Oe ereee]eZZ/jjjjejej eje))w)w)/jjjjejej eje))/jjjjejej ejeZ)e(hhe3jje!jjej e"jje#e$*)* Oe%e&*))***))*e'e(Ze)l* V5%Y[tOdx/uRvW r ~  The captain bellows a command and the animal team comes to a halt.You are at the top of the steep hill overlooking the Green River.The wagon begins to move so you jump on board to avoid the long walk down the steep hill.But, the only reason the wagon is moving is because the animals are very, very thirsty.The animals give it everything they've got to get to the water as quickly as possible, and they are taking you with them!That is a brilliant idea! As thirsty as those animals are, they would have pulled the wagon, along with everyone inside, over the edge of this steep hill!You are responsible for saving the animal team, the wagon, and the lives of your fellow company members! You are to be commended!!Using your Yankee ingenuity, you put the chains through the wagon wheels to keep the wheels from turning.You have already locked the wagon wheels with the chain.When the oxen return, refreshed and ready to go, you assist in hitching the wagon.It looks like the company is ready to attempt the steep hill.The wagon starts moving so you courageously get on.Once again the wagon begins to move and you jump on board.The animals are holding back with all they are worth, but it just isn't enough.The wagon continues to accelerate over the brim of the steep hill!Things are looking good!That is a great idea but it is too late now! The animals are already headed down the steep hill toward the refreshing water below. All you can do now is hang on tight!!There are chains on the wagon next to each wheel.These aren't horses!These aren't mules!The wagon and animal team are at the top of a steep hill. In the valley below lies the Green River.Eventually, you will %w1!You already have a team of animals hitched to the wagon.They will be right back. They are just going to get a drink of water.There is no need to; it isn't moving!It's too late! There's nothing you can do! The wagon is gaining momentum every second!!It's nice to know you're willing to help, but the animals have things under control this time!No way! This wagon is heading west!You already have a wagon.The animals are pulling the wagon over the crest of the steep hill.What do you want to %w1?The wagon is at the top of the steep hill. There are chains through the wheels to keep them from turning.These animals are thirsty!The animals are unhitched and heading for the fresh water below.The animals are refreshed and hitched to the wagon.You are at the top of a steep hill.The chains that are attached to the side of the wagon are put through the wagon wheels so that they will not turn.You notice some chain attached to the wagon next to each wheel.This wagon has no brakes.How?You can't get the chain, it is securely attached to the wagon.Even though the wheels are locked with the chains, the animals pull the wagon over the edge of the steep hill.4 lb!)+/-%^!6 F!)C!)!) 9Gj5j+-%Y$6 #S+-%U,6 #S+-%S46 #j 8j +/-=%^!6 #F+-%U,6 #S+-%S46 #j3j#+-%Y$6 #+-%U,6 #S+-%S46 #j ( (j"j+ / (<LI$$jb2 ( ( ( ((je.hh3Tj j+++j  ( (3Tj j ++j  ( (3j j QMF Fj FjGNNGSj ( (3Tj j++j ( (3'jj 9vj ( (3Tj j +++j  ( (3j j! e 9 Hj<EE OSO OSO"e(Z(e(e0]]0e]e)e)ee e *)* * )* *)* * )**)**)**)**)**)*.jje Oe j j c Oe*)*)**))*e'l'pPc:b)EiVCongratulations!!!This is the treacherous Green River descent!When you get to the bottom of the hill, there will be plenty of water for drinking!This is the Green River!The only way to get down this hill is in your company wagon!Why? The goal is to get down the hill!At the top of the hill are wagons which have yet to attempt this feat. Strewn across the side of the hill are those that have tried, but failed.The side of the hill is covered with wrecked wagons.This is very rocky terrain!You get a distant view of the oxen.It's too late for that!You have already brilliantly locked the wagon wheels with the chain.That will do you no good now.While the animals are getting water, you put the chains through the wagon wheels to keep the wheels from turning.This wagon has no brakes.43wlb8Xzi!)+-%~8J#!)+-%P8J#!)+-%g8J#!)+%#8XI eeeex)/I e+hh8Je6e7QQQ  $  $ $  8X  e9 H e#  % M 9)/I ee5h%2M 9)/I ee4hM8Xe ee e e e77(eZ(''D8Xe8 !g:o,e,ce e!e"ee8Xe ee)8Xee )(8Xe g?qe:ee(r8Xe ee=))8Xe e2eK(K8Xe !g:oe8eZKZ(K8Xee8X e$*)*8Xe% e&e'D(8X  g?qe)e*e+<Z<DZDD8Xe-8 !g:o,e.ce/ e0e"e1 K (K(K(K(8Xe !g:oe,e3e;l;] x\yT &a-UOg?c@z;{ > U / p 5 e  " @ You are alone and stranded in the middle of the desert.Those young oxen, lacking the stamina of mature oxen, died a few miles into the desert.You have been walking for miles and are dying of starvation, thirst and exhaustion.You can't go much further...The animals are very thirsty, but they aren't dying of thirst like you are!!You are extremely weak from lack of food and the intense heat.The animals are also weak and hungry, but they are faring far better than you.You aren't sure how much longer you will be able to hang on to the already thin, and ever thinning, silver cord of life!!You are in the middle of a desert. There is nothing near you.This is a desolate trail.There are a few bushes in sight, but they are very sparse.You can see hills in the distance.Cactuses are a familiar sight in deserts, but there are none in sight.You have nothing to dig with. Even if you did, this ground is soooo dry, you'd never get a drop.There is no water anywhere around here.There is sand all over this desert, but it is of no use to you.The animal team is barely alive, but continues westward.There are no animals in sight.The animal team is leaving you in their dust!In the abandoned wagon you see some discarded meat.These animals are oxen!The animal team is barely strong enough to pull the wagon by itself. Any extra weight at all might do them in!There is an abandoned wagon near the desert trail. You see a barrel on the side of the abandoned wagon.You can't see any water right here.The oxen are miles behind you lying in the desert dust.There is no wagon in sight.From here you aren't sure if the barrel is real, or just a mirage.There is no barrel in sight.You don't need to carry around a barrel.You drink all the water that remains in the water barrel.But you still need something to eat or you will surely die!Now you must try to catch up with your company wagon.Your company wagon has no food or water. If you follow it you will surely die.The canopy is ripped, exposing part of the inside of the wagon.There is no wheel in sight.The wheels of the abandoned wagon are half buried in sand.The wheels of your company wagon continue to move westward.You can't see in the abandoned wagon from here.There is no more meat.The meat looks old, dry, stale, and walked on.You see no meat right here.There is no more water.There is no meat anywhere.There is no more meat.The meat looks repulsive, but you are so hungry, you eat every bite.You still need to get something to drink or you will surely die.You can't see any meat.You don't have the strength.You see some water in the bottom of the water barrel.You are too far behind your company wagon. You are left by yourself to die in the desert.Your body is too weak to carry on. It gives up.You are suffering from severe thirst and starvation. Life as you know it is nearly over......unless you do something quick!This is no mirage, this is a barrel!You are on your way again!You see nothing in the wagon.You can't do that from here.4h  b zW; zqT zzGb zPz5Mz\zWzSzgzYz;P!)+-XC%z#F!)+-% #F!)+6 %TH!)+/6 %ZM#F:!)+/6 %VT#:!)+/C6 %K#F!)+-6 %#Oiw # # (x #3  $h=6  #4GQ%zGQFMFMFF >i@i QPi (+/;$M'  xsw  #($ 9;IcI32/ c cw~ glY"Come on ya yellow-bellied coward! No one's gonna walk up there for ya!""Not that way, ya low-down slug! Walk straight ahead!""Not that way, ya low-down slug! Get up those stairs!"Do ya got any last words?Last words: Ya utter "%s1" and the trap door falls open...It's an utter pity that yer trip to California turned out like this, ain't it?4P    " *,,*)*(%##%&&$ %!!# $$$%'((*+**,---** ) )*)$ %<  ,C7%66"%)) aT%& $#*B   *%!* )$ $, **!#Tc  2UEGHIJJIIHGFECA?<;;:;;:~:~:|7{7z6y4|3443546778Tc02)1)1 !  aZ * T^ L * , * ) )* - )  )**0*: *!; A" !: ɑ7â ЙZ'[-X6Y;\=\A^A^D]G^L^QtRmSlUhRgUfSePeOfKdPeSw - S QY♣ nªʛv`mj$$# 4 #1$!;49+R9C|2s)<k)0)$* ), _ = XOnwlokmilgnfick392ls<| 7s8tgc bdbb_^]]^^_]W[=$ * -  ; +  ^ _`^ U]V[WZYVZU4Y3W2S8T AM -DCD;E8E0C.A ?=;:KZ39[7h:r4z>9zMXJ]XcWb^]U^ZW[V_P]S\]KMOQS T!WC^D_E`ahbiegacdab_GHIF_5y:}JZc  ()(*21:=@CF R!R#X$\&_"ZWUZ`^Z ^`!c#c%f'l(o*k,o/r2t3w5v5t2r1q2p6r6p4m3k4e3d2]0Y3Z2U4U*7N&1! BM",N`b%#!5FHKKJHEB@<:;::4546789  (+.24BFHJL#ZVSOMdb c"d$f%h)o/s1t2v3y7u;z6o4l4i6e3`2\1Z6X7W7T7Q8S:U>W?Z@[B[K[M^K_I`DaB_?bt>}BDFIJHGFED=:9}6|58>   J T   >m*)2" 10#PQTY^bbeg xˬ ˼MS - = ; MTG\]'a-e9%g>hFhHeYFBpdqirnsyvwzqxwuphplwntlknjnhpilcedbeba_Y[YXT\7e>gLcJ  $)*/<AGI!L"N#R&U([)^,a-f0i/l,g+f*d&`$_%b'f)f*i+k2d (P(H%F$>:43.*()%9!!  -o0) 6)(e%`@k8/./201/ .*!)&"%&'(&*(-)2+6-6,:.=.C0E1K4P3T5U5J3@1:25/2//.,,&,#.!2"3&5+51777=8>7B:F:LG=D=?FH$G,F2F:G?FEDLESGTKLLFNAL8M2L*M#LJK NNLE. )% .259<AHJ-g.i(i]$&+N0\/#10535:7?9I5F6L4S6V='=AE=3n3u2s6:>BDA{?p:k;l;iEgq7v$xz%~'()ERQ%6?HPZ_bgih}j}mn"CJJ2sx|t{goXj1i]jFwue77788887}6}6|9~999E[EZg%g&h&h'j'j( 7!%+2|6x9t8o7n6j6i8f9b;_@]B]E`H]I[LXMXO[Q_S`V]XZ_P`PbNbJdEdBa?b=d7d0c.c-f)e%4  "       # $ $ % ' ')17:>CK K I L O KLP R V ] a d edhiklqswz}~&=$  2$#"Q    * :"  ) ! )9  )) 5}}~~~|xtrproljeda]\[ZYWUWURQPOOPOONLMLKJJGHGHGFFD?FIMMJEB=@C<7563//32/-+,*(%%&()'&#"  * =Z )!)<*!*9) n+g(f5g9h6i:i~?b?^J_M_W^?^4] Y/C+#9 ^`^gipqs*A3DBFA^?^?a@bGcGnHoInJpMqMrOqPsQqSsUqWsYsY}Z[Z2~2!! "CFIIJKNNP! ɱ*5>&P&=8K9L:L:N9O:O;P;<=,-,**-+A.)2-T1H#L NP&O)P+Q4Q5Q=RCRETJSKULTOUPVQVSWTWaYsR  ѴW`c_d`cbebf\cUbUbTbScPaP_K^F_D_B^A_@`@a=a;_9^6^5]4^1[/Z/Y,Z)Y$Z#Z!Q5]4SH\G]HeciavZwf^@ j\vZVRdhofyc|aabadnnu~v}~}jgjzkrettuwt|u}yd E!{Yf[*0 *)""!*   #yTi=jJiMjQiSf8_!20r:o;qJEE=}B{5{>B)}3}4/0224589;<4(2,J'J t6u2 G 4 ᵳ i&h2h;f?d@cFbLbOcPbSbR^S]R[SYQWSWT4Q ##}#}$#$#%}%}&#&#'}'}(#(#)})}*#*#+}+},#,#-}-}.#.#/}/}0#0#1}1}2#2#3}3}4#4#5}5}6#6#7}7}8#8#9}9}:#:#;};}<#<#=}=}>#>#?}?}@#@#A}A}B#B#C}C}D#D#E}E}F#F#G}G}H#H#I}I}J#J#K}K}L#L#M}M}N#N#O}O}P#P#Q}Q}R#R#S}S}T#T#U}U}V#V#W}W}X#X#Y}Y}Z#Z#[}[}\#\#]}]}^#^#_}_}`#`#a}a}b#b#c}c}d#d#e}e}f#f#g}g}h#h#i}i}j#j#k}k}l#l#m}m}n#n#o}o}p#p#q}q}r#r#s}s}t#t#u}u}v#v#w}w}x#x#y}y}z#z#{}{}|#|#}}}}~#~$$$}|}|$$$} !!""XssVVssWWsshhssggssiis333333|33}~3 3 !!3"3"#ss##ss##nn""gf##gg##ghcchhed^ _$$ZX$$V35Q!"@!W X ^`^ejlmpqstttsuUZcW"Y&!` +,--,; > DZaYk n0s  Ѳ1  !#  "&  %4&%)!K!94)921!9L0#QJ+0" j|)*s|)*{a -ݽ+) ʰ {%{now%5 {h I;1*¹ +@. ܫK* 29*:.%=%>(<*:)7+5.2///-2.5/82978;:==A?D@GBGEJGLJNHOEM@J=J7H4F5A6@5C5F3I3L7M8L2J/I.I*H'H%J%K+L,L/N1O4N6N;O>Q@PAPCRFPJQOPRSRTPVPWMXLWOVRTRRUQZP_RaSeVfWcY]YY[VYZZ_XdXg[i]g]d\b]Z]`^f`faa`\_V]Q`WbX_Nc[b_cacfeihkkjnhoflcjagZiTjOiMfNdL_I\I[GXIUHTDWHZF]H_G\DXCW?UcBACADB7&-409/<=9:3<4=8A]c'%%1@%5:L6K%X7`UaWOlalWrr|s{tyuxpz{bn`pU`%_+`3a5d5d3c+i' {etisqttq|tiodp\oVnIl@m=odˮ , `8\0](]%V,:3X4$!4X8!i3h?iJeJʪUF"I1c@d:b2a)b%e)riѢʪ :QT̬DA<>:;896859EEй˼6%ѲI%%E5) $Lk;IYq0;A;_V%a[bech]_%Y]4^ " - Q   $+R*# P-" 2 (3 F S x PL F=:3  $(7< BBFDGI#I*L-X,c/g4f8gj?sCxEGHHLUY\^]akrz~{z- K"=Y-- snc\TMGB>4)  'r 9*}|xxyxww{{~{~}~}|{zzvsrpnmmigeda^[WVURQNMJJM}LzHxExCvBuAv@t:s9s5q3p1o0n0m/n-n)m&l%m$l"k jhhgfg gfg ffjk"l$k%l&n*n-l/n0o1p3s6s:u=u?uAtAvCwCxDxFzI|L}M~MNKKLMNOQRTUV[\_a~defgilnnpqrtwz{|~~`J2)A")+@Y49 ,0# )# D"" )13 "4 0!%"!*"1B1")"*"@!# 10,*rQlV43"$kdC#ec"$bc`j_r^t_x]y\}][Q1(?F!&"5"OCOKNSOXN\3#! !,*0"$(9C12C#J"TC9A9BSAb#-M.W/Z.b/d3e6d9e;h=g>h@gAi@lAsDuEyG|FHIx"oo nX*2+$W# 4A3!3Y$)@Y*"##&1# !#)39[;" +YUH3|$ $'%JRSW\^dglmpsuO!5=BHLMT# 21!; *+ ;+ )"@120+))L,),) &)Q'*123!B;7!2>;"!#EF#IS!LM GSFO8:Op1)Zu!]h)PZP]!*))gm!ix"9!* “{xtxndB N) aH c9!)1!3 c3 i( ii iih! m p)*1.#4&7D M+_{)`~1f~ t2 "9):[g *b"*S}`I)#)o%,wvv-v3v9!!zC#!}> %#ɪ%  ɪ ɩ{FD" [ !*A@1   )@)1)9% - . 0-=%"$'?8%+)2%D'"LOKM FF?;!;722')&'"*ӹʐ,QZ1+*/0) 2!6!9%:!Q"2A*"+1#2 DQ EU"$0!42MJJ19":3ahnruw{kc9AI90)I*IA,J))J ++Z9ts+Q*,VNUf Z-H?61%)36-)&$ :E=F B81*" $'BC;9!8#9$:#;!B!D*F-I1J4NDMTNWGUGQFNGLCMFJFECB@A><=9A;9;886748462817-4&)$!,".%0'4*7-9.85<0:/9,;(:%5#2"1.4+*       Ր  !KGHK JKLMQ RSUhikmm nqosu wyx s[\]\]^_a ^!`%l-k)i)l'k&k#idh|{ z|x!w&v*u.u3].\/]1^5_6_2`5a7b9aZ;\;]<\>^>_A]A^C_E^G_KaLaIcDdG~ $8?AGOA>:3*'$" $#07%l,%<,E8BIDO#IWV/WJcQkMvUw_9L6S,@]Gh I|.0E 7$:N0 ) # h]RmWvMZc|tC~nwSHJz8mp v(%Ml6c/c^>6NOPRS   xڠɹ ˩VlVdVaU_TYSTRPOOKNKMIJHFFCA<>9:96939.6-6,7+5(1$.!+*'$"  4w ,|,|--.|.|//0|0|112|2|334|4|556|6|778|8|99:|:|;;<|<|==>|>|??@|@|AAB|B|CCD|D|EEF|F|GGH|H|IIJ|J|KKL|L|MMN|N|OOP|P|QQR|R|SST|T|UUV|V|WWX|X|YYZ|Z|[[\|\|]]^|^|__`|`|aab|b|ccd|d|eef|f|ggh|h|iij|j|kkl|l-{-{kk- d <<cc<<hh<<kk<<nq<<q<mrmrnnororppqrqrrrsrsrttururvvwrwrxxyryrzz{r{e||ik||lm||otyD HQSVsQm#D+|,u,m>|>p?mGm1)"*"XmYqY|Ywbvbmbtc{b|j|jm.|0d!!|2E&.2)213242668=8>:A:D>I@K?L>NAQ@S?U@VDYG]H_F`JbJdMgMjPnPsUxWzV\j1j +̺-'.G:D5A5?2>0>-<-;(8&6$4&2&0$3"2 /.7A  ) * :1"*"!4Q++))CD# "*D˱AeA0aK24!0 ;9YK,)AL[SZV[Y[\]`cdfgeifjhmhqjGXNWQVUXXXZVVTOTIRDPCSFW4E)1"%9I.#>)K*A)B.D/F0H2G4F0J.MCJTMTJeYlZn[9S8V6W2U0T.S,R+Q*P(O$.'2q^zimjVVCW=\4b3d2g2X3D+F(M#9 zawcpclahac^b^`[\XYTWRUSRQPSKRHPDOAN=J:H9F7F5C3@.>,?)=(:&9$5"456"4 &13j +)+9*@Y iPXWZ\YA\˺5E&:$46    !!""##$$%%&&''(())**++,,--..//00112233445566778899::;;<<==>>??@@AABBCCDDEEFFGGHHIIJJKKLLMMNNOOPPQQRRSSTTUUVVWWXXYYZZ[[\\]]^^__``aabbccddeeffgghhiijjkkllmmnnooppqqrrssttuuvvwwxxyyzz{{||}}~~  9AKQ UV]`f$j&m+m-o-s*z)~()NWakeb\ZWV}T{PwOsKoLjLfFcA_?[@U>N?I=D7@4:343.0*+&)!)(%! !f$!! " !!'  !&+)#9.001""  !8 91#:";0%;$< '=%?)'>'@!)2.B-C 0C0D)2C1D)4D3E!)7F6H09H8J!! CPAOBN@K?K>H : 0FMDO GPEV:ITHW02!;0 * !)  `X]W_S !*0! ncme2)*1"*}m ze{dxaD$)e}h )mp!)302") w˛ʫh3#)B#2+ - 1.0!15"781 9;  < >! A BD E12ILA1* GF*DA)@ ; I)""<?0?@02!BPQ1TT1B )#W!V* &S%R*  0223Q2R !29U7V8X"%WS1R15^4_0) :] :\)<[ :Y1=Z<[0 B]@^!B_Aa2AIh>k)@j V%KIUHSQ]IgTp^wW˃b,fl B?.99,;$'1N. @G|QuG\vf{v'&&'87 ~{|zyusopmlkkjhjdi`iXjRkNkMjJhIgFfEfCdB`C^D]C[@Z=X>?m?m@@AmAmBBCmCmDDEmEmFFGmGmHHImImJJKmKmLLMmMmNNOmOmPPQmQmRRSmSmTTUmUmVVWmWmXXYmYmZZ[m[m\\]m]m^^_m_m``ama*l*l``* d 9 9 dc99ch99hk99ln99q9bcbcccdcdceefcfcgghchciijcjckklclcmmncncoopcp q feqqijqqlnqqo9=GHQSTb,q-b>q?k?b@bGcGnHoInLqOqWbXjXlYqcicbUqUqUqUqUqQqQqQqQqQqJp e)!!G S)"+22*!S@*$$2$ ;*)",1"%!3:,)2)kL 6#;2TB_^_ kR;)+P+)3@ * M+ = - OA!#ME : ɚ,N R* + ,)*1;"+ ) !0: ** 02* +*1)4#1@9 #!)+"; "BF1I2*"F> U7%E)K(M:H;F9J7KAV@S@JDFBGED?3=5E1H4J7I??FR8Z=dLM"9>6C5B1D0F/G0H2M3L;E@DC/J*M)O(I7N>??@@AABBCCDDEEFFGGHHIIJJKKLLMMNNOOPPQQRRSSTTUUVVWWXXYYZZ[[\\]]^^__``aabbccddeeffgghhiijjkkllmmnnooppqqrrssttuuvvwwxxyyzz{{||}}~~G.*?66521,:L2 ")I"$!9!b+*B*B:9.@/B.D)H%K%N'S%X#[%^(`'c)h)k,p.t,w){,-025:97 3 &#" Z/J)0IJ/)5!) 2+ 6.; 4 +> 97@B/:! * U,Q+=HJ"+ B1)" @3ID:@# 3$7475M L*!H* !)D9!)BA*"!ʱ1!@!;+= 1*+ G1!:;99* 0# "9 !!:)*< *  :1! : *"*)0!)!B""! !)  F:19!9A:*  * * )2:)#eڪ HڠzZ]);9uS+ +"oR>= lL , -eF< -cP [R H**+  K`MUMYMSNQQPRKTGUEUBVAW7@DI 1*"B@+" A1*G')  2=)1C:! 6A!8?"2)-G#2I/H8Jl8L;L>JBPPIOPb)`) b_+!!\BQCU+>^)+ <\*8^! 9a)*>`.X*: *6Y!,V K,]) 5]/]ML+[2=!Q5L7!AA12!EINFQDS@U>V:OBKFHGFHS6W4")U=#REVPSVlTUBRbRgIQoJrIoHmJnJqIjHcFc,ISIXU&$R'Nb, d- e-Q@S.MR0P1CP1R0I0J/Z>)^?*`:f9)|. :I3#9#̑9D)F q9 |*)*02*@1:hᛠnq) *p ~h+jw+tp_**w_|Z!:]~Z5bXTJ))N+ xT*sS);!|Tx>+* r<+mPm9-,gF bD*::~=!) )A !* )MI CM ERR4!c_02I!)9A9x012! v2{G\NY?"#!h9WKYQPSNWJ{) ] ")* Qb eh0!kk9* 9!}0<,k1P)C$Q|W;:JFB*:9:=~<)w-^/ S*9 kklpnpu}w|x}y~xwqtz|fefgh_TRNDA?=<;?@DLRUVT@~8v0u2O>[+Z'Y&Y(Z,W(X'MZM_NgNnOqOtNwN{M|K}J~IH~I|L{MyLwLmKiLfKcGD›{H|B -єh8dEk8i=cQYPWJQQPVKSU? JMKOLTOTXHXAYEZRbNdPdHgAi:f7_6r5t4x6v:uZ=`RRZO|[&Z%X$ :\;!Ҫ ّBPB2Tѩ(R ;\ʡc# E– I!A 3 991*)9 J # !9": "QEá092Y) ))IZę LJAY))SBOFMGKHIIKBI@LAD D#7"98@:2C1D/H*yCa@ ~iZ~19.]R/3R ) "29?L1AH\-FK6Sg:  1 1 6 4. +,)1c#CiEmQ[VUlM/V,h-Bzs{aI]HeE?fe ie ʰ ʫɛٱ԰ѱ4 't't( ( )t)t* * +t+t, , -t-t. . /t/t0 0 1t1t2 2 3t3t4 4 5t5t6 6 7t7t8 8 9t9t: : ;t;t< < =t=t> > ?t?t@ @ AtAtB B CtCtD D EtEtF F GtGtH H ItItJ J KtKtL L MtMtN N OtOtP P QtQtR R StStT T UtUtV V WtWtX X YtYtZ Z [t[t\ \ ]t]t^ ^ _t_t` ` atatb b ctctd d etetf f gtg(s(sff(7ww77ww7wIwQ w X w \ w e f w w hhwwijwwlnwwot9G76N Q 6 6 W [ 6 6 dhjhjiijjjjkkljljmmnjnjoopjpjqqrjrjsstjtjuuvjv7L V ^ d eh!sQh#-h,k,w?h>v>wGhD 1 "*"XhYvYwbvbwbociehfhjwjhrP[e 7R5[5^5b6e0e"e ʑ?!I*!I+=-1)! 3)!#)+"+), W)*+" $+!)2)X)rQZe.Se O;+,+ * ! QIGFB ?!A!D#H"M$P#K$F$A%:%9&:'<'>)A)E(J)L*F+C)>)9(6(4)3+7,:.90:1<0>1A/D0I0O1I0E2A1>1<0908173:4A3I4J3G5C3816.7,6+2--.)e <=50C96;>=@;=:672702b- $5 -  ,)+##  # 9D8L8M5S4Z[a SEUNVOWMVEWAV=W:U7V3U)V)W5V7X9Y;\9\7[4]8_4`3^8a5d7f3e7c8a6]8[M=K;FDNDRE[IIJHMEOHPJTPVPVUWYX[[^]`WFY>W9c7cCbEaG`HaKbMcOcZb\a^eSiTgKoIqH61Q,T=: )T* +<&-H.?-=+;,=-@2R <6E7=582303/110338:8?7E4O3S3O>;$+H_I\JRH]Q^ !T9aC +OU*P0157687;@;S^S:[K0)BSV A)6.<&X&]&e2_5W6S7Q5N4Q6L7G5G6A8C5481B@>P?R@T=\>_CVHXJ\V;U5T*W+Z7\0`5gU *)K*+  [# ,*#M !e+-#\$e2e3`4W6O8K7I9F9D:CT2)^X#[RYJ`R[@lVROBXRIL\]_*Q*L,E,A*<,/013 58.7>6F$4LN2Q 6< ?A@HALGAD??EDNWMO[R[CS^H\:P:LOAm8Jl=m&B &G(pM%pOb3M]3H@0-8<8@,@E,G++NMR G\4j  !!""##$$%%&&''(())**++,,--..//00112233445566778899::;;<<==>>??@@AABBCCDDEEFFGGHHIIJJKKLLMMNNOOPPQQRRSSTTUUVVWWXXYYZZ[[\\]]^^__``aabbccddeeffgghhhiijjkkllmmnnooppqqrrssttuuvvwwxxyyzz{{||}}~~"@P "ge"#eg#$ghcchhed^ _$$YR$$VV$$UU%%U%QR%&RL&(PO''OO'(N{}~~m$ %!%$"On ;* # !") # )l u z#}}~~ QTWA--,**-/7!!>;>D#"[aŗz ٣úHtGiDdCeAi?j>q?v>y?@5- *9x9o6h4g2l4q1t.q,m*k(n)s&w&}'ѹDa*-/!)1*")e)+_+ $e ){ J))oWsR* )@RrTpfpO rJ *""y9x6u+F|4)1>;cYUQPKIHHEB ?< >I#T )qNn`pXohrksmtnuqxv{w{{|}}|y~u|t~sstpmkigkosp_VRIaa`_gfecgdfvGvEwCyAz@{>z?[UQqJ * oSt0v5 {M " 1I!0[ c V\+!V! w{mvUGYowzy}zvxuvsuixmgjilhidbWa[f_aciXnUpGqHkAlBn6r/p(q'o&n'n#o s?sBvJxQ~JxH{GN `tax`ybaMf+OyPoPk8 6 +"==z<} =o -`oe\gf f[ fS `Z ar']zX}ZoVyXlRfZe_`XgWcVaWSVRWPYN]N\PaP\BhFQuO{N|M}L|JmKhPcScR_Z~_wRHP@J>;r>u>:6>m@iCbCXF/E-D+pR &<'A(D'I*K*M(Q)W,R-K+B*8)6 #"3$  6B27 JI?)#  .+"y#/L9 ,*$&v+*\)*eY KE=> EA>!8"6#3$1%/)%/#(-*.(/+1-2/5)R+P*N,N,J+G*I+K(AGMj}$p%r$t#v&m=X;O9I:G9G8F:E 1s   1b37;= > @ B DG Y[[\==<8#0$-%*&('%(#)!7!1535179:@,A.B/D1D8F:H@*3+5.9I ht yig#r"s!t|$%#|%{(r*i/h0e/b4b3d2o0q6`4X-F+<,?7<8@:B:D;E9̗MsIjp,/%Hn |&9ExMLQG#>PV^X}dpwmm U\UcVmWt[^ [gcM\K<@:? 2a8yoOxgJu`gvW{W_j)z],|jCnwmKp?q9W#xL{gx`vZueylI~fn|\%zWρc"m"ujs]p?p;mJmP-WHxMt4|neox]ɚX ie*ho~MHRӹ© ,)4K $i$i% % &i&i' ' (i(i) ) *i*i+ + ,i,i- - .i.i/ / 0i0i1 1 2i2i3 3 4i4i5 5 6i6i7 7 8i8i9 9 :i:i; ; i>i? ? @i@iA A BiBiC C DiDiE E FiFiG G HiHiI I JiJiK K LiLiM M NiNiO O PiPiQ Q RiRiS S TiTiU U ViViW W XiXiY Y ZiZi[ [ \i\i] ] ^i^i_ _ `i`ia a bibic c didie e fifig g hihii i %h%hh h %5zz55zz55zz5zIzQ _ z j z j z j z j zjzjzjzlzmzozrz5 L U Wj!z9D4I 4 Pj_j_kkl_l_mmn_n_oop_p_qqr_r_sst_t_uuv_v_wwx_x_yyysQjD+z,w,j?j>s>zGjD)"*"XjYsYzYw\w_vMqJp L9+!)9<0" 1a1* A*91<,0" )#!9-g.b9_B`G`M]Q[RZU[YZ\X\VZVWTUQUOYMWJYJ^HcFbE`DaCdAd?b>b=d=f>g+g$g g &`"c(dg2 Z )+,QTZ V , ,9* O)2+ ! :!"1*!$2 * :$%A!* + 7G6R6U6X5Z6^7_9\<\=W>V>Z<^;^U=N>L>G;:=7?7=;=?@D@K?P?T@SBUCSCODKDFE?D9C8B4E9G=FFGKFNFQHQIMJFKCMENBM?O=Q>S;T9V9X5X4V3W1Z1],_(_&a&`+_0]2[3Z6Y:Y=[?[B]C]G\IZFY@W=V=UAVCUEVHUJTFRDPDNGNIQIRKQNNPNSNUKVIUEUEWEYC[AY?Z=^=b<_;gg(=g*d3`(_,UHY?E;e/=8<;>P=V'?%=";(D:/D+4G2O1V1[/T0Q/Q.S7@%:L9U9X@5@3C3:%")*")[,.c&Ǥ+ >^N1!I] a0`2_4^8ZOYWF^.N3FBA>3H3Q/R0S2*C0U2JVE-?(@'7"72A0C&a/R.T/V0Z2]2T3O5F5?):7B8D9H8T8c>aGVBR6<7?;D4G;HBZ0\+b'g&d+c1e5d6f1g-`/_1 [!+++" ! + P#CA, %\*]0!#*5c-7_:>*") *9IQ2*JN9KK QAW;+T>`&g*C7$>86K- ,C*-)"#=)!2)]#\Y[cl^XH/BJ2I8II=K0I-O0]:^5`1XOUP,XTYP G^.B`A_$C_NH[ A; AA:D;IG3D2G2L2QM0T1PC/Jc(a,XGXE\MJ^HmSM RR(US%RGL3MJ8AOAJBD9VGED+?< 96 L L O,>")A GW[O@XSXY@'Uh&R&&LR+a";amUICYOK45        !0I#,/2=SYepv "?$4%tzhf7TWP IyEd :[nsccZ1) xfWSP L G F LOQQH</-/8.6?CJM\ o\ a i ]d ?LJSZmyzzyxsrskhjda`a``b^YU]gotvhZKG<16@H<46-%-.-././ !#)1: 0: :"٪@*9!"!:* *" *i *!:3:O2Y; b_)!!*1*9 "*)5:0*,9&/C<;<U] k19OtQPO N v yxeC=.25: 9 >N KMR?+#1%<> QNM;"#"! )j)V)V6V 6V6j6V9@@?AAB?D@C=D;A9><;>@0C 1Bə*, D+)C,*1+9-";@B>A#@,U>a=e?fBeAY@QANCF@N?H?B@8>9=B3 A)d?1%4$:$A"C>B?8$.Z>#))G!"J&G3<!) 83$",>" D:/)y;B!1"I&F*G)FT), 1! + *!Q7S8 T7V9T:V8zx"ѩ+: u vvw vQA{ | }~~}6/+)+,..,-.110248PAODNEKIHMHNFPEUBYB\\@!\M\@ X:  "Q9An@ -9:Tuxzto{o^oBf@g=`nzywBXDUKHLFMEOBP@Q>X9U8[F\X\a[=]Ndn0mn0(!CKUTL@_beqjd`xia_XWM@;74- " ,'  $*,-( 1W>VFU>Y;VOåHsա5+'}: u# r2s/w(vVzb|i}dowqwnstxQv|bqqRstTNZQVLtAY\XfL m[`[`YmYm[dm0mm0kh zh uh yitinijifi bZ_XlX_m_`^Q ^^ |m |f~e}f{mqmlmcmn[ ak|a=D=Ubibbje]\afi[VU_" PUXblZ[` ^ ^mml _UjUjWiVkTjM^M^P_P_RUbV^f` V \ ^\ZjmQLT*hdf$a%m%a(^`m]+[d]kc^b&cEE#ƙ@J@ICMCA` DC@GDH>K=JBFKCOK>EL IG IHBUHE=OBN @Kh>iB4Me?2N\;c;b7\7^: b<^<R Z T\ -4PsY1tT1oXoWtUwYu[P V SQPUWTXWkNPlRItQYuO|NuNlOvPQCGULRJ:.Y*A""<+#03B@K5 J3,;"M+* I,J-`6'41*b*)9 . 1/b.-428)7I5419'4iA85:5F3^3e5 y59~4929!21)/+,1y1x2o.f4_/F-B.=2<5;2:48400$3!41/03 561 e8lFrGsCwD}>x77?~G{PpRnZ|`QNZQOC>:;=4136;]5G4J4@A8G}J,MA"XN*K!JJI0B.Bia7D-C8G2;١;;OG"UQ#8"8/71>~F|<}<>==FF5LHT/U1W4Y2[/T1T3S5Q6#DOGTdlqMx6C)!!'LJhKAKBEMENDODPCQCR]=_=a=YZ] .J.K{t{ [xjttjRu{{{{qpeS h xmslubl0 ! } ~vdc (l6l=^X[:[8]5e8g7h9D9G6H788 8|6|86753'86#m5p6J 3m6 *('%JGM@EX557,=Ek(+s&/  zF =?*A Z[@35@0h|i JJ>>ZYOO x xxxIwm m llkmmiimmi#i#m=mBhBd?d?aDX>X>TFTKKDKDGMGPA\A\M|M}N}QeR^R^WeWed{d{mmmmnmmhhmqmql{llm @cm CM Q =lL?`?FS?MF-}MrR`kblkhZkk l yyknnz4 "%%##!|wvmdXUR*\Q0:,.*::1@()"#$"RQ)I^;9<9)0#RA4z>{F|M~RTTUXXVSSPҲک9RLIICA;ĤCJOOMH~?{8x5u5p3m0k0g/d1_6[8U8R8L4I/G)F'G%F#D"A#="9"5#/+-,+4(9&;%<#:8;=AB<74-$  #+3< DLT^eiqu}    &1 <HMZejqwz "#"" |ysniL -l@'A*?,9.01+-/,4):(<%=?)>HLCBOJQSPZO\K^?]<]A[LZNJPDO@M?K>K$<´/   &0:>A?=;: 9":&<';(:5)0+/,.--.,<+>*@(AABCEFH!Okorsv{ }#xwtqePI H F C ?<- ' #  ,6-2./0-=kPD%S    &)28? F NV ] gk n s|m%"t$}%'&#"%/3<>:97 7#9D)W  $)398:<>@=     !(.7?A C E G I KNU]htvxz{}&$#~!{xwt%$#JHFX` ``deefhmn&l&l4lY>ZA[B\@\=Y@\BR>N=K,C9BF@4#>1 ԗ>)=:*^=b;:+@CBR'zD{N~SUVUVR1KJ+K9@EGJMLD<|6w3t3n0k.g-\7W6R7O4K1I,J)G(I%G#D @!; 4"1%/*,+*4'7%;$9<(3/2012-?,AC&:'9)6.+1'2&3$4#6"x%+~8!)%=EGGFI?[./ V) f=:@CQ&xImJfIeGf=l<fAmAmInB P4R5~9DA-<+U[[Tc^M?,n,;8HS@PXQ($wke4:5 Hh@j=f'`'`\ Y9c2k6n@-NYo{wo+YPIRAO<7)%vjd;56Qxkb4#/&'4'FD    y m g ] g NDJ5   ,$&'*+-& P''+.,(% M V Y \ baj p f l t x | ~w  KIC Q>840.+#&     6>BLNVQ7Tjhzso:i=gn| 49<48>BM"M&T)W'@E#)!505Q 7;h>f8?C#):0#489B4MrQmj\IsY*Ml&G/@KBPG~3z1t/DMEȔAC`0c.N-L'"3%5J'0m*/ +(% )MxKYˆYd=i8 ",qA#EB/+J6 7 "oF sF.vEuCNgD kF l>h?R0 V3 [0R3:"B JH@:4@1h/&&zTOxR " 0%5"$((36/6P(E C5N!N%U(X&?Cp;UDHIP738;D:3?MK{ikptUm }IHGFHGBC:9=L=M:U6V0VSTZo#%"Ue@YeY]Z]Z[Y[YWVWVUOUOTNTNVOVO\U\UeaP  Y f l  PtXa<gBPِ g@ I o>nIvHwGvAr?o>L~LQQ~O~__`U`W`Y`[b[bYbWbUcNcPcQeQeNgMhNgPgReOiOhQdMdLc;cc>d5c5d-c-d%c%d}cwb\e $f gcj klm!mknno pq!q`qtt~t[q0||%{7|:{0Qx`ayiylxnvuyzxyz{z@vsmrfqp~~~y}r|h|_|R{D|<~/(~ }}{${9{>zPxXx`ylwhuatWr\qpuusoUq$ryz{Ypptis_qVrmUn@Vn}gtbs\rYoUjUfYjWf dOb` fTf^eyb i%fgnfhfprfNk f fNi?k |c vc bk \e\p[jQd OcdYkYjUjUkWj&b.b6b?bKb LcXjVjLdNcMc?c@c7c6c/c.c'c&cSdObNb@b8b0b(bbenf_fSf&fjjjgixbqf eP^[e[Umq o!lknkzX{[}^`|`za~az^UgViXgx`x]y[yYcb dd"c \ ` dbd _ b` ]F^H`K^N]GcEaCdIds`uav^t]v[xXw\w_ c a _ d )1 *)A9$ ӣ o  , " @ @wh v&"~ mI  O|D@fky "+""w    b I,n} lkjkqpomr{{Dy?z!{qfU>f~'jt_ryy\x\w[xKx#a&iCca͍I)3ZbubOxFyGy{]y{myrz_{UzJz2~,}}|z||~| pq lhwijwckigpQ0rrtttrqrprrpZppn%n%pTp#qon n$nsX>Wk?s'R |%)#Y* "*1*!);:IɦJ)+;1, .?,{!9r,ng#*#K",#¢.)" r3*+u d  #\Y W Y[[XUTPPSTY]]Z X"V UR!T%W$Z&a XYZST"X$_gmnoii }x y "*w)qz/8}<{7pDq@q7ln9 : ) !"+0AK#04&z* +"A9lzw}x~{} ,{! !< )*)!B92f*cl%:’B:2 2,lc) JI-+*_\ [TSS 2I*QY`a(/ YTT$ TUA-Z4[=ZB[Y\\^a_z^~__^^__^^``[!\^OZ:YURPdQ3db`_^]\\ZXWX!VVWW VUTRTU VW9 %1:CKRV]_oAZ0\j@JQP RSTTUU"W,Z^Z]I"(1FipsyzI! %"&!&(-0I P09?8=9>@FBFAFCHLOONPPNQQ1"1A!R)U)YYIZIz~zvswunigaRPQQNUep_t RX_^fbZ[ZYQSXEvGpa``_\Vw~SdUQ )X )MWQQLhO`K`NwPOU "V"N M K%PL-KLJKTMTYQ\KTTN,NRRdR]RIO`KKYIWIQ Q~P+NLNNZR IMLTLQKNwP hLtNyNuPgNfNaN`MhMmNtOhOgKaKfP`OhOkPnPpPfOfP6P7P;PCmNoMrOuNiM`NMKFHBIKO@L@9OO[PZPZOZNZMXM ^ [VVW`` U RQW#&y'w)z*|-|b/{2|I>~,;>nHI~H#tpn r3y7{tCqlggbelo~ngz-~fGIazivxsay͉}}bb拇 OJgnobeh)l,oCrokod#_d]Z `a^a  In%"")"/37jor-HÊe *#+1+9hDMYDbrOv@x}ăapk{+#"zs`"z5yRtddyDsy΋rmLlUjclpelyht|msnwojpn]YY%^@`WgXggbcihbgWP#`$`]ikgBkː}%xCry,䓃EÆ)Ȃ%(΍ y`~I} -}z'u sIpfk-o mgf ghkm!Ipjv)iw)%u&u:ay>@}>8r>+pCjo3m;h6(e2c-`0d;_ \XUT"/Z"]Y `b#}zn >oAvE{EnFj.uD2o2i)r(k,g#+xA{ECyE{(Cv(E{/t0ql-s-tf*xN*uN(rᔃ {ɖazw⒅ ghiGhea(`*aFzz>+)D$^T[nZz- ROQQ@ QRT-T-V"V%W2W2Y+Y)YTY\]m\\XX\\]ZQSX\\bWd\rXZ\QV@U0TSS[ W c+d,eea4  !1 )!)!       \12'11//]][[fj lnp rw { }   66:7VQVV;??LQQNKH F CB?=;<  7AUT &gQ<< y  ! =HQQC&C>>*<,<=R0 RQAUJ(C'>+F,<7<-RD-B'BA(R1 U"°1<>NLLOUR`R`OTITDUDU555E4F4F45=5544$333GfVVV"U&V)V3U7V@VBUHf PVVP22G]] -  mid%pli%so!wr"{0W1((' ' % a)mj#g)rl)tq(zu,wr+~z++,-,--,.,6l Ɣ' B w Iv(h'# BDDI~R|,[zaz hx.ryyx$yNy y zzGEEEGMO}XzC_xhypyvx}xyJymy z2(%MshYOJJEN+8< :Ez Qr nnor " @se@UhO&IDT{Ic"YiwmI}̒O|{z  >6?9D1J.O&R"US<C6G->/A-I$Q43G'3 wMalC"^)V8Z;E.O NJWm\ "R(>J%JFPEMTN][iYt^_bE[l xir u dpSp"1@;9@@h>z&$z2I"/GpQem_dI?Y/lbOGPCGRYD[N@y[f[\ks 1"Q4+K.R*"T*C?"M?S=I9K2L*E*1'1&1,'51519'91C1G$E-D$9$4.+$+$'.'$$'.' /+'5%9.D $$H+ `1#)#% %.P0.12%21<%<%AP0A&*/+)/)&)&7*7/7/F+F(G%GWeWa%`&V$\c#V(^)],V4`6Y5]`;U9V<`F`HVEY;`B`AZ;`5`%V#^S1B):1%)14)4,&%&,C%DW!AW+QY/^2 `>WAAWD`GX\c](W&W7\8`8_IZHWG44>4-O;)3W YV8008OZWXW232Wf%21 +*AYq+huUzIz9Dc9cTOR@5R7?a9+9k984G/ndsd|eeeeff OpUgTVUD C /gOnIpIoHo4IJ5p4n4/ /EpJKLKNMQPTSpKpMpPgPpSgRFHKN Q@QEEQRQQ H$H3G5G5E;?;2]2]?UHaJaUfUfSbSnIJJTTWXqVWTqTqVxTINNQ{QS 4    0 0..CCAA ^ ^\\ppnn      00>?`ann}zwtx"w&t%q&o%m&k%i&g%c`]ZVSPMKHEF!C'A&>'<&9'7&5'1.+(%!$'&' & '&'& $(,0AEIMQUY]dhl<73 ptx|49191I191I1IAI1I1I1:"I1919AIA9QIAI1IA9A 4!)"0"!01"0#Ƣ&23    1@mbba`_@a0` _: : ` `$`$_$:/:/`/````_`:n:n`n``fJ; ;IE7 77:::TTT;5:5T>T>T>:>:5:N;NTOTXTXTX:X:N:v:vTwTT:w:: 88 : ccd6f>>?ff@]`= 7 5 7;6;P;w; 1@ @@1@==??``bm mmb b0@`n  BmHSHfjiffIehgfeJm|eNOK |C;PJ_ _%_._a_m_ghhg}hyguhqglhfgah\gWhTgOhIgFhAg=h9g5h/g*h%ghghgh ghgh==`vx v+wGvRx^whzquz|{~ihw W`7 ;SS6;6S=SO;OSWSW;~;~SwS99::39?9?:3:M9Y9Y:M:u99:u:;UvUNUXU4;4U>U;UU ;S:;:SS;SSz;zSwB~B~KwKWBOBOKWK=B6B6K=KBBKK Q" [" 99::#9090:#:_9o9o:_:=BA<;@?&I~|yso~,h}#GcxMZwQwCGu:v2v)wvxJ vmv .v(Mw%@vxM yyy"x&y/yE:{+3x?y HyMz Tz Zy`{h|"p yy@z|@hz &I",>Pm`IhtMO6&D@f k2" K]"m)/RcphARipqvD!#Ij,iini*i8lAiNj_koj~jɍj̗{CgƚsƇjnl̜}fuqqGyIaiat qsu%ob.tb'7&9%VZ_dg%il%nq&qv&v%{%%MFC'=;&53"0-)% ' '! &RR2VW2[]3`b2g&i2l&o3q't3w'z2y2~0*&%46%8,:2=7?+ON3LJ3HF2C'B2>(<3;'927'533#03/+2+&3& 3"23(2( 2 (3'0-&H!&'+/+e7-@-G) L#*U$`)f*k,+o+hz'}" D!+OY/@P-1%&"a/0.k'X$_0&+ #&22)`07ʚ8d6D"Ά'.c$.e/ic-0F+j,,+ +: /?gA!hD%"JJ$!G h$fOXgi#n#q$s"uizB)a]m]mT    i;@mGjE0mCaPa;lFc^g[fQbNbHbBb<kHlDlBdC0g>dF0dI0mKdLdOmOmRdRmXcXaZjZiVaVaRaTlVlZaXd#_ `egiDa dAPMKD K)B H LOE]I.P&P%R&P&; PPRP;)Q Q%;'; ;<1C\GLA@`\X\=sZ[FDjUK_cowɞnVg ^ ^%^.^a^m^g.R&R.U%U.X%X.[%[ RR UU XX [[` ^PP__llm}``n`n^^`` `^/^/`_`$` $^ ^ `#` Q ]DQD]RRQQRQQRR:Q=]S]]SS]6]6Q:S:]OTO]S]STWTW]v]~]`kg4\o\oUcUcSESaadl4  F FFEON N  1 IA IA YA I A $I(A ,I0Q 5I9Q >IBA FIJA O9RQ WI[A _YdQ iImA qYvQ {9~Q IA IQ YQ 491IAI1IAIAIAIAIAIQIAIAY1I1Y1Y1Y1IAIAIAI!9 I19 _ ::_2_2:=:=_e_e:p:p__::_: :TT#:,:,T#T#;C:M:MTCTC;_:_TUTU:_:v:vTT:v::T$;$S+SD;DSLSL;V;VS^S^;~;~SwS` ``2`=`e`p````6; ;%;E;W;w;< <<"<-<@><@N<``<@q<@<<<<77FNNN FNM = ==="=/=A=O=T=b=s===N==85MFNM __3_<_f_o___x wx v3wGwVvfxzvwxyzay@%R%@+>ERE@K>WRW@]>wRw@}>};];K;+;; A+AKA]A}A#ww v,wx x.w#v$*wNu /w 5w;v@vFvMJwOwCTwYv]wbwgwJnwmsw xv({wwMwˍwwxwEy&v ,v{ { {{|"{ #{+z@1z8z@'{h:>919B:N:N9B9T:`:`9T9d:q:q9d9u::9u9::99S2SWX3[]3_b2cg3gl3kq2ov3s{2w2{333333.%$ON3KI3GD3C?3?:3;537033+3/&3+!3'4#33 3333 *"3&`.I --'' /I-f--%-(%'0h-'20I6$j<i9-%?/DaG,@J"QP-+U/jV%ZZ.(_&bd/i%j m/q%sw./y"v}0 ~%,$-!n/(-1hBO&ZJ[J/E/\GB^h?NfAAFXO]RSP@ZZ$bZcDirABtNs\%z\CUD,KEZÙPȞZ(^ GAA` MIU-[]'"I:fK-KX„ɛQ:h99^ ^<^3^o^f^^^ ^ ^ ^ ^ ^ ^ ^ ^ ^3^3^3^3^3^3^3^f^f^f^f^f^f^f^^^^^^^^oPfPPP7>@391I Y19AI19P9AIA9@IAYN0WUROLJJC@=:742/,(%!  *Q19A)291I1IAIA)Q9I1i1I191 @:9K: O1qM09J: q O3q P=P]>A>];KRMRARRR\-K-\@;<PPOTSWXWZZ Wltpn`bQR\S TX X\\WabQUX[TWY[]_UYmn nA R7X->Q9QSQ\= Xbehlmqtw{}O01)"1" ")!! "0202902)"1)" Q]Q2 O.N.QRW.V.YZ1N?M?P0Q0V?U?X0YN-M1M>L>T1U-UVPX1O1W/K.JowoA nGnvpNpaqeqdqoqpsctdvexfyg{h{jpdphpnprrnuoyr{vnApB WV`ZVVP6T1JJr @: b bDfD6 JJbCngR6Q2EOS/XES(X?ZD :"0)"14 )2!)% )!P0snP-R(ieU"U1uZ2x^4|b5~f7k8o:t<x<}>?A#A1B+AP*MWQ4?N.<J.8F/4A/0,7>J)P#,A&U, Z$.bl$c(N[. h3 m'v !Gv+m5y;)M$ȉ0C;>,v32UJ[mc j(p%xGM3ďM˔@2`>VKa?aH_I_@g?gHiHi?[FYH8I 6R 6L D 2H4J`<3B3G7G7L5F4E3I`@h@ZH_=]@7RX:XDXDUHKS) J6JSDMD7DM%MMT8N6I6C7=75L]CbC1jE!fG^H[Pa\}ZcC b?e?k@rBrN}WlHfHiOBU@B]JUNUJS1]*3[=Z^* \,[bj*rs* ~}!-xp*vn*gd*2ebr\Y[S1R=Q9S1Z,Z9YC[YB^BTSXYiXrWwnxkvjuishrglckbhaf_c]j\l]bhstMSTIWE\DbDjFXJ_aZa/_6^;]?_G^I`N`SaXcZg\kamhplumyq|x~{y|{{orrvltwllfea^k]j\iBVB^>^=[-^ __vt"v/t9w?@IPSw :3vu"t ut@!u't@,th1t&8vbEJIM,OGn=2)~06>H C g "->@0,qaEn7-!zf9K5wG,Iwa#iaa#a(`-`4`:`@aE`bLcbQdUf Yi]napOguJjxgfpm{rw)z,~Cˆɉ#dv g{!`%_+`2_8^=^IE^nI_%I\L]"MYM_SaVaZd[h-cnHeoiqekrr{ nz*u{y~z+hDO cckg jmf+o#bemi`)i3m;fdFdDI]CaK`Oc.LXiKWBeJdFPkjFk>mDvcWi]reri|/pgth}Ą犋JJGhf|oe[QG{Jq$[xiixlB^b%V}CK}Ts,KMEW<|8r(E^RRP@ AO"~~bmonm1I:jO iZ%z _ai@cqM+CjZ]X(OBqƖ wYMG 1 j>==>Y4 ^ ^ ^ ]Z[ P90#N:::PQ UTX X [@[0a ` ^^[U PDMIRXCXBOBO6a6aBrG`GOXVXWWlVqVrWyWl[j[i\d\b]O]P_ox{}{xrxlsllcl\f\_f_g^h__`_A_A]3O OYY^^__4 88 G E| 9AIAIAIAIAIAIA) 97FN8P7T8X7\8`7d8h7l8p7t8y7}87878|@;1"0#0#@"03@ = ; ::99ii0{6`GKOTX]dimrw{545454!3!!-3-$#$#3,3$$33$P:$%$2,2,%%2 2 %%% %QA{Apfpk~k~k~:}:Q:if w 9O9nJ84O8nH HLvOlpROPllnnlG C ABRC Q;3"=<AIpj pepDeDekekPkPB464k*kkkjD*D*jD D __D`DWDW_`_`E_E_^X^E^ ^ E6QBD?0?0`E0ESES0HSOj>0:0:S:S6S4kE9 E EXEQHRHG+D +CCD90 PD C C DVD VCaCaDdD dCqCqDpl!a"0*"1xTA2ET1##"DQ;Q;I?I>FDFGTDGK`MfulzC96S6!5!5(DReCdEeOkojmjpf?/F/F0okpmqnpmNiQl0WlAQ)!:T (*04DV[ackqu{~|~;7i1x6u#:ldBh?a ?YBTFb&m!mp tI(qn-q%(w|"{" y0x={mw <-GHR\geqqZ B*3$+h,4+$#?P`dp?=D:?8?90@-Z1gD)7:(@7F#SUSdE_fcN(tF(sU8Ʉlfz]NthN`J x~^ɜYF#112$i2jD%fEhGAUcJ3KG&NTNA)K5mJ)66 6666"6&6*6/626TBYB^BcBhBnBsBxB)iioifi )ioinimi(hlhof %eke)TTlTlT4lSlETP)EoEkEJ)UlUU)VVX)X)[[)^^)bb)fmVfVnXfXo[f[o^f^obfbofUCWT[T_UcUhUlUU&fflfkkiiS2S2i*i*k4k6S:S:JJBBJEJESHSOjPkekeiPiO_OSuS|ipipkkonl}fwSSxxvwThhT T hWTWh[h[T_T_hTwwTog4 "P ""! IQYAI1YAIAIAIAIAIAIAIQIAIAIQIQIQIQIAI1  )rP.rJJJrMrVA_AgrjrjJrrnjY[Xj.J.)Z)]K0i0[nj@j2)r )oJ@J2LqL1M?T?T9M9M7T7T1V1V7_7_1V?V9_9_?W?a1a7h7h1hqg9`MD`TALlVD_DgAMAaAhlbDP,Z,s.s.XYssWzGzax_xD:H:b<`P=Q9V7Y+frJsKuNvOwP{U}X\hV`W<rO%O ll(lll 9II4M1M:b1b:k4{H VG_G_lSUSlVF_FSlIl3l_l`kll^EgERERZ`KkMIM#1@$TW1W:' ?(AA?C0D]]\[EjjB$Щ# mn om+s!-t6v;tAvHtOtQqPoRm`mBBgvqtxwvusmonmnsemQmmTl^l{nm4a~}3l BI"&*0)#4;A,EL O.UZ$aNe i otxG}΂MȖC15p@oHqepJjtmpp wq(~t%q~nMn nm3 E+ $* 0 5IkUa m"+1"6"RgᎢ 2".9CUbbrvI,njH4ɀWC'g 1~>~MznWs-Yo^w\qfW|P_Gd}Inyaxmi[ua͋|{brbE9 ("O J$pgw%try)z,~C%zst u!u##rd'q'w -{}[xaZIjI}np%sϐu""yu̗{ώßy1-'H DePlɃ *4??4uu44O[RW'O'[$R`*W, , ##;#C#C,;,q#y#y,q,##,,..$.,.4<DLT]emv*>=.5''(1I .// /(/08@H PYair{;419!.3,8 +h*D2:OA@JQXa_dhkrz+#   # / ; H T b p ~      $ 0 < } 1f]#ek3VCA"-?+C +"2 "PP4i#u2ʘ>`ʍioir[eMbbjCfIc,LZ) T$ [)W \ +k/c2a 6[ hda`]}Y+j0d/d3`eij_~ZvOsK{V5]8X9W>P0h2h4a4c6c6c7]=U?U?U?U=Y=Y=Y@Q@QCQCMCMCMEMFHFHIH;Y;Y;]-l-onJlJrOpOuSuSuSsSkEuWuWuW|\|\|\|\|`|`|````eeeip`C^:W:^>W>[[2[<^KUKXL7[S[g]g]R^P]L[LZ]^]^`Z`^b^IVL^T\MW<^<^^Z^llm=_=_;E;0l;@v;;+s+wws4   0  QYQYQYQYaiaYQYQia9]djpv|!ɱٱɱɱ4YQYQYAYAYQIQIaYAIAIAIQiQIQYQYQiAY1 !66 <`<:G:G`m`m:x:x`[9 [8O8O9Z9ZTPTP:393T*T*9399 8899TT949 48)8)9 : SS+:+S2SQ:QSYSY:`<`G`m`x``75hY1hghgh!g&h+g0h5g;h?gDhIgNhSgXh]gbhfgkhrgxh}ghghghgnXG.w`n`F`=`az xz.~A|P}bylxy{z yh :,:R:PP2TU3XZ3\_2`d3di2hn3ls2px3t}2x3|2323212(LK3HF2DA3@<2<738224-20(3,#2(3$2 32 323 *"PP!TT!XY!\]!`a df!hj lo"pr tw!x{ |!!" ! ! LL!HG DC!@? <:!86 42 0-!,)!($!$! ! !  !   4)&#. &$/l.#%(/B,&3-I:%?-E&I-N'R/W&\-a$,g-k& p-.t%z.$}'N/ % -%.G%Ν-3x wMwwCxy$z)|/|4}J:|m>z E|(K|%Q{WyM^ydxjxoxvxzxEx+yy zy y y|z"{ z{@{|@{h }&%.6~I=}"E}L~SmZ~I_|e{m{Ot{{{{D|@}f}}k}2 "+(8"DS"_hwჅ 0CQb]pI|,nőzkZL9;,Cg#3CnW-f|vf~yI{G%zIxaQji#a#2B^sbbA KXOaJmgwǏ蚢)D,8Cl oo k/l#,dddd ftv~} v+pI5xnCx%Nr@o"7g"GeXianpqÁtq-nHfÏf~geniz|l{ \|*J|x{{+mh|mSvFlDjm1O;@GTYaXDDk"<&G\+]+8S#8>J;OVJ]`Y\dR^ BEIMZ^a gjjgf o  n &.CG0[ea7 %@))E&A&'/ 0/  W   ] % 2 ;. P JB :B*88Q7I 7D-?797/-$7% 7!)7P*I*C)B);*;*3)2)2 ).*.*&)%) VKGE>=44 .%!   <E** 2)QIAIA1I19Q9QI!I1YA@9!+0!90IAI!)! ! ! ! !~(z'x(v&u&qnjgb`]ZVSPMJGDA>;9)15454)1" !)*)+.,.-g )A)091I9! I19A9A)1)2$g 6s  ._i^KK wip 6 *?Zpg;# ^8 9'@2C1F1J0L1P0R1V/Y0^/b0d/g/j.m/p.r/u/y0|/002121323232 9@3o045LSL4 L4U3U3URsOs2z2zS7NP87`4`IhHh3`4911<241&!}yxu st"Aۻ4:YQ$N X Z ]`_^X5<D 2<XvVf#$/NoNo1wx0p@U@4'K)27747);6:,>)=6I)B).7241)%6%)" %L# 0 5 7?FG O2)W#![+]7cC`lNY9Z0TB%MHIISOY dempp,`'o La.WW_U$mTNyW m] \`e^y^G_ΏcerMwȑqCi~fyp^zfJm z%hjSkMIx3(z|E+ 3. @y M=g"F QA@38x@ph?i&P[1@IB"<51m/I$02 F (  P O 8 .   B20+ /!3"33/2+1+@/C4E,<1:4/0*,% 4 2 " ? <58Cq929D:2!979?<@S@ULSLQ>Q8H`DxCNTTzQzSaURoNsOsMgMUPURiDNGb _TT^[TTYUU;I`E`MdMdEgLSJKSSLySMS4_   X:b;3I!)b[i \` AI A I AY Qi $A(Y -A1I 518Y =AAI EAI@ MQRI VAZI ^AbI fAjI nQsI wA{I1)09!)1)1)1)! 3ɱ¹ 5{.64*2;1G0M0Y/`/f.n.r.t-{-./01{,},~& ,,-/!/&0+2  223%221!2&2#+1'01+50/:03?08D0<I0AL-EQ/JV/NZ.S_.Wd-\i.am-er-jw-nz*s|&w~"|D"W31S8PM68TST2J2JT6 57874 2 U2 U1I2I3cJc3l2lIb3 b2m1m2>V>3343X25 i83?3?4+O+6"7"P,6 ,5!6!7QZ[ Z WWXUP>:78 68;BVAY)+)XY)?P=9W Y[W_S{MnOlIcJ+O"P2RSR3RRSS<4V3X`$5 67/6B4Z48=:S:;7LNk3kGdH*7*M#NONMjHeI(N%O)L)>#=jFj:d9(7i38 %>f:8Mg4gI&8&O@>FI97k3c4c;l:lBcC*7"8"@+?+G"H> =?:U947nPsSS|spg`ZPKG@82zNy sq)o1k?kEfQcZeedlbybelswy|qclClfGgMeReGXfI`fadcjbincrcazb~fvegkoxbzb}2d gfaO!aJ+_g5\FXNW)WW,_VCgUoSxQSW#`dcn kbŃZ}VwXnYId]n>d%1fl" p"nṙd{a}]T]-Hte柛ɏ x*aNm焟,q_EWA8(+& `AoIPj-bhk'~|I zf!|-3q+h:Y8YD;^>ZO@_@E_7aa5Z5a+ek1`:fC[J]+QU#LVR[WZ[Z`_ZN]KXdVDXΆ\\_ .i.9)uFsj u}7pcHiZhldyf/ogzh}ēJiJQCG5h$f"Nu$frvixbBNB%rqC垦11CI*UjGPiAH%G>[=aVP@aIq=x+Tj6(vI~;4ƂLS X<:07 ]2v1e ^W\ f nl`b_ fj \;UQR U B;UڐZW VQRX6SLP3EDEE3KF3OIO3P3PIPEQELEL3;Q6I4I6I65LO8KQ >B57;6K6N7Q77Q6KNJI8D 77K7M9P;SMHQJQMQPFAIKANAQBNQPSSVWY QG8SYYNP`3X3V^]]XPROADDTTW_MR|NwNeQSSSR~MQRAIZ-G?: e"e"Y! Y"Y+g*(q"Y-g,*Y,f+~**))Y.g-,++s, 21+^(_+@@-*^01+Q-1>0>.,/*1bedeb*9+"QQM+eN!O!9)1bd1 0.::.8.83 2.0 /.77-**L*%)1'^(J(@)=-4 34i@.(>'>%-&#K#4JaPdLa"K"72 1.99-=*E)X+W-J.D0813108/<&6&4'.'*")8O=2 ;2/3@@X>Y>==$=(=4=L:080N=NSPTF.F@A:<:<6OSO=G/GA94?%A3IBR@Q>PQ   = QB BN QS SK7JI I A ^AJ7`= @N AP ?   @QGI:'3;DLU1X^_UKf ` 0 011 X&VZ.T9RCO&4&9 >DJOUYW,G0SAN%9XX9V9VJY sVLBMxA8 . ,-7-|-|;|-q.q=q.b.b9b.[/[8[/Y/h.h=v-,f=v>vAf@fCvDvGfEfIvJvMfKe=eCeI f>f?fDfJg>gDgJY0Y8Z3\2c2i3r3}33e/e9i/i0"  ?,|y#v)q-n6m;iCkOoToZsbogjlipat_zb}ghoprus`pBqHe"h*Y(3Y%fY"a*\"d*_"g*c#3i)q!n!j"g"k*t!w!n*z!q*u)~ x){) ~) ) )((( (001 1/[]_3,"! ,W:WJ1@ h &/ 1)I$"$//m<TOF9 JDB,@M*fS2SGkV+T! HD/"5+5#4-"[>`G"b?ZGyK}Ax@{EʞIZʑQI6b#I ,#9nVş;57 678a [!\^V!QQQLGA$6'1&1:@F? ?P PBI7K9J9KOPOM"I"F_7&/'3( *Fzzv ui%tj)pf-mh1l5lc8j?h&DiIkOn)TnmYm.^jb]nblghlf$nas_)hdv`/{aeNgjmlmmln(o1 | s #n4hKeVfA]eccqZ`fg3e (}a|!{$w(u,-r1oF7o&,OLWKST|T|Y][XX` 9RSOT>Y9Y9S4S+U$V$]/^*_e*_P ee,/4/EORSTZZTTX] / .e+/5/EMENNLF- ++;+B+L+U+O1# S|X 1O )|JLL4i eKvJiKiKAL2KKc x x x TvQi`yj} cdC cMI`ede P R U Wc`[MC4. qI d V \ _c ^ J@M@@`@J B I@+J@.0.>K 69!I1)   @ I1  J =q.i# -$ ''44'4(2''6 6(9 95( 5 17" \0L pKsbbtYUUV\ZYXYYFGHHFFrb?b>arahCh=_?_CgCk?aAd8hh8d# 6bba3a4]-U-S/S2L3L/U4Z4\2Y4S4Q2W1Y.T.U=AYsK |zxsq#s%M76?_2 C-JJmX c(m%xM>$ T)\>UESR+^\]n nnzj |i fˊ\Q"{N lTN^@7b%j@ehn&y I "mI}O$v.w0D$@ f k ,$"<+>:|"0{)}" p.qH}Yk|~wg~GJhb{ ˔‘pzX/_PANP7P)O NVI4,*%n |} ~ C gn -f5UGZIraEk'Ni5TEPa3f.f*e'b1b1j7ib=jbSM KGQORJWgYVO)G,BCLKSP#Dd9/ 6IB7)HXISn?o%;v5|"/~"9u6sbH_e8x3* $* 1+1h%!,D59O*@&?Ba+"{:k(Dh+~e@d Bm(AZaCcbTiUw 1# `2BNd]Dqi'Fj c#B(71.g#&h-GV>J9CJm T,GbhmBfHI6PbH|$ci NBVQ%MCG ?,71E<)#( !`IC-~ '-4IBfM-TJœ9ə0̀ h{ u In jj id %^ X aQ @J D ? +8 j0 ( ! (    8 8n= }D0DO4 ho \[$[$\[\1[2Z2Y1\:[:\E\E[Q[Q\\\\[i[i\u\u[[\ \[[\^9^F^^eFe9ee[jl[jk[%[%j#k#[2[2j0k0[3Y3_3f;[;j9k9[F[FkDkD[R[RkPkP[][]k[k[[h[hjjkj\t[tjvkv[[jk[[jk[[jk[]j]j$]$j1]1j:]:jE]EjQ]Qj\]\ji]iju]uj]j]j]j_E_E``:__`:`g:g:ffEffgEg ^e^e%^%e2^2eh^het^te^ee^^e#_#`0f0g9_9`9f9gF_F`FfFgv_v`fg`_fg6N6O 7J7K 9D9E;?;@;B7P;J7X5N5]7]7N6J8E8Y:?:SGIiJ[IM_/DZI@f=dDXOCeFt>yfBtC;:9mDB@>f8=kIaflg2k4q.k3_$9x5i-5BRT%LCGA,B>ECEA} ,Y"V" l+5T-H">MNI"XNaJlOj>[=TBlB}>ʃ;|Kp]~qbX{Iop,onhrz -$~6CiDJ?+)|CyugƐWTdnuG1-̚!"f&1G&I a i a &.9BbNb`m v OJ gǚ),^CW   .##d    -4I$n%""%3HR-cH{Íe'>ɓS T*ava眄+hAAD/O@&Ě1a=<9C2B0D/D.F-S.F:`!-SAA!RA:E9O9Q8D4CHA>=3E>"IIGG١FxEx;{323|3z6yFF4?6>E=G?6A4E3F>AEFIGFG"F"H"FG5GDHFF<854y;A5@6AFH>F67<"3"KRWY]`cfgjklpu{ V' U* S- W- T0@T2@T4@ 1)];#^>_BaElbH^HBZHVHISERAQ=9V;Y;^F:AbzI,'~~nQ1 ^XRL 8::4P?C\Ig`B^<]XUln=l-:Z:a1bf-\,XGnI%gataivnnaj͗co?u6f8D+b,b)I* h*_-,O(J42gmbnepikl)e,iCm˕qɁIMO#w1dy32 >BFcgjnIRdnUh%3ϒ6 1"("(("(-(3'->'HB&G&L'eO(])`) d)*i)m'{&'+(h'''D* $0 &0** .0 4 7+08(9%D9E;B> EAPNASROT1NZA)*&,@)/(3!NSVY]0I I!ɑ1L@6O1O@9ACPgO )k[ PgR0gT0fWP}7 |:0|=0|C0 s"1r&1r*1BHM E0+5 2 % '* -T W@Y\ 2 Fj#2HcZk~/^^aa^I`V`V]I]I`b_m_m\b\b_^^abb_S P9S-S-P9P9S"I੐ F"F"I=GGGGD=D=FGyGxDDG<`[;P;P7[7[;,;#;#7,7,:,:;` / / ,,/4/=/=-4-4.o/x/x-o-o/00..02P4S SNXWOOWXXWV S R P NNOPRUWM__MLLN᠚API)* <.<$>$?&?(=)@-!)E))G.)K.K%M(O(Q(Z& )0 _% @-F%-5F7F ;J!)@J DK 5 QK $,WK [K _J!)dK  hK lF pF +S /S2S4S :V >W BW $ FS JW NW RS YS ^S0_UbWfW iS  nS0oUrS  )` -] 1\ 5` 9` 4 ?\A` G` K\ Q`)V\ Y` $ _\"c_ g` k` "*r\v\"=f Af $ Eb Ke Pb Sf Wf \b _f )o /o 3k6o ePd*n7n?m^man-s4s?sHsctntXIiIeT|{}~|w}e|R{=}4|,z#vpmk ea_XSKE?< 6 1.*(!(%&'$3!B"T#a#g"k#w"#!! x!j c!\ K!C!9#)(,/5 6 :AGR[^GDBA>\5 421/+*'""8!N"_!rS -,:'   "(/!0|)*!=N "d@#)+SDADB< ;|<:=?CB WZY \~\\_^C <X]7KO UiP PnTksF{0{=&Sv.01G0&03M;NC_jq{s6n%dJ>9m> J(^%h=a4EE +9r! zLzM {` |i{"w ny@{@thv&ldYI<"1+&m%$O&#yDs@z.fx%ukx"j f a"D+> 8"4/"*$&.%6#=$=#E$O%b$m'+"v"wb!}!I!!n!"!"N$)$/$.$/9 <C; g=8 )'$%':<"!d"a"f"] 2G^Ihac_i]Za \[Yrsbb xOpJggDž耘)~,fC˝]ɔ^[]#~\dj q䂈ĕIn %yn""hn̒hϝÍa-`HHP MeLG I E*A@LV+VhWV}AD@?OF@IJĞSaMJKkSVYX+W4t  !!""##$$%%&&''(())**++,,--..//00112233445566778899::;;<<==>>??@@AABBCCDDEEFFGGHHIIJJKKLLMMNNOOPPQQRRSSTTUUVVWWXXYYZZ[[\\]]^^__``aabbccddeeffggghhiijjkkllmmnnooppqqrrssttuuvvwwxxyyzz{{||}}~~#`Q $ZT$$VV$$UU%%UO%%RR&&OP''OO''OM(*NO*+OO++OO+_ dP~ ~   %*  P  n ;]"b + }! 73!*  XTQA-7*)5 <  >A!3KHZ[:,1J,/:9.K@39K2%CR#QR$39>QAQ8T2X.]-a+f&h!k!q"t"y&~)$$*2549?>S@>1:Bѽg^[]a \ \x%x24:| ttwz}y| }#y%|%{(z*|&$Cʼ<{:r=l>aAU?JAFEGEJCRDYCaBf@n?uB|C~CI+ PiNcPYOTLNMHKIJHJPNWN^KcJgMkOiVg++ROSGTFVMXOY]:DT4:[D@<!isi{smdda[Z\`D<32:D6-'!%*%&46! !*,{-y'u&q,l3k=jAg9h0a1_-\4^@cJ`Va]`b^\^R\K]EZ?[9X5T6S=QB3 L2E }~z">zMgN_OYNUVQ_TS9i0x&}*"B;]jgxTӴX-+JB=9642/ -!-#1#6 ?$>&9%3(1*1-4.9-;/:1<5>6A1B.D-E,I'H#I!GEFRTZ[#P'N(N+P/O,L-I.H2K7N:H=F=G>K=O>U=c;m:v;{?BDBzAqBgDbFWEQGJIPLWM]KcIhIqKuPqRiPaRYT_SeUjWiXdZ\ZWXPWLVHTDT@V;Y9Z9Z:Y>2[H\P]U^^,*b]bScHa@_;^6_3a7e>hChIgOhRgZiOkJnMoIoGrDuByC|962{0-+)# $,.2026:?EHNTUSJG~I}NTW[~\wRuQrTrWtYwZw]raofqiqknmklhjcl`r_v]tYvW{V~TNɑ@ʬɣ)z̟ٻiq p r w xw:),c@AB^ _ ` aMGD<:86,$3&1!>(0,J,M-N1I,O*N(M#NT!H#J'IENDRD^Al@s_?ZJhPfP]QZWeVKT>ZA\F]Q^`aVaD`A^;]5*(&$,0"21tpmnn[wVNH9,'y{ xyMXLUKSJQ6,)*! ?)*; $ ; +++<:=" !",,,*)1!+*s# : . :^I` "Y*_ !2)w\#u^tatblteriygBwiydIxbz`z]|[p$! ).K)*m)m(f-c.9+-9+f)! w' + [o2 n-*s# K x-# u0+ oDLrAv>uCu8)w3 )l>* )-* $ l:1+3)_-1#2* !*+a[ \R,\M+[@\E bHaC cL cS[7Y3"Z2 U6X2@W5X6@Y0hY4&[@S;V6Yj #" <ZV" 5XP ,*;XSɩPi9NaK+,*,)  IHZy! B2;0?":$+ )+;NAÙcsjrithuhtixjway^x]u[w]w_z_yJ++*>~<{+, 3D} ?q* ’[ԓ=@c!* ,?`*)+ CY/+  J" -D)+)\:D/I1"%5O*Z**9!Y"V) M<*"<!")" M2**%L+;:/59#7)!/; "*;!9I@DF@<A>BLOKKNMKi)**M!<Ú r+") !:* y),{~y) {" .} ~|)y"  $.&{%#y'z)|=Ik"lrsm!tIu2+#0*t!* m h);(\&b))i+o!.v!!)2f6k!2U=8l)8n!5q !+ #,g *c "*_ 1e 2X=b7e)3m5p 3l 2]+h)`*W*937V+,,=V,a3O1L&a)([ <9*h ,m.u 9n6j+l;j:o*i(e*\)X+U-T/R.Q/v2w4u5t 3'""}=KNgFa8`6`:a=b@Y:Y=X@[O\S]X\`ZSZ`TQ} * )+ XmTp* + "; 7n>7P&4m" 7*D ;3:," ;"*!-B  5ӲM112<:!'u˭ʜƤQ ɩ%yr f dj`\&Q(P)Q&]+}*&('.~:;<=?BCOvNwMyLzGvFuEqFoFk%C'C=DZ7{6zEH|M|STVR "18=?BFJP]_` a b cefilmnefhiklnp o phi l!p#s%t&u![WYUSROKKGED$P&O*4'9-8+:-=,R)U3h2d2[3V4T5Q7O8N9L;I9Q8S7U6W6_5b6f:l6l:q6r6u8y<@AHGFHJ~EzBrIfHhYf).Z#-b1S0kRylWsR~BHtRqISkai[qgeHV.=*El,lp p[.qUnO$g\NYr ak eg9^;V<[ "MMȊSCOKsMvOwQJ}GmE >(>%25M~;wEnVnaGYfE$q+05 79 j m nf"b \V@_y@ph$b&'kKwPIVz"^piiocmrRIoMnS}Ro'j'+k-h+j/B] BS?c?m?w_N^B`Whsa}]z"^nG<v!*  inx 0*  4q __  !_!_""#_#_$$%_%_&&'_'_(()_)_**+_+_,,-_-_../_/_001_1_223_3_445_5_667_7_889_9_::;_;_<<=_=_>>?_?_@@A_A_BBC_C_DDE_E_FFG_G_HHI_I_JJK_K_LLM_M_NNO_O_PPQ_Q_RRS_S_TTU_U_VVW_W_XXY_Y_ZZ[_[_\\]_]_^^____``a_a_bbc_c_dde_e_ffg_g_hhi_i_jjk_k_llm_m_nno_o_ppq_q_rrs_s_ttu_u_vvw_w_xxy_y ^ ^xx //////"!!   ~~}}||{{zz}zzzz|}zUzU{{|U|U}}~U~U !UU!"UU""UU""UU##Uz!5 !$ z2D'..|>~>z+z+}--2~2!a irolfdjlmjeca`cfgf b!]ZURPIFD><?D HK!O!Q"T#O$M%I(I(D(A+>,?-D.E0@2>3?4>6@8<9793;1=2>8=;>>A=Dbosirqt nbw.W,I+J2p5s:u:wJ;K6KLFKC`futvJ?3!T*W!!W&+,]& !]< I7S#X!]'[.\1]=WNTNPNNHFHF;C=G7E5H,I.C\E`*A#S(PX!a ekq r p[!X)K=U>Yl>]>`@eBAi>PI>M>J7G8A9>9:;7;<,G ?L.@O@S$@aN=h :h jG@lBsHQIRMGSZDC[B\@YH[-[-S$JU)mW# V+(M4%O2Q/MDDCHAKL:գKC)!#BлƥY1Ja:"!ᵧi+;jӣ:LEB?@EKPSZTWXRQHCBFJKOQUYZ]b][]`e^\f99F#ɱɣ!$ + + , A99! *_C"#:<*)"+0J";  ~+ 5#I $!ʙӤ .) q#y'0yr -2:),0; 1 ) |' H!H"  )"M35HPja`]JLNPTWTVLKLVTQpKnH^KQHP'&%~ aC&`Na]"%1* (#&  %~>Ӳ29 H,"%;32:-:@74) $"#!-{)!9Hnu)t's$opqrtxyz7ZZWX@4a2a2\0Y)U,f-i.k1s2{|z}1\~%z*LxO}>x9|9 K:22+ /<.<+Қ#*-)-27+KJ{,%}4*~?}E"* VVWXYWUCA?<9z8|0~K  8{5|H(( zK 0     *,#$ 1"!!! !  )  !s! )iU *M 1 J*# ,hVw L. 0:) : )-))9!!+")!0=! ; @*9) *: )i914\RDglk>1+!* ;I*J*+7Q5j7a6_6Z8T9R8Q9S=P>Q?O@PAOBMCLDJEGGFJFKFMDNDPAR>U?W@X?Z?E?XMAP)I!9NT]SFtI"JpNqI* A2+f~ˠZy]`Pa+ i  + + * 1)!)+ !<""o_M!)) ))B",*#!) "36 1 ;$"!))#*1I!1 )#9!hw.- * jwe|:^j) ]X+*ZB;9 \KZ k:d*": dDg>*k;2f8r;* x6z2gI *dS+*0 jV+*ie+#Dq  tw #"wc ) ")J tOtHKqD+*)+ "+rSP:*"UWT "*V9,* +0-. !* G T,}#r#y+)+*,*!+=Ò * K;+! +&:*:)#<'9 #OethrktDbq@dofft`V* n9 09,I9+I1hKjl*n])*i<+;I?,])1*9+9YLLI* L: Q::":K. !" MR"O+Q"FjEf"GcJtHvKzN{P|A_EWCV@SbAWCYIAI,@Kn@KESDVEZFVCFAFKhKiCIlMtgPtQwSvRtTvnVv-PuR}MfMkLhMfGOlINnYbITiHSKSZe" Ʋ1ˢ#Ub*.ŢM[TTWh?n@dAq>WE~,F{- -.,E$DNG " &)RGo9HfkwJMzMȒVCO=cq@uJ9YmB~ B(B%1M0/2q;=E>+0bqd r_lE nA bFT"R F@@<@h8I4"1&}LxLm>̓ O43D0:}:~;~;>}>~ ɢ ӑɢ#"!4buZ A $    *=XlwW 5 *Jlnoڱpo~n|o|owzvwyz||zz{}u n4rzzs}opAEvp"|pnp3)s#v~ᑍlƑsB|Iᄛᆒ{{z 0 | x`y{ |r}~tw,##xwzw{~zuw"xyz|1T?VXYxX_]R^7\RYYX[WJVIUJWxVTRQPdQFP%NONMN+NJM[MLKJMOQTN NO#ZXY[9 ! 898 # @ ZQG@@GJGD HE F E:4~334=CEDD6~ݑT0v<E7z4} 5} aab_]\\^]^']*^/Y2Z5X7Y6[5[3^/_1a4a5c2h3i2l+k#jkjklk`j)!:5I#)%I05:%R %A;2bѻa4^##5i5a4`.b,a/i(j$ijijj k i5Z2e2idkjlp qp uuq mji/j8m4o0s-p0m6j;kLjXkglkmkjkgmdlckdie`fIe7b/_-^$_-b.e4e%f ebbdfgied3k8rq p onmlj/is.z,z,|;FLtReQ[QTRWHZ:\/a0d0M{Oy1yGxPuRzNzM.LRTSL'-  y/l0a1$0 2$ K K+ 8K(-))('#ɓ0/0 .IA/. /%-(.-  .!$-'1 -#1(!'*&,',(!+'/(0(: ;0;;;#; ? @ ?>">'0&.'91:$1$K,>>5)G)5GH J#K%K(J+D,=*6*5)3%1#1!28=@CF9 J. BB0<GOENaNNOQ,glf^gMf(g!h!2MROf=eef#g MfU N NO#VYZZXjhe5d3ferq p onml x.v?sPlLm7mQq0t/u1t>qMnPm3aRd?c4d8`J^OYQ\E_'@1D6<6%95?FDGDEFEFCHD-EI1E?F8EIF@S%X=S)5%7/83MAWC8&GC9DT&9';3BF<(>5DDFC@5>*U&Y9X)Z5 3, #')-/%:"*B)L, @6/+-.+('" "#%*./-249=BDIIFF6LF!*k.-- .p#)Ipos& 6|763FK19!JMQiN9#KMHC +,,j- d,^+M+ё١1.-&Plmj's*rC6Ia/45}59441--.1j.d/`/M./..-.?.!Jё)Bj&~-2 -YP).)0vGuLrLsCv8D 3AZ ?>FII6*5-6ORQ'I#HHH HHHII#I%I2FJGREbmUqRr^R[RYSTSSQbSdRkRoRMUTQG4mAE6 EJ@*A!AAAAADDGB A DC G"F%F)D+JRSMUYYV_TUu:IIA37Q6(9D+<< D:K9L::*; -:D90L9~9 :Q <8*8.5F7~659M{;z2|=}A~EGvPwFx<  #)##%&' &%l%)B!a8ma?(dJdEOcOI]4D[?@p=fs5kpH$), ),,.C274+KE-&_`` ecZ4Q9@B 0990098190"8%8&/ $=87:@=E{B}M,^j-e3h os.wia$aN_ k vqrbG^sRtGwM;rpCq r#w+wJ:cm?[D GUEbE(CL%:L.OM#TT V YJdE`W+ac SiSY P SnXx\"Z kt@g[@h&'?FIM"Eo# ?G"5+am+m"#ml"mSQN2GKNONh4i?iMh^ijRr\O. ; 0 (  !I(,!.n4* 3ŋ:% 5:ɝE̛#C;Agp'oo+"n-&'&+f+#GIa+#i+ aOO~O";CC Ga^ -YH`ademn q x*w t }+hD!O&@) *a N/F#F@>@EE A>:>AD G!M+P"TTYZU TU TSPP.M,G#G"FECF 40959EL-L-HHKI KIKILHl@lk(k2l7j2hhki k ikij  3PɱJBi@ XOJ@GJE@F4/7FFckBjSSaRwRxOOLLHWHVJSS,9,D-E_F_;SAL»NU$U$NN3,422.424L:J2G?H=H?I9I?J5J?K9K>A 9DE?E>CA@4 EIQSKA97;=QGL:J+J+@,5*5*29,G1H3B545C6I;K8@6,QHv1x&xwwv1WU"V,W2\3]+]$\ZXV1V:]b?b=t< s<a> [3 Y2X)Y$Z(Z02G1Y*4Aj8p<\=Z#:J/Df'@6c5"@*U7U@VBXD[D]B]As6#0* k<# )d6#@,u7#0, V;#0,l< q?  4&/353-).387EG # ,. tCw~xttAG%|&%$~wss}LGH:E,FHB7A-;,=;AJPB3M= 55O l1pn2d2f ec`cd&c2l#nm2ls!w&u1H,J8MAPFK9I,J/E/G=KGH=G8A3CBEFC>;0<r6s2u+t%q#p"oBl9EkLjMiBe)%f0+l*kji%f%d/c1a7`?bDaEcBf!i1BmCnMoRoSp"n+mh9A@5jknpma!e(c0a0`,H+M9K(UYW$TY[\Z VUWDCMJWm16.+,)+-'5$A,+/>L2YQ1S,A .- /90.Y-'.0-0K-aIx,-, % ,(4w3U323'344031210O/z1/8x8w7{7T: $<Y#>T A.89d7bE`v:r9uAn? \4n4g31936@Ay<=w4z.O,JAlR_~kogH@39)n,eC cYNKVM_M#nJdtGwO qUwTwYg\^^T]Q`I[YndY%lUbW"Y"YNZ\ \^]- YH YVTeR!R.w 6v*AvFuMlGl+JcM>>LK 9B@9 3O@  a  k  "+(# % +`-.1d"D ,14.9isz}Fj c ɖ/ g hz{Jx JkdG]hgfnjg/2 $fiimB˙z8|/~8}6}8|2|8{6{8|8 Q= !B 7 78 A8l19`! c0`0_`fnTmTlfmKxTP}W|VxLxk~mpmplkhjk%SAS S U VSS$N"HH,GCEQGNG:K,GUy?S1IP"UTBBGIIRRCSTCTPCn$n$llammyaya1f1l=l=f1f4`--Q/S0P +L+ZY])^))q _$_$_(h(j*j&B#@CHMKOL M P OSNMNQ2ɴ I&A > :!!/" )=<08  80OF<-.b>O>D.S .11b7Z7X6\/d 8X8==h>g>P=[ 6]677[7[5^5 (^q u ^^w{^um]2 _p#p#g>h @jHjHhKhKjUjU:W:XEXUUzKzKHHz@z@>==i@m@wHwHm@m?m?x?z??k JiJmJxKwUwUmKmKvJzJ{{h}h~i~jjhhijjmmwwzzz~z~|wm~m~wwmxzk |j|V<|ic3i'` _oo"o56   002 02 p##qy_y_s|qqs^zzzz ~&_&m&33a{;ZJ;;:{ }|:$%I7#7 C}: H0J>45 <,?:AAD#K")<)# #HJ?l<IFB64!GM5 SN%T:VSUVQ N"UYG:I'L%G!UMV ROV W,$W(W )P.*W X$"CNW O N"J D.Y=I1P=F=E=P._=N1c8Z^ =Q=h.o=.w=.}>.=.?.1.1.1<88%) 9##[ L [] __``d!d'e'e$f"efhijkmno$n&o'p'q(r&r#uw!z}!}'~&'$#"! @%%)#),,e"$ ,?DGCLDTCYCnDCDCDC/B// /B0 0 .7(&(?GJ!!<#<"J:E =I`0)KRKMXTKG@z!:}TH>{4&N9MZb`NVX|2T7@GITٱGGO@9W1S^ ^~w_&3AnLnnnJEA{L{{{ @kGkKkTkTxKxGx@x~kkkkxxx~x?iJi}iiV;WCHjH}?k?{UiU{~j~|j} D))"-#B,0$<#*" m'?(?'F(j$#A-aG.Q-V-W.q-{.-.-.B.Q.h..C+H*Q*Q d(m)A}()I &Q ,! - A*I)T)p)~(% c-c"W"W-[@ ^^#r%?%?7\[W"c"[@\ ^ X b Y$]$] a$Y(a(], W-c-XbD+) M,)!f*:9w$%1:!2;&i+m, B,D-F-N,J-P,S,V,s)s+|+z*u)d,o,}-,-,,+w,"*%$&$ !(k L$F&*},v,p+n*j,g,d+2B I ˖ , .$N  G#Ώ"""M!ȇ%C&i'i$g(l"O$JN'mK) J&(F'%F)+M+ċ+ˑ,,,i+ +E/I/ O/T/ Y/ ^/b/d/"h- k-p.@t/x/@~/h/&//.I."../m5I5d2P3OI9I?Q@D]>@`5fh> 123 9 8sBky8ā8 =="?+4?">慇"H<92F/s%-x#-%/C::>5:=,14+7%10,3*J:&8.$('!)#( ,k5 4-(!) 0 -*# %)3!7*2&4579&1@5I, /#5'#4$+"10)b I,-.n,*4.0<0G6C83:(51/C+)gB:=0+;%-$nC-̝5f<=BGCI 88E77@Y@T@B@ICI6V9 b6bCpCp66DD56D7 7 6-1-)858<4 -(($x$iEA-*! +;H]m! %(-$%$!y cG?%-8@SX],   ]  t/vxx  #J"+)*#;#AJ<)=1ɓ3鲩ʢ13A<C"+HKKNSTY[Z\_`ehilnmruy{ywm +; #)#xpl  '$% # " ! !!*"%<247 68<=@A ?D CFH FGJ KN PQUZ\SQMJIGD@=?= ; 85 23/+-      .235 ?@HU UM #$*169<>BHH N O U W [ ^] b d h k onkfc_[VXSPLHDBDB=>94/-)$ @45S[`dhiopttyx} }ѫ,`XQ N L I A DOQadh nr#%(*/AD Xugety v y n  "%*06 @ @ H K M~%4@ ? H Q mqz r wojr{ xM_[R\RT;-2=]@Y9=\4Z0*\.[*Z"XUU+X , S2UTR"O$M*Q%T$W(X/V5X7Y:W=Y@YEVGRENFRGTITMQSMTPVQZO]RAiC&@O: CM.B9CC?HCFAME<@$KCJ,G4DAyy}z;z85|vu~uBwxvw4~~ ()'+)y*t)r'p)j'g(c%`%[&>'<&5)''#,!*+)()+ HJM RS0/ 0// /a#0-.;-?.].g-m.y/-.,._&?+*,3AI1`41335C616,355 4 53[7g7k6{645632s3l4c3]4415 N&$ʞ#$x1 22_1 ozS2I2"U*V3S9T?XGWSU\U_SpPrRtTQSR W#VWV81 ;:::+:3;;;]=n;u;}::<:@765;1 =<:=^?y>=?>=7<; :PQ!SIb+T3Q=SHTTS`QnOwQOPOPVUrViU\WTXGZ=[1X"YY_}^h`P_K`Ga6`(b$aa`aqp%q0rFqKrZtqs{tKIyKkJ]LXK;L.J K M)O5M>OKJMN JWNaNlLxNLMR!KQPQuRmPeQ_REV4R0S.T)URL$L:M G HGHaI)H7GSValmscB6IE"/435`5e5i5s5y4ˀ4,24 444q 8<>;BKD0")/<"A"E%J'L,L1J4M6L4I5F8E9F8C;?=@>>B@CDBEEFEGGHHKGNJOMMPKTPVPWSZQ[ObNdPeThTlRoNqMtQwUxT{SWSTOROKNQOP_ګX`de}]{]zYwZt_qao[nYlXkYiXgZfWeUVSҩPOrUv1 # "ɑQSI%(.38>@FAh/ У"O.;,B;= ̴"R@+15)9LC4*",)"=BjHѹ` +Ӛh`^yk pi29!9>1IJA*#VBY#@#:91+;# $&)7>@DGKOdWhs ~^RA8/(%co8G 9+ 9@BA{=.s",$0;s.u8n -u#rsqoo l m2Ep mjmj llm n$J ;02//+- / - ,.479=> C GDE#J(M"IA;23Eɽ?715>D!HA:8301,.0129=>@ ADGFDB:64 H 5@) AGEA :EF Hۭvomcc~]w]uZqWoUjTgR]PUMSLPHOFNGJCFAFBB@@?@:.*d~}~{wtt~#Q +!bI2pKkz~}}yl3%ˢʒx#{ptxx?< QVJI;Y$%%1k`opu}wzqݯ}m{e{`y^y\mZ!%T5!bQ%Q)#'4lnnwm|lpptsbRi`rxs{n{n\z]k+bPpyi\lanexb#)!_#(_4b*h!olZWfBV@hI@uF~MRRMvHm/Y&U,_X \.p+$$N t )x=}IGs1R.OLMIGCNJqy~Jm (Ms}셃嘘E+ ˑ|"} |{@|{@yh{&|x`weIwi"cbafaama^IkrkyiO[VVX@HD>K@;Kf^dkC9 ( "+"攁"xvruvq}ʋ`h_t^e_c\YUd-XZVfXm\r\syϞ"&zoxglw "bI{,wzn}ņň;?EIJHD?>8;@?=8I]NiKWNbkqw~IzOT[OxVBi;c2_*Y#W$ifc cT VUbVbZ_YjclinsCnytg}z~}xqsmrgnn`-|eifvroGdIbacgi5y6va;unn y  DHbEb>: 3 0/O1J3g7:>B)D,6C9;>Bar#bydg}iv hlefheA Vgmf9F Wdn1 0#2&1(Y ih0+1 % &0 F=8;C`+n*:";**:ZRQMLE!A"=!;#9#6%4K>/$$1'&);%6"AA!D FJMMSY]h k kopdm92)M#UX ` QlKD8B5PIV^F94 dj X K,BH O.9&K$)CN/: 11 3,YbGc!L%?"SM(L*FC"YS"K&G'B03J./m/, 2-(3/%0<*=M)E'K$M"R[^Ed+"Z'N Y @  !I1% A.5:8@CCBEDFDDLPOYa^ac_aab]gni12zr0"0I i)II9i&a!Yi:91)AYERI QY]^90bjoqv{iAA92P{yvpmiea^XSNCA71+($ JLbJY:3#&+.1{6v:n@fD[ISLIO?R7T0U*X"Z W S$P#M&G'F&C$A&@%<.K<2E4C2D)A2>=7G4O3X.^1U,_*f&i!rv|} ~w#s&l+h1_6Q;J@=D+0| ”!Ҫ%Y*CK9Q6Y4a/f+o'r"{}BD>O9[3c/n(s%|!!=n*{.s3n8b?ZCMDEHd;k0z?)<-G1F4E6O.N1P%:S5_2d/iB1A5@9?>4U2Z.\.`%m$o#p"suvwyz};::<5C4F3I2L1O+X&b%c#f"h!j knqs~ AW@Y>\=^<`,y+{*}(~+p*q(r't&v T-S1R5LFKJJM.4A3D2F+S*VE) W"BYA[6q3u0y1wC)4L0Z+_O).|("\-W>VJQUL\IeCm?y:}642135569;;>@DEGIKNOQSVUZ\abaegddijmompquspgy{~,1*B:!"i2BX*T:Lʳ!9+ n1B9 8+61;"f]cefliei]g]Sl".xi;q0# i2[o%:*F4+g8$9OX X>$XAWEN[Kd@Sogbj:q3xmGiq}rmmifb_YSQLIA<9844[7Z@XKUTP]LiDs@<;9b*^5]@\LYPXYS_QcNmGuC@e+b3c+`;_P\WVeTjPpNzK~HGIyEBa8]W[`UnSyPT}Yo^_cRbIcCdS^gYzY\WTOOn+n3k9jDgMfXbg_z]Ya^fjyngrbvTxEtToclif{erigk\lKo{Uy^xfrnqzrnj?JZk{vnU@60C3@EGT[ip}tg[N@78IWekx{k\E<5e&\/[3Z7XGKiHk77b-f4e8cLcTbWaY`]\Y[]QqGn7e^ch[ZPGIfgcfgklmminfoepcuTvPpUoWrLt?y<|W/EX\kqzvuu69|_)"V"9? 15A9!I#*1)5 21e1!:# K 2 #+%+ 0$#)".i *,F.j9JPcu/gh!'zJyJ vuGrh qfv0A,L8266JM$+)i"B[$Y-%V6CR?OI,OQIVEG`@g>m(:u6y 40+`'I8i-<`DO'GFJ>IJn7`#WTEW{Pz(L(M:?~lBuFmfSVNWNNZd ukɏTaNP^Va ,7,G{"ew(r!*l"Fg$a$|ijfT"hH&C$c |&zur)omj.hb!d$_'[*V$-Q0K)2E7:/97;2N6='emr)v3kl6a(=X?QF; H7 @E)o"y{/A>?gDg<eIoBeoP lc(aEDJ>L6,N1Q(FM(&G6CA?O:]6c1l-q&x&z"~a)r/e4Z7L+7Je;;?.6Dn.P(^h kcwM|  zF!sA*j+/`/^5Q 5Oo?9`B/g)f2Dm:mJ"jRjTg\Keqhb^ e|kpkno^o\sPmtNsC|V|aAuu sWW~OYphYn^`b^^kbU\YXeVjO} LND:*?~CrGlfRXCUN#VI Y:[,b(f&Nh,Ln%u%|'L"c!&! !#;CPϝ_Şnzʙ'ȅtrMa_iS'QIOBEl0>@Kͅ\i z#}dqoa][LYQJM' N-(-9r`4.,)A gA'#=AYLBIs&yL!c[/^ZSc0C-@2~C6(no9x?kDcIYNLQ>T>JQJW.eX&'\"*b {u sp#eT[OeJnEyJyiPn"Va$ZW ZT,\HM];d4l2m.Fw-v7wD.|={KyW pk~x}(ta}wkKhB3b>XDVE;a{cH h  sO!qysu o qsp!)!k"rvs sLr)E  )mlN}QRO{O}Q=UCLBL:<(=<=> v8x/v tqXd`cid\j ^jfiklrmyklijkjoovphnZn\jOi~uvu|}i|Y~L|:}%|}-~>\zhF/)BsiZE>C7226FBR_y~+}ocu{nlvwvtxCg)9"0jh1pk0+)$}f*$f*"kB^"\`AcZ_kgrfqixcdf]hPbH_D`p]z[](\Z] [SY]WaXGoHZFCG&FGI(HEI]HsJHRqP>O(OPOQpopdkac]x\s]hU2!"GNevYwE4*.:cp{srqtuutHwIqgH[G,GHE/g5ov2xfwmtru{vxwnobaczidgkjol^aoGy)!%FCMU isttslrfefcTji lh h1wl=eBf6ih^jg 2!l)m.lJ5kmT7Uxx}ucrRjAg;f7hfeff4=  j`YC=      #"%(*,./13 587<=@ BD EIED   @ %; " 0 7 5:A;;3-')&+,'# (*> m_mkkdzSzSz:*Xvkvk_l_kzkgzkz?c?c?AAHzLzLz IvAvAi@g@eAEzAzA=](r(u=`=` *s*,,q5h577f4{,)@->y6p+z)s(@q^wBWAhA^M^MvJvMzPWvOvO^\^\u^u^^a^a^ 9d[B[DWBW>y34~4{>q=`>\*Pn[nBoDYD_DkCnBnB_6t6[tّ Hu+DnLnjtgr_r_qeqdnfngpjrjsfq_o W\>]foIpLuXpCc;y454e[PiWjW6m^b^cngn0d\joboctFuZu1 3?1$.)"QJ-" L#:BYA1,6: ]3f9B, :4 -3:'* )'%")4K ))+- &  _UL5P:bF $B%!p1q:r?qSrXq\r`pdpjqpnyj}g]fhnL")v3949ݐ0#PYм ~s~j}g~Z}PA~8{)}  ~ *u mpop o!m iec]ZWTQO#n2R3XS3>$##*6 A ɓ{ nNVJag9161&q.sAtQsYt\s`tkqtp!*rqsu~}vCqrsjs[sMq3n*e&TO\^`qmnqt{x &~kywY`PflmNdj~ jVfOFODR-i-k.k@YCV)DR GQeQgVPZPQRQRZ[Z[Q]Q]Z[_[`R`R_P_L` GZ_`` eZ>j% ?(++*,+O)Z'^,]/`0_/]6`4^8]5Z3O1-2 "^a,"Y,,0?/_ ^= 9#*)"*878nv)z"||nx~ :zywuwtwvɲ#@K $+(6XHX B>d3cٳ"'ifhe fc ]Y\Y Y)W9Ki2:j3j`RVSNHGLB>9&-20-BBB j{jj%[0^8YIYI_=a6^|;Z'~;C|Ii{nwr/, ,.,#')% (3';,D-H(O&T%X%(+}+|*&#$=0/([~|+ioWaWb_X_XZNWWk=f9h4n.v/e'I$&} |   & = 4K1 QM OKJI GGDBG II D :8 47 3 /-/ 1//531#$')&("iO>^0"/32X5\2]0T/Z.[.\-W/M.4-,-#++,;,G+\bYD5Ar't2vzLyWwis~vuxzwoze{m}szq~z~|zv~!{d|R}G|7y+z"|zu s_R )<8,H?CS7` HTITn'3%2i" z"r&m w - H83Oe`jy *喥n+dhomnW`VDVX>gO!@QkYlNaNVASDk}sn+d#WII[`))ʛ:d>D3/$t2p.(i5*FDjVyc=.B1H,*(0 =*%!I%B) (-=-A/I* )*# $f!%H%A)<)()^#[Y%X `lcdeB%e+dIvwy鞎뗐ˁ,zrNK SG&ztCttvwx|Jm (%Muq#~E"{+&x{ hh h \XW"W "V&U@8U=W#@ThQ&K[cI_"ksmI~scO\T[De@GfA9k4, !"2+T" w"k"RH> COH\G=M7q755xmu?u?wmwmvmxmz?z?x lv@vl]@]kA >^)sDtIaItLaQoUoZoUc QcZc`aaldafkhq;n3vE_EZ ambsflhtbq;w=w8|1.Byhxcy]xXyQxHyExl@GsKsRsTsYsfs`s++6z6~=o8s0{#TGMFeY~M<8C=|}wJm'b _(a(||}(}=h_h_jJj*)Jk_k_g>g*Ij4 L 3aq3c2b2223Q221q1q1q1q1Aq1r1r2q2a2b2b3b3a3a3a3a2b2a2a223aq3c2b2223Q221q1q1q1q1Aq1r1r1q1a1b11b3c3c3a1a2b1a2a2a2a1b1b1a1a2a113aq3c2b2223Q221q1q1q1q1Aq1r1r1q1a2b2b3a3a2b2a2b1c1a1a1a23aq3c2b2223Q221q1q1q1q1q1Ar1r2q22a2a3a3a3b3a3a3a2b2a2a23aq3c2b2223Q221q1q1q1q1Aq1r1q1q11a1aa3b3a3aa3aa2b1a2a2a2a1b1b1a1a2a113aq3c2b2223Q221q1q1q1q1Aq1r1q1q11a1a2a3a3b2b2a11b1a1a1b1a1a1a2 R 2c2q1ab111A12Q211q1q1q1q1q1AqA1q11a1c1c2aa2a1a2a1a2a1a2a1a2a1a2a1a2a1a2121 2c2q1ab111A12Q211q1q1q1q1q1AqA1q11a1c2c2aa2a1a2a1a2a1a2a1a2a1a2a1a2a12a122 2c2q1ab111A12Q211q1q1q1q1q1AqA1q11a1c1c2aa2a1a2a1a2a1a2a1a2a1a2a1a2a1a2121 2c2q1ab111A12Q211q1q1q1q1q1AqA1q11a1c1c2aa2a1a2a1a2a1a2a1a2a1a2a1a21a21a44  2c1aaa1bb1c1112211111111AA1111aa2c2a1a2a1a2a1a2a1a2a1a2a1a2a1a2121 2c1aaa1bb1c111221111111A1A1111aa2c2a1a2a1a2a1a2a1a2a1a2a1a2a12a122 2c1aaa1bb1c1112211111111AA1111aa2c2a1a2a1a2a1a2a1a2a1a2a1a2a1a2121 2c1aaa1bb1c111221111111A1A1112aa2c2a1a2a1a2a1a2a1a2a1a2a1a21a21a444 X'52b1qba1c1a1a21252b1ba1qc11a1a1111'41b1q1b11a11a11a141b11b1q1a11a11a1'41b1q1b11a11a11a141b11b1q1a11a11a14  A Y Q@A qqqqqqrqqrqqqqrrqqqqqqqqqqqqqqqqqqrqqqqrqqqqqqquqqqBAqqqBaAqAAAqaBuBq!aqAqqAqlqAAqqa1a1a1a1a1aqsrBBqqrvaaaaaasqqCCqqkqvBBdrqAAAAqqBBrAqCC11111ArBraqq Bqqq ADyOAᏅ AFBBOJCᏊBqHAAOMqqqr@A qqqsqqqrrqrqqqqqqrrqqqqqqqqqqqqqqqqqqrqqqqrqqqqqqquqqqBAqqqBaAqAAAqaBuBq!aqAqqAqlqAAqqa1a1a1a1a1aqsrBBqqrvaaaaaasqqCCqqkqvBBdrqAAAAqqBBrAqCC11111ArBraqq Bqqq ADAyAOAAAAAAᏄ AFAAAOJCAAAAABqGAAAOLqqqG qqqqqqrqqrqqqqqq qqqsqqqrrqrqqqqqqqqY; uqqqBBqBBqAAAAqI IrqqqvrqqqBBrAqCC11111ArBraqq Bqqq ADyOAᏅ AFBBOJCᏊBqHAAOM@5 qqrrqqqqqqqqqqqqqqrqqqqrqqqqqqqqqaaqla1a1a1a1a1aqaaaaaakd  uqqqAAqqBBqqCCqBBAAAA4=`d 666664aaaaa4baaa1baa1caaa12a2a1332 666664aaaaa4baaa1baa1caaa13b134qq!!qqqa111aq!!!qQAAAQ114  J?@ ‘’aahjgicaaaaaacFiqG qrq qqqa11111ab baoojaacaoojcbook?@ ’‘aahjgicaaaaaacFiqG qrq qqqa11111ab baoojaacaoojcbook; ooifcFqGqrq qqqa11111ab baoojaacaoojcbook>4 qqaaqiaaaaaqi 4F 88211AQ2eA1aEaA1AAAA11AAAAaBAAAa4a5aaBaBb4b4baAaAb2ba2baa1ca1ca1aaaa112a2a3b2332388211AQ2eA1aEaA1AAAA11AAAAaBAAAa4a5aaBaBb4b4baAaAb2ba2baa1ca1ca1aaaa113b3a2a234324su+'F qAqqAAq AqqAAq qAqqAAq8 8 qqqrqqqrqqsqqqsqqqqqqqqqqqsqsqqqqqqqqqqsqqqqssqsqqqqqqqqqqqqqqqqqqrqqqqqqqqqqqqqqrqrqqqqqqqqqqqqqqqsqqqqqsqqqqqqqsqsqqqrqqqqqqqqqq/ / qqqssrrqqrqrsqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqrqqqqqqqq&E aaaaaaaaaaaaaa aaaa b%B qqAAqqA qAAqAq qAqqAAq4f  fN*!bfdqocqbccqbiqcbobqocqoaqobqfobqgaadqoaqobqdaobqocqoaobfoaqocqoaobqeoaqocoaobqekbqaebdoaobqeoaqaagdoaobqemaqocoaqobfoaqaclqoaqobqfldqabdqoaqobqflaagjqoaqobqfobqocq#h#bqf"iqfoaqoc%f%aqe$hfkcqbaad%f%aqe$hfnaabbbbd%f%aqe$hqfobqoc%f%aqe$hqfobqoc%f%aqe$hqfoaeceq#h#bqf"iqflbcadqoaqobfobqicdqoaqobqfd#jqocqg#fql%qfc%iobqf%ek'fc%daqbbdqf%ek'fc%ddqcafqf%ek'fc%iqocqf%ek'fc%iqocf%eqk'fd#jqocqg#fql%qfladadqoaqobqflbbadbdoaqobqfnaqldoaqobqfoaqocoaqobqeoaqocoaobeoaqocqaaajqobekdedadqbbjqobekaebdqbmqobeobqanqoaobfobqocoaqobqfaoqocoaobqeoaqocqoaqobqfdlqocoaqobf!bdfqocqdccqcebqf:"q!!q!q!q"aq"q"q"a"q""q"a""a""a""a""a""a!!aA!a!a!"A"A!!!!qqqq!!!!""!!!!!!!!!!!!!"!"!",e$h#ɱ#)!1#$!!2#'$!!"b'%bac'!!gȂ'!!!#!'!!'#1!'a!!'#2!a'a!a!!!acb'a!aaabca'a!aabbȂ'a!a!&'a!a!'"'a!a!"!"a'a!"acb'aacbb'aab$'a%&'a!'&'a!''!'!!!!A!!!!A!A"""""""""""""""""!" q'+t'z$t$vy#q {"r ry!t3asx!ta33ay!ta33a!a33aa33aca3aea1acaaaa1aaca1aqea1aqbbqa1aaca1aaqa1aaca1abbae1aea1abqa1aqa1aa1aaddddq#!$!!q#'+t'z$t$vy#q {"r ry!t3asx!ta33ay!ta33a!a33aa31"aca#aea$a"caa%"aa%"aca&#ea*bbqa*aca&#aqa%!aca#a!bbae1aea1abqa1aqa1aa1aaddddq#!$!!q#'+t'z$t$vy#q {"r ry!t$sx!t$$ts!t$$&!)&/!c/!c/!aa/!a/!c/"c/"bq/"c/"aq/"b/"b/"b/"b/"q/!q)%)%)%)$$"q#!$!!q#'+t'z$t$vy#q%st"r*#t!s/#s!s/%!r/&!/&/&/'/(/(/(/(/(/)/)/)/(/(/(/(q/'q/'/&/&/&+'*$)'$q#!$!!q#4#m    w # ACCACCACCACCACCACCACCAAAAACCACCACCACAAACAACAACAAACCACCAAAAACCACCACCACCACCACCACCAAAAACCACCACC# ABBBAABABBBABAAAAABBBBBAABBBBBBBBBBBBABBABBBBA# AAAAAAAAAAAAAAAAAAAAAAAAAAAA# AAAAAAAA   +g $ CCBCCBCCBCCBCCBCCBCCBAAAAACCBCCBCCBAACBACBACBAACBCCBAAAAACCBCCBCCBCCBCCBCCBCCBCCBCCBAAAAACCBCCBCCBCCB $ AAAAAAABBABAABABABABBAABABAABBBBABBABBABBABBABBABBAABABAABBBAAAA $ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA $ AAA  L $ BCBBCBBCBBCBBCBBCBAAAABCBBCBBCBBCBBCBBCBACBABBACBBCBAAAABCBBCBBCBBCBBCBBCBBCBBCABCAAAAABCBCBC $ ABBBAAABBBABABAAAABBBBABBABBBBBBBBBBABBBBBAA $ AAAAAAAAAAAAAAAAAAAAAAAAAAAA $ AAAAAAAA   ! qsqq ! qrqqq ! qrqq !    # qsqq# qrqq# qqqq#  4R?F   m9 qrq qrq qqqq   v qrqq qrq qqqq  o" ABABBABBABBABAAABABBABqAABqAABrAABqAABBABBABAAABABBABBABBABBABBABAAABABBABBAB" qqAqAAAAAAAAAAAAAAAAAAAAAAAAAAA" qqq" qqqq   H ABAABAABAABAABAABAABAABAABqABrABqABAABAABAABAABAABAABAABAABAABAABAABA AAAAAAAAAAAqAAAqAAAqAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AqAqAqAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAA  i! qrq! qqq   d% ABBABBABBABqAABrAABqAABBABBABBABBABBABBABBABBABBABBABBABBABBABBABBABB% AAAAqAArAAqAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA% AAqAqAqAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA% AAAAAAAAAAAAAAAAAAA  % qsssAsBABABAAAqBAAqBAAqBABBABBABBABBABBABBABBABBABBABBABBABBABBABBABBABBABBABA$ qqqqqqAAqAqAqAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA$ qqqAAAAAAAAAAAAAAAAAA$    $ qsq$ qqrq$ qqrq$ qqqqq 4^ S* qqrq* qqqq* qqqq 4Q \l;;L;A!!!!A9A$"A9A!!!A9A!!#A9A!!!A9AA9L999999OC9A!!A9A""#!A9A&"A5A#""!!A5A!"!"A5A#!"A5A!"#A5A!!!A5A!A5A!A5OC5555555%55OO5A A5A"" A5A!!!"#A5A!!%"#A5A!!#!!"!AA"!#"!""!AA!""!②!!!!AA"#⡑!""AA!!!⡑!!!AA!ᒢ"!#!AA!$"!!AA!!"!!"AA!"!!AA !!!AA !!!#AA !!!AA !!AA !AOO;;L;A!A;A""A9A"%A9A!"!q!A9A"!!A9A!A9L9999 99OF9A!A9A!!#A9A!!!!!A5A!#!!#A5A!$""!A5A"!!!q!A5A!!"!!q!A5A!!!!!#A5A!!!!$!A5A#!A5AA5OF5555555.#55OOI5A! A5A! " A5A! "!!A5A" !&!A5A!! "!""AA!"!!!!!!!"AA!!"'!"%AA!""##"""!AA!!!%#!"!!AA!!"!"!!!!!q!q!"AA!"!#!#!!!#!#AA"!%"!!!#!q!!!AA$'!"!!#q"q!AA#"!"#"!!!q"!AA#"$!!""!""q!!AA!#!!!"!"$"AA!"!!!"!q!AA#!!!!!"#"!AA!""!!"!!!AA!!!!!!!AAAA!AOOI 77M7A"!!A5A!$A5Aq"q"!A5A!q!!#A5A!r!q$A5Ar!q!"A5Aq#r!A5A!qA5M5555"66OE6A!!A6A""!A6A!!!""A2A!q!!$A2A!#q!!!A2A!q!!"!"A2A"!$!!!A2A!qq!q!%A2Aqqq"q!q%A2Aq"q"q!!A2Aq$s!!!A2A"#"A2A"q A2OE2222222*%55OOE5A!!A5A ""A5A!"!A5A" $!!A5A#q! !!!!"AA"!!!%"AA!q!#!"!$"AA!!!#!!"!!AA"q$!q!!"#"!AA$!"q"q"!"AA!!!!q!!!"""AA#q#q"q!!q!!"!AA!!!!q#q"!""!AA#r"q!!q"!%!AA"rq!q!q""!"AArr#q!q!#!!AArsr"r"qr'!AAr"qq!q"s""!AAs#qqqr"!!"AAq#"qqqr!""AA"!#q"qr#!!AA#!q!"q#! AA!q"qq!AAq!!q!AOOE4&wT Di ‘  ’• ‘“ ’ ‘+   R     ,  ,  "> 4k> /8^^qqA]baA]aaqA]aaA]aaA]aᢑaA]aaA]a!a"qaA]a!aA]a#qA]b!A]auA]aqA]arbaA]araA]araA]arA]] ] 7VVUqqrqUssaqUabbqUa•qbUa“qbUa“Ua“qUa“qUa’aqUa④qUaqUaqUa!a"aqU!a#a$qqU!a"a"qU!a!#rU!a%!qrU!a$"qUab#aUbseaUqaxqaUqarcqaUqaraaUqaraqabUqaraqdUqaraqaUqaraqaUqaraqaaUqaraqUqaraq UqaraaUUU"6QQOOAAAAaqaqeraq AAqqrtrAAtvaaqAAbataaqAAbbqaaqAAaaaqaaAAaaaqaaqAAaaaqaaqAARaa\aaAARaa[aaqAARaa[aaqAARaa\aqaAARaa\aqaAARaa\AaqaAARaa[aqaAARaa[aqaAARaa\aqaAARaa\aaqaAARaa\aaqaAARaa^baqaAARaa^qaaqaAARaa]aaqaAARaa]aqaAARaa]aqaAARaa]qaqaqAARaa]qqaqAARaa\aqAAQaa\qAAbbUaAAcadbqaAAaaaqgqaAAqaatrqaAAqbcwaAAqbaqfqaAAqbaqcaaAAqbaqcbaAAqbaqcbaaAAqbaqcqacaaAAqbaqcqcaAAqbaqcqbaAAqbaqcqbaaAAqbaqcqa cAAqbaqcqafAAqbaqcqbaAAqbaqcqbaAAqbaqcqaa AAqbaqcab AOOA!.PE-(W!!!!!a!a#aA!aAqAaAqqA!!q""a$a"a#$a!a%a&&q$a'!q!a&a#"(!a&qa"q$'a%($+(.%q/$!!!!!a!a#aA!aAqAaAqqB!!q""a$a"a"'a%a#!#a"q%a%,a"!"q!a%!a$&q$%(("!qa*&a/!"!ar!.!!!!!a!a#aA!aAqAaAqqA!!""a!$a"a!(a%a""$a!q'a"/a!$q!a%!!a!(q%")($qa)$%a.$ar!+!!a!a!A!AqAAqqA!!!"a"$a"a)a%!a#%aq(a/"a&q"a$!!a+q$"*&)qa'!*a))ar!&A!AqAAqqA!!#$a"*a%!%%aq'/$'q"a#"!,q%#*%+qa',a&,ar""BBqABqqAqq$$a",a$&%aq&/$*q"a$!.q%$+#-qa%#,a#/ar"BBqABqqAqq$$a"-a$'%aq%!/#$'q"a$/!q#&+!/qa#&,a/#aqBBqABqqAqq$$a".a$(&aq#"/"&(q!a"/#q!'+/$a)*/%BBqABqqAqq$$a"/a$)&aq"#/!((q!a/%!()/%+'/%BBqABqqAqq%$a"/"a!+'a$/*)/%"*&/%!-$/%BBqABqqqq&$a/#!+&!#.!*'!/#!!,#!/#!/!!/#!!!"aaAaBBq!qq&$""-&($%,%($&-%,!$-$!-&-!!!!!a!a#a!aa!A""a"a"$!"a!%("a(%"a%!(a'%"(('#(#'(&$(+(!!!!!a!a#aA!aqAaq!!q""aa"a%a$a(#!q#a*##a$$#"!a)#"*#(&#%*#('#/!#!!!!!a!a#aA!aAqAaAqqA!!q""a"a"a&a!a%a*#q$a+&a#&$!a*q$+"((',*)/%!!!!!a!a#aA!aAqAaAqqA!!q""a$a"a%"a!a%a(%q$a)!a&a#$&!a("q$)$(&)*,'/%Z.UUTTqTT"q!TtsTTTTT T -TSSSSqSqSrqSSSSSqquSqvqqS!OC#SSSSSSSSS S ),QQOOHAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA//&AA//&AAAAAAAAAAAAAAAAAAAAAAAAAAAOOH  "qrqrqqqqqqqqqqqqqq’qƒrqqqqqqqqqqvqqqqqqq#OO$~qt"qqqqrqqqqqqrqqqqq’qqƒrqqqqqqqqqqvqqqqqqq#OO$q}qu2QQqqqq1"1!!!!!!!+ 1RRQQQqQqqQqQqQ1qQQ111QQ!|!!Q#1111q"!QqQqQNQQQQ"""""Q/&Q/&Q/&Q/&QQQ-0SSOOJRAARAARAARAARAARAARAARAARAARAARAARAARAARAARAARAARAARAARAARA""""""""""ARA//(ARA//(ARAoohARAARAARAARAARAARAARAARAARAARAARAARAARA#####ARA%&&&&ARA//(ARA//(ARA//(ARA//(ARA//(AROOJRR R 4 M&$_qRS^QqRqQqQqQQ^WqRqVVVYSrSVrSXRqSQqQV1qqSXWqRrVSURVSQRaR[qVRV1111RTQQTaQCQaTwTqqqqqqT1111qTQRqRQQRqQaQqqqqqSqQBCQqSQqAOFQQQQTQ[S$^qSqT^RSQq^ZqRqUVVXqRSRVrSXTqVqV1qqSXWqQqQVSURYVSQRaRVRV1111RTQQTaQCQaTwTqqqqqqT1111qSQQRqSqqQaQqqqqqRqSBBQqqQqqBqOFQQQQQRSQSY{O#&"""""""""!//(//(ooh#####%&&&&&"""""""""!//(//(ooh#####&&&&&&"""""""""//(//(ooh#####&&&&%&"""""""""//(//(ooh#####&&&&$&!"""""""""//(//(ooh####"!&&&&#&!"""""""""//(//(ooh####!"&&&&"&""""""""""//(//(ooh!#####&&&&!&""""""""""//(//(ooh"####$&&&&4   11AAAAAAAAAAAAABCBAAAAABAAAAÁA"!CA!!A!!" $11AAAAAAAAAAABBCAAADBABDBAAAAACAAAAGAABAAD#ȃ""BāAA!"""ABA"!!A"#!""!!!""$"!!"611OOAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABAAAAAAAAACAACCAAAAAAABAAAAAABBBAAACAAAAFDBAACCBAAAADAAAAACAAABAAAAAAABAABAAAABABBAABABBBBAAABBABAAAAABABAAABAABBAA!!AAĂAABAAA"!AAŃAAAAA"#AAƁCBAAA##AAABBA!#$!!ABAAA""!!AAAAA+'ABA#!%#BA"#!!"AA*!!AA!#"&AA#"!!!AOOA 11AAAAAAAAAAA‘BAAAq"AA%A!!AA!A!A%A& %11AAD‚BqÁAqAqFAqCBAAAqAAAB!ÒArBAq%"AqAq'rA'!""$%!#!!! ! %!"!'"&&!)$!OD"611OOAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABAAABAABÁAAAāCAADAAAAACAAAAqCAAAqqAAAAqrAqBAABqBqABqAAAAAqBArAAqAAAqAqBqCABAAAAAqBqBAqADAAABCrAArAACA!AABsAABqA(AA#AArBqA,AA!!AqC/AA!qB*"#AA!!!&(AA!!)AA!$AA!!AA"!AA"!AA !!!!AA$!!AA "!$AA !!!AA",!#AA+*AA**"AA.##"AA#"!!"!"!!AOOA[ 11񓡑a!a"񔡔aa!!a!a!a!q!q!a!qa"ra!q!!r%qa$ "11񖡒!#c"!b!!"!!aaacaabaabaa'a%aa""ab!!!aaaq!!a!r!aaaqa"aa!!r!aa"r"a!ra$at#baqqb#raqa!$asa!#!s$$tb)rqb"%qs$!!OC"611OOAAAA!"AA"a!!#AAba!#AAba#AA!aa!AA!aa!AA!!a!"AA!a!a!AAa!AAaAAaaAAaaAAbaAAcAAbAAa!aAAabaAAa!baAAaaaAAa!)a)aAAa!!!$!b&"aAAa#!#ac"aAAa"#!abaaaAAar!"acaAAaaq"!aaAAa"ar!!aabAAa!ra!!!aaaAA!rb"aaAA!ra!abAA""s"bbAA!#s!#aaAA""t%bAA"sqa"#aaAA"uaa!$aaAA!rraa%aaaAArrc%aAA!uaa"aAA!taqa!&aAA!rrb,AAub!%"AAva&&AAwa!(AAwb!-AAtrc#(AAxa+AAru&!!!AAy!.AOOA4 +  `!y"&11qqq)qqq!)qqa!!c!fa!!g!b!!a!a!!a!"!q/!/!# 11񟟒񟟒񟟒񟟒񟟒񟟒񟟒񟟒񟟒񟟒񟟒qqqrqqst/$qrqr"/$qqqqq"#a/qqqaa""b&a#a"faa!"aac!bba!abqb!#bc!a!aaa!aaa!!!"$aaa!ab!!!!"#a$a"q"a!!#!!!"sasatbrarqssr//"//"//"񯯢=?11OOOMAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA,/"/)AA$///%AA///+AA///+AA///+AA///+AA///+AA///+AA///+AA///+AA///+AA///+AA///+AA///+AA///+AA///+AA///+AA///+AA{AA{AA{AA{AA///+AA///+AA///+AA///+AA///+AA///+AAAOOOM 4?n3???3???1r??2q3q2rq??qqssqq??qrqqsqq??qrqquq??rrqsq??rrrrr??qqsrs??1qrsrs??rrrrqq?=1rqqraqba2a?;qaqbqaa2b4?=?>?7?=1>1???3??5:??7<OX 4qa3c4b4344455q5q5q25q122qA11Aq1q55A5A25B4B4B4A1A4A1A4A1A4A1A5B5A41A6A5 3qa2c3b3233Q455q5q5q22q3q211r1q4q4a4b24b4b4a4a4a4a4b5a5a5a4 3qa2c3b3233Q455q5q5q22q3q211q2q4q4a4b14b4b3b3a4b5c5b65 3qa2c3b3233Q442525q5q5q54q31q22r213a21b6b5b2a5f5d15b111qac1b13121Q322333q13q13r3r3s21q13a4ba4a3c1c21e133b11qac211b11122121121Q21A21A3q3q3s31ra6a31ra3c21qg132f1 6126273727272A1qa23Ac22A1b1A2A11A7a4c1re1Qub1 6126273727272A63A1c22Aaa1A2A1A2A8aa16ceqqb111q2>?2/"/"/"rrr/""$11񟟑񟟑񟟑qqqqq3?91??1??1??1񏏁//!񏏁//!//!//!q//!qqqqqq//!q=?11OOOM1AAAAAAAAA򟟛AAq񟟚AAq󟟘AAqqAArrqAAqqqqAAqqAAqAAqAAqAAqAAqAAAAAAAA5AA956AA=::AA??>1AA???62AA???;AA???;AA???;AA???;AAAAAA///+AAAAAA///+AA///+AA///+AAAA///+AA///+AA///+AA{AA///+AA///+AA{AA{AA///+AA{AA{AA{AA{AA///+AA{AA{AA///+AA///+AA{AA///+AOOOM4 ]6  a 1a35a94a1a5a4a9a52a8a5a34a16aa6a4a42a6a?3a?3a?3a?3a?41A1b1ca3ea4bi4abc4q2fcq4aaaaq5da1q9b2q?2q2abaadcA1b2654d4e2b2aeaada cbbb3b3aad3ad41d9a: 211111qqqr1q114131177 7q6q9q628q52q1;q5145q513q44q51211Aaaa1aAa1AaAaa1qbaqaaqqasrar1uq2rs :q635q5q5q3q2q7q53q62q1q41119511612a1Aaa1aaa1Aba1qbaqaaqqasrar1uq2rs$31111A11A12A211qq1q11111221212121212121q2q1q2q1q2q1q11$31111A11A1A2A211qq1q11111221212121212121q2q1q2q1q2q1q11$211A1ABB1BA1C1AA21aa1b1c1c1c1ba1babababacaaa11111111111111111111q1q1$211A1ABB1BA1C1B1A1aa1b1c1c1c1ba1babababacaaa11111111111111111111q1q1!2c21eabaAAa1A12321aa1bqabqbarbar1aar1abqb1aq1aq112221212121212121212121!2c21eabaAAa1A12A2A21aa1bqabqbarbar1aar1abqb1aq1aq112221212121212121212121wb 221A22232b2c1d51d31e21e2a1bb1bdcdceaac1acacab11 221A222q22q3r2b2c1d1d1e1e41bb1adcddeaac1acacab11 223q1A3q222q232q2b2c1d51d31e21e2a1bb1bdcdceaac1acacab11 222q1A22232b32c11d21d2a1e1a1e1a1bddcdceaac1acacab11 221A222232b2ca1d1a1d1a1f1f1bcdadeac1acacab11 221A222232b2ca1d1a1d1a1f1f1bcdadeac1acacab11 221A22232b32c11d21d2a1e1a1e1a1bddcdceaac1acacab11 1bdcAbcaaa12r1s1t1qr1qA1rA1rA1rr11111111111q111 1bdcAbcaa1a1r1s1t1qr1qA1rA1rA1rr11111111111q111  211111321q1q1qq1q114131177 211111311qqqq1q114131177 211111121r1rqqqq1q114131177 2111114221q1q1qq1q114131177  %8B7D7AA7qA7B8B7C7B888q8qA7r7rq7qq7qr7qq77a6b4qb13qa2333114123122b12a122c122c122c12c31aa2aa12b42b111 %9B8D8AA8qA8B9B8C8B998q8q8q7qr4qa21qqd1rq2b1q4a168887172312212a122c122c122c12c31aa2aa12b42b111 %9B1q6D1q5AA15qA5Bb5B11a4C3b2B434aq2r5s6q67r8t9r9s9q988887172312212a122c122c122c12c31aa2aa12b42b111 .667a7a7a6b6a6a66a3B61D61AA6a1qA6q1B6q1B7C7B7q7q8q9q9r9q999qq9q988887172312212a122c122c122c12c31aa2aa12b42b11143  s1+t1 qC ".r&r&q%rvtqrqsqrqqrrqtqqqqqqqqqqqqqqqrqqsqqqqrqqrqqqrrqqqqrqrrqqqqqqqrqqqrqqqqqqrqqqqrqqqqqqqqrqqqqqrqrrqqqqqrqrqqqqqrqqrqqqqqr!qrqqqqqt!qqqquqqr!qsqqrqqr!qrqqrrrr!qrqqqrqrr!qrqqsqrq!quqrsq!qrqqrqq!OOB!AHIIA!AHIDBA!AHBDBCA!AHBDBCA!AHACAAqCqAA!AHACAAqCqAA!AADACABqAqBA!AAACBDCqAqB!ABqBBBDrAAqAq!qq qr!qqq!,##!s"%###qqr!!rr r!q!"",q"q!q#!"qq"-"!"!!q!q!q!-!q#q!"q!q!q.!q#!""q"/##!q!/!#$/$".r&r&q%rvtqrqsqrqqrrqtqqqqqqqqqqqqqqqrqqsqqqqrqqrqqqrrqqqqrqrrqqqqqqqrqqqrqqqqqqrqqqqrqqqqqqqqrqqqqqrqrrqqqqqrqrqqqqqrqqrqqqqqr!qrqqqqqt!qqqquqqr!qsqqrqqr!qrqqrrrr!qrqqqrqrr!qrqqsqrq!quqrsq!qrqqrqq!OOB!AHIIA!AHIDBA!AHBDBAAA!AHBDBBqBA!AHACACqCA!AHACAqBqBqA!AADACABqBA!AACBDBqAqAA!AAqAqABBDBAqAA!qq qq"q","qsrqq%#s"rr#! q"!!qq!,"!!"!r!!r-q"q"!#q#-"q""!q!q!.#q#"!q!q!/"q"#q!q/!!q!$/$".r&r&q%rvtqrqsqrqqrrqtqqqqqqqqqqqqqqqrqqsqqqqrqqrqqqrrqqqqrqrrqqqqqqqrqqqrqqqqqqrqqqqrqqqqqqqqrqqqqqrqrrqqqqqrqrqqqqqrqqrqqqqqr!qrqqqqqt!qqqquqqr!qsqqrqqr!qrqqrrrr!qrqqqrqrr!qrqqsqrq!quqrsq!qrqqrqq!OOB!AHIIA!AHIDBA!AHBDBCA!AHBDBCA!AHACAAqCqAA!AHACAAqCqAA!AADACABqAqBA!AAACBDCqAB!ABqBBBDrAAqAq!qq qr!qqq!,##!s"%###qqqq!!rr r!!"",q"q!q#!"qq"-"!"!!q!q!q!-!#q!"q!q!q.!q#q!""q"/##!q!/!#$/$".r&r&q%rvtqrqsqrqqrrqtqqqqqqqqqqqqqqqrqqsqqqqrqqrqqqrrqqqqrqrrqqqqqqqrqqqrqqqqqqrqqqqrqqqqqqqqrqqqqqrqrrqqqqqrqrqqqqqrqqrqqqqqr!qrqqqqqt!qqqquqqr!qsqqrqqr!qrqqrrrr!qrqqqrqrr!qrqqsqrq!quqrsq!qrqqrqq!OOB!AHIIA!AHIDBA!AHBDBAAA!AHBDBBqBA!AHACACqCA!AHACAqBqBqA!AADACABqBA!AACBDBqAqAqA!AAqAqABBDBAAA!qq qq"q","qrrqq%#sq"rr#! qq"!!qq!,"!!"!r!!r-q"q"q!#q#-"q""!q!q!.#q#"!q!q!/"q"#q!q/!!!$/$ /_$b%qa%c"$ac!b!e&"qac#b"caae!acbad!ebccfafbqdbhbqb!abhbq"abhb$bha$cha$ch!#cdqba"!qbbrca!%cr"c!a%bq$ba%ba&d!$b!b&b!$a"a&a$!a!a'a!$!c'a!$"a&a!$!'!a#!)a#+$b%qa%c"$ac!b!e&"qac#c"caae!acbae!ebbdfaecqdbhbqb!abhbq"abhb$bhb$cha!$ch!#cdqc!"!cbrc$er"c!$cr#c!#c#a$c!#b#a%b"#a!#a%b"#a""a%!b"#a"!a$b!#b!"$!a!#!(#a$'"a%'"$b%qa#!b"c"qac&"cb#c!acaaf!ebaefbbdqeaecqb!abhbq"abhb$abhb$bhb$cha!$cha!#cdqca!"!qbbrbb$cr"bb$bq#ca#b!a&ba#!b!b&aa#!a"a%ba$a!%a!a%b!%b!a%a'a!%a(!$a(!$*$b%qa#!b"c"qac&"cb#b!acaae!ebadfbccqeaebqb!abhbq"abhb$abhb$bha$cha$chb#chb"!qbbqcb!$cr!b!b$c#bb#c%b"a#!c&a!"a#"b!&a!"a#"a!&a!"a##a&a!a##a%b!#"a'a#$!a&a"&&" 4i/#b/!aq,"c-ca%&e!b$b#caq#eaac"dabca"ccbe"bfaf"bhbdq!bhba!bq!bhba"q!ahb!ahc!!hc!abqdc!acrbbq!!a!c"rc!ab$qb!!d&ab"!b&b!b"a&a"a#!a'a!a!#!a'c!#!a&a"&a!'!&a)!&+/#b/!aq,"c-ca$&e!b#c#caq"eaac"eabca"dbbe"ceaf!bhbdq!bhba!bq!bhba"q!bhb!!ahc!!hc!cqdc"crbc!!!c"re!!c#rc!!c$a#c!"b%a#b!"b%a#!a!"b!%a""a!!b$a!"a!!a!$"!b$a#(!$a"'$"'/#b,#aq-c"b$&caq#c#bc"faaca"eabe"dbbf"ceaeq!bhba!bq!bhba"q!bhba!bhb!!ahc!!ahc!acqdc"bbrbbq!!bb"rc!ac#qb"ab&a!b#aa&b!b!#ab%a"a!#a!a%!a#a!b%!b#!a'a&!(a&!(a&*/#b,#aq-c"b%&caq$b#bc#eaaca"dabe"ccbf"beaeq"bhba!bq!bhba"q!bhba!ahb!ahc!bhc!bhc!bcqbbq!!b!b!rc!bb#c!a"b%c!a"!a&c!!a"!a&!b"!a"!a&!a"!a!a&a#!!b%a#$#a'a"$"a&a!$"& /q"#q!'sq"sq&qqq$!"qqq&qqq#q""qqq"a"AA#q!"CadAq!!q"AAbc!!q"a!a!a!aq"! /q".sq.qqq$!.qqq#q"&a"a"AA#q!&cdAq!!q'cc!!q&a!a!aq ''&&%q%%qq$t$s$qq$qq$C$C$!/ "!abbcbabb!b!aa$a "!abbcbacaa!aaa!aa#a *))q(q'q'&r&rq%tq%t%rq&qq!&qAq&C&C&"&"@ #!"aa!bb!acadbbaacaaa!a!aa #!"aa!bb!acabbcadaa!aa!aa R!/..q-q--q,q,,r,s,qr,qq-s,C)!C(aaB'bb#'ac&ad&bba&aca&aa'a'aa&aa%bb%ac$ab$bc$ad$aa%aa%aa/%/#/#q//q.q.sq-rq-rq-qq-Aq!-Bq!+!B*aaA)bb)ac(ad(bba(aca(a(aa'bb'ac&ab&bc&ad&aa'aa'aa **q*)!)q)q!))!(q!(q(r(s(r(rA)A!(a!(bA(aaA!(ba(bb'ca(a(aa'bb'ca'ba'cb'da)aa)aa)aa!+'!"&"&!&r&qq&&q''q'q'sA'sA(r(qAq)Bq(aA(bA(aa(ba(bb'ca(aaa+bb+ca+ba+cb+da-aa-aa-aa'&"%B$"$#q!#q#qq#rq!$q!$rqA%qqq%qrA%tB&raA&rbA(aa(ba(baa'db(ca*ba*cb*da,aa,aa,aa"!"!"!!B!!!AA!!!C!A!qCBrAa!sAb!"rqab!#taa!!%raaa'aab(ca*aaa*cb*a!aa,aa,aa,aa/!/!4l DD11OGAuAA!r!yrAAs!ust!AAra!x!t!AAra!qu!uAAs"utrAAq"s!r!&AA!r!q!""AA"!!!!AA!a!!AAa!"AAa#AA!AAaAAaAA!AAAAqqAArqaqAAqqaqAAasrsqAOG  ((11OOGAu~AA!xzAAuvsv!vrAAq!r!tz!sr!qAA!s"wv!rr"qAAt#yt#rs!qAAt#str"w!qAA!r#t#y!!vrAAqra!u!su!aqtqAAs!u!warqAAs"at#s!q#q"!qAA!s!s"!"#qAA"qa!!a!!#qAAa!!!!AA#!"$AA!"!"AA!"a"AA!a!"AAaa!!#!AAaqqq!!!AAba!a!!AAa!qAA#aAA!aAA!AAaaAAaaAAaqqAAaqqrAArqaqAAqaqqqqrqqAAqqqbrAAaarqqqAAqatsqaqrrsAOOG  =?11OOOMAvsAAqzv|usqAA"w!qzqAA!x!rzvuAAqv!tv}!{sAAq!t"{!qst!rAAq!u#xxyru!rAA!u#ax!t|!q{"rAA!u#aw!tz!{"rAA!v!a"w!uv!"vs!rAA!qt!a#t!~"us!qAA!r%s!a!xr""z"rAA!u%ss!a"wv!"y!q!qAAv"q!a!v!a"!a$w!qAAx!a!w!q!rvq!bq!tq!!qAAv"q!v!!xr!a!s!!qAArq"a"tqavt!q!!s!qAAt$aw!a#t!r%r!!"qAAt$a!v!a!!s!!!"r!#"rAA"u"t!a!!!a$!q!!qAA#s!a!"b!"!"""qAA"a"#a#"$"!!AA!!!aa!""!!!AA!!a"!""!#!AA!!a""!!##AA"!a!"!#AAa!#a"AAa!$a!"AA!a"#AAb!"a"!!AAaa!!!"!AAarqa#!"AAaqqq!""!AAcb!a#"aAAa!!!qAAa!!qAAa!#a!$AA!a%aAA!!!aAA!!"bAA"qAAa"qAAaaaAAaqaAAaqqAAaqqAAaqrqqqaqAAaaqqasAAqrqraqAAarbqqaqqaaAAqaqqqqqrrrqaqqAAraaqaqasqrqqAAqaqaqcaqqqAAqaqqasqqqqaqqaqAAqaaqarqrqaAAqawqqqqaqrrsarqAAaqbraAOOOM :\b 111A111‚223q3q3q3r3r4q12r2r3q4a4a4a3ba3bb3b1a4c4ba5aa6qa6a51b7qa6 111A11123q3q3q13r3r2q2q3q4q4a4b4b3b3aa3bb4aa4a1b4bb5aa5d5qd42qa7 2111A11123q3q3q3q3r4q2q2q3q4a4a4aa4c4aa4a1c4a1b4a2b4b1c4a3a4b2b4qa3q33 3111A11123q3q3q3r3r4q4q3q3q4a4a4c4d4c4ab4a1c4a1b4b1b5a2a5b1q5qa243 111A11123q3q3q3q3r4q4q4q33a4a4c4c4b4b4c4b5c5b6aq6a6qa5 111A11123q3q3q3q3q4q4q33a4b4c4c4aa4aa4a1a4d5c5aa6qb6a51b7qa6 111A11123q3q3q23q3q42q23a4aa4c4d4aa4aa4a1b4a1c4a1b4b1b4b1b5ab5qa1b42qa7 11111A11123q3q3q3q3q42q123a4aa4c4c4ab4a1c3b1b3b1c3b2c3c1b4a3b4b2b4qa3q33 2111A11123q3q3q3q3q4q4q1433a4b4c4c4aa4ab4a1c4d4b1b5b1b5b1q5qa243 111A11123q13q3q3q3q4q4q3q3q4a4a4b4c4c4b4ab4c6c6aq6a6a6qa5L5618=43;3<747815549553=176:25=85<16375:4773=;8488156 :+===A<===‚>2?q?q?q?r?r?1q1>r>r?q?1a?1a?1a?ba?bb?ba?1c?1ba?2aa?3qa?3a?21b?4qa?s999A899319‡:;q;qaa>d=cb>bb>e?ba?bqa?2aa?3aq?3?2;w4321414A13144q5r7r7r8ra8ra9ac9ad81f82bb;cd} 1q1A121111111q11q1q1r2q2q33336788181828388 2q21A111232121q1q1q1q1q1q1r12q2q333367778818188 !4q43A333454143q3q3q3q3q3q3r14q3r33445677777777 #5q54A444565154q4q4q4q4q4q4r14r44445567777777777 $7q76A666787176q6q6q6q6q6q6r6r666777888171771717777174& <sE##""!B"Aq"A"B"AA#A""""""""""q"!""""###"""!!!!!""$#""!B"Aq"A"B"AA#A""""""""""""""""####""!!"""$#""!B"Aq"A"B"AA#A"""""""""q"q"""""""""!"""!""!!!!$#""!B"Aq"A"B"AA#A"""""""!!q!q!!!!’""""###!"!"!!!!""#!"##""!B"Aq"A"B"AA#A"""!!!qq!q!!!!!!"""""!!"!""#"#"##""!B"Aq"A"B"AA#A""""!!!q!q!q!!!!’""""##"!!!!!""$#""!B"Aq"A"B"AA#A""""""""q"q"""‘""""####""!!"""$#""!B"Aq"A"B"AA#A"""""""""""""""###!"!""!"""!!!!$#""!B"Aq"A"B"AA#A""""""""""q"!"""""""""!""""!"!"##"##""!B"Aq"A"B"AA#A""""""""!"q"q"""""""""!!!!""#"#"4B'= # 5 G !Ab E2d12qc1q21cc1B1q1A1Aq11B1q222q1q2a1‚aqrrrrAArAAsAss1s2s22B2D2E2E2E2BB2BB2BB3AB3AB3C3B3B3B3C3A3qq3AqA3B3A221 E66q72d1q2qc121qcc1B111q1A11A1q111B1q222q1q2a1‚aqrrrrBAr1As1s1s1s2s22B2D2E2E2E2BB2AC2AB2AB2AB2D2B2B2B2C2A2qq2AqA2B2A2111 E66q66q77q77q2d12qc2q22ccq1B111q1A11A1q1a1Bb2a221‚qrrrrAArAsss1s2s22B2D2E2E2E2BB2AC2AB2AB2AB2D2B2B2B2C2A2qq2AqA2B2A2111 E66q66q66q66q66q66q66q64a1q2c1a2qba2aq1bAbA11A11A1A22a21r1rrrArArAArArArr1r11B1AC2E2E2CA2BB2BB3AB3AB3AB3D4B4B4B4C4A4qq4AqA4C4qq443316 E66q66q66q66q66q66q66q66q66a3a1b3aaq2c2aa1cA1qa1a2a1a1A4A45a4a3q3r2r2r2rA2rA2Ar2Ar2s3s3s33B4D4E4E4CA4BB4BB5AA5AA5AA5AA5AA5AA5C5C5A5qq5AqA5C5qq5554142 E66q66q66q66q66q66q66q66q66a3a1b3aaq2c2aa1cA1qa1a2a1a1A4A45a4a43q3r2r2r2rA2rA2Ar2Ar2s3s3s33B4D4E4E4CA4BB4BB5AA5AA5AA5AA5AA5AA5C5C5A5qq5AqA5C5qq5554142T+2q11q11q12q22q33q33q44q45q55q66q67q77q88q99q9:q:;q;>q??1q?1?2q?3?3q?4?5q?6?7q21q11q22q33q44q55q66q77q78q89q9:q:;q;>q??q?1?1q?2?2q?3?3q?4?4q?4?5q?5?6q?6?7q?7%qqqqqqqqqqqqqqqqqqq qq3qq4q1q1q6q3q5q8qq66J6J66J5L55L5L6A6A6AA6BA5ABA5BBA5BBA5ABBA 6A6A6A5AA5AA5AAA5AAA8A9A::2AA2A22332AA2A2233 B Z! .3d3aq3d1cB222223A4A3A322q2q2q1q1q1Bq1Bq1q1q1BC11C3C3C3C3B4C4AB4AB4AB4AB4B4B4C4A4A4B4B144 -3d3aq3d1cB222223A4A3A322q2q2q1q1q1Bq1Bq1q1q1BC11C3D3C3B3AC3AC3BB3B1B3B1B3B1B3B1B3B1B2B1B2B2B2B2B2B32322 ,3d3aq3d1cB222223A4A3A322q2q2q1q1q1Bq1Bq1q1q1BC11C3D3C3AB3AC3BB3B1B3B1B2B1B2B3B1C3B1B3B1B4BB4BB5B5A5 -3d3aq3d1cB222223A4A3A322q2q2q1q1q1Bq1Bq1q1q1BC11C3D3C3AB3AB3AB3AB3AB3AB2BB2BB2B1B1B1BA2B3B4B4A5 .3d3aq3d1cB222223A4A3A322q2q2q1q1q1Bq1Bq1q1q1BC11C3C3C3B4B4B4B4B4B3B3B2B2B2B2B3B4B44 .3d3aq3d1cB222223A4A3A322q2q2q1q1q1Bq1Bq1q1q1BC11C3C3C3D3D3D3D3AA4AA4AA4AA3BA3D3AB3A1A2B12B2232 -3d3aq3d1cB222223A4A3A322q2q2q1q1q1Bq1Bq1q1q1BC11C3D3D3BA3BA3BA3BB2C1B2B2B2B2B2B2B2B2B1C2B1B3B1B3BB4A54 ,3d3aq3d1cB222223A4A3A322q2q2q1q1q1Bq1Bq1q1q1BC11C3D3D3BA3BB3B1B2B1B2B2B2B2B2B3B2B3B1B3BB4BA4B6B6A7 -3d3aq3d1cB222223A4A3A322q2q2q1q1q1Bq1Bq1q1q1BC11C3C3D3D4C4C5B5B4B4B3BA2BA2A1B21B31B31B326X /"1A1111qq11qq222222211111111111qq1!1CEAAAqqAAAA121qquutsssss111111111111111111q11111$211A1ABB1BA1C1AA21aa1b1c1c1c1ba1babababacaaa11111111111111111111q1q1$1111Aƒ1AA1qqq111111111111111q11q1q1q1q1q1q1!2c21eabaAAa1A12321aa1bqabqbarbar1aar1abqb1aq1aq112221212121212121212121$111B1qAA1B1AA1A22111111111‘11111111222221 qqrBqqqqqAqAqqqA11221111112211 1AAA121AAEDCCCCCCB111111111111111111111113 o>,3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B2B1B1B1B1B1B12222333344444444q4q444q144 +3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B1B1B1B1B1A111111A3333333131313131212222q2q32322 *3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B2B1B1B1B1A11222233333313121231313144q5q55 +3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B2B2B2B2B2B2B2A222233333333222111q234q45,3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B2B2B2B2B2B2B2B2B222333444443322q2234q44 ,3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B2B2B2B2B2B2B2B2B2223333333444333q31q212q2232 +3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B1B1B1B1B1B1B1B1B1113333332122222222121313qq454 *3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B2B2B2B2B2B2B2B2B2223333312122222323134q46q67 +3c2bA2ba2cA2aa2aAb2ba3aa4Aa3A33q2A2Aq2B2B2B2B2B2B2B2B2A222333445544322q1213131q326 ],3222A2223A4A332222222222222233333444444444444144 +3222A2223A4A3322222111111111113333333131313131212222222322 *3222A2223A4A3322222222222222333333313121231313144555 +3222A2223A4A332222222222222233333333322211123445,3222A2223A4A33222222222222222333444443322223444,3222A2223A4A33222221111111111A3333444444333312122232 +3222A2223A4A332222211112222223333332122222222121313454 *3222A2223A4A3322222222222222233333131222223231344667 +3222A2223A4A3322222222222222233344554432212131313264W: h  qqqq1q1q1q1q2q2q2q2"32a3Ba32A23A32A214443A11qA111q2‘2223333331313q13q1q3q1q3q1q2"32a3Ba32A23A3A32A21443A11qA111q2‘2223333331313q13q1q3q1q3q1q2 G|-aaqqr1q31q12q61aaqqr1q13q22qaaqqr1q411r2qaa33q4q3r21qr2q11a22a11q2q1r1r2qaaqqr1q3q22q3 ;}"6556"666665445666656"656A65A566556413314155555544444q4q21q3q4"545B54A4554A41666531q221314444544431323233q3q3q22"43a4B43A34A43A315554A21q111213333443333133q3q3q3q22"32a3Ba32A23A32A214443A11qA111q2‘2223333331313q13q1q3q1q3q1q2 e"21a1aB11A11A12A211111A1Aq111’11q‘11‘11122222212121q2q1q2q1q2q1q2"32a2aB22A22A23A312222A2Aq22’2q‘2‘22233333313q12q1q2q1q2q1q21q3"43a3aB33A33A34A43333A3Aq33’3q‘3‘3334444141414141q4q1q4q14q4"54a4aA4444A45A54444A4Aq44‘4q4444555554444q4q4q4"65a5a5555A5665555A5A555q555566666555q4q4q45"66a6666666666A666q666666q6q6q6?"6556"666665445666656"656A65A566556413314155555544444q4q21q3q4"545B54A4554A41666531q221314444544431323233q3q3q22"655b555556A6654q44q4q444444555555555555"54a4aA4444A45A54444A4Aq44‘4q4444555554444q4q4q4"65a5a5555A5665555A5A555q555566666555q4q4q45"66a6666666666A666q666666q6q6q6  $$$$4  M ..< 2s2t1s1rq1qq1s2s3q2q1s1s1s1s1s1r1r1r11r222222121212q22q21q22r 2s2t1s1rq1qq1s2s3q2q1s1s1s1s1s1r1r1r1r1q12222212121111212r12q1r2s2t1s1rq1qq1s2s3q2q1s1s1s1s1s1r1r1r11r22222212111131334r3r2s2t1s1rq1qq1s2s3q2q1s1s1s1s1qq1qq1qq1qq1qq1q22222212111q2q2q3q3r 2s2t1s1rq1qq1s2s3q2q1s1s1s1s1qq1qq1qq1q1r1q2223333221q2q33r 2s2t1s1rq1qq1s2s3q2q1s1s1s1s1qq1qq1q1r1r1q2222212121222q21q22r 2s2t1s1rq1qq1s2s3q2q1s1s1s1s1qq1q1r1s1r1222221212121111212r12q1r2s2t1s1rq1qq1s2s3q2q1s1s1s1qq1qq1q1r1s11r1q22221212112131334r3r2s2t1s1rq1qq1s2s3q2q1s1s1s1s1qq1qq1q1r1r1qq2222221211112q2q3q3r 2s2t1s1rq1qq1s2s3q2q1s1s1s1s1s1qq1qq1qq1qq1q2222333211q12q33r 4X"2s2s1u1qq1rr1qqq2qq2s3q2qq1u1u1u1u1u1s1s1s1s1q12212121212121212121q2q1q2q"2s2s1u1qq1rr1qqq2qq2s3q2qq1u1u1u1u1t1s1s1r1r1qq222121212121212121q21q22q2q"2s2s1u1qq1rr1qqq2qq2s3q2qq1u1u1u1u1u1s1s1s1s1q122121212121212121q22q2q"2s2s1u1qq1rr1qqq2qq2s3q2qq1u1u1u1u1u1s1s1s1s2q2221212121212121212q12q1q4q"2s2s1u1qq1rr1qqq2qq2s3q2qq1u1u1u1u1t1s1s1r2r2qq22212121212121212q12q144q4q"2s2s1u1qq1rr1qqq2qq2s3q2qq1u1u1u1u1u1s1s1s1s2q22212121212121212q144q4q  2s1u1u1u1u2s2s32s1u1u1u1u1t1s1s1s1s2s2q2q21q2121q21212121q21q22q 2s1u1u1u1u2s2s32s1u1u1u1u1u1t1s1s2s2s2q221q21q212121212121q222q 2s1u1u1u1u2s2s32s1u1u1u1u1u1s1s1s1s2s2q221q21212q12121212q12q1q2q 2s1u1u1u1u2s2s32s1u1u1u1u1u1s1s1s1s1s2q2q21212q12121212q12q144q 2s1u1u1u1u2s2s32s1u1u1u1u1t1t1s1s1s1s2q22q12q121212121212q1444q 2s1u1u1u1u2s2s32s1u1u1u1u1u1s1s1s1s1s1q22q12121q2121212121q2q1q4q4>>O>A" AE44 ?< ?< ?< ?9?9?94Q#*@??? ?? 4bbb-b.z){zzqU z% z Pqz }z 9c!)+\++[//%GM6#:!)+%5#F !)O# e(e)%D+#F cߗ*+, :  %uG+tCCee]R] RR R`R` R=R]]] ]   ``` ` ==% d|he%3+ eeR ^vjeee"""'e'"") B`Ne[eZee Ze"") B`Ne[eZe Zee"1 B`Ne%[eZec.;I [e e'"& B`Ne[e c.;K [e e]"' B`Ne[e \ee e]"]"]"'"""'`"`"`"']/]/]/'///'`/`/`/'="% B`Ne[e%_+ee^ ^vjee`ea^**^* ^vjebecZ^ d|hee*^^**= d|h1 c-e ] c-e cee  ]e^^ d|heee++/eLe nKe e! e"e#)e$e%e&ZZ Z)ZZZZe-R d|he.e/e'R d|he/e0e.e1/ee ]Z0000  ]=ZeggL "8k %Q>XIIfSZ 8 h  + ] The window's already open.The window's already unlatched.Ya unlatch the window.Yer not close enough.Ya cain't latch the window when the window's open.Ya latch the window.The window's already latched.Ya open the window.Ya cain't do that, the window's latched.Ya close the window.The window's already closed.Why? The window's open.Ya have no good reason to break the window.It's a tight fit, but ya manage to crawl thru the window.Ya cain't do that! The window's closed.The window's already broken.This cannon looks just like the one on the tombstone at Sutter's Fort!The cannon wheel is difficult to turn.But as you continue to turn the wheel, you realize that an ingeniously designed mechanism is raising the back wall in the fireplace!!Ya turn the wheel on the cannon and raise the back wall of the fireplace!Ya turn the wheel on the cannon and lower the back wall of the fireplace!The cannon is very securely attached to the mantle.The back wall of the fireplace is about three feet above its normal position.It's a brick fireplace with a decorative cannon on the mantle.If ya did that right now, you'd only get dirty!Ya might get covered with soot, but ya climb into the fireplace!But ya never know when the man might return!This is a clean and tidy hotel room. It has everything a normal hotel room has and a fireplace.From here it looks like just a decorative cannon.The room has nice wallpaper.It's just a hardwood floor.Sittin' on the commode is a pitcher and bowl.There's a commode sittin' next to the bed.There's a pitcher and bowl sittin' on the commode.Next to the bed is a small rug to keep bare feet off the cold floor!There are a couple of chairs in the hotel room.It is a neatly made bed.There's an ordinary table in the corner of the hotel room.There's a ledge outside of the window.Oh no!!Ya hear someone comin' in the door!! It must be the man that is rentin' this room!!Drat!! You've picked a lousy time to visit this room! The renter is here and man, is he steamin'!! Things are NOT lookin' good!"HOODLUM, BURGLAR, THIEF!""Get the law up here and take him away!"Ya have no need fer that.The back wall of the fireplace is already open.A dandy idea, but how?The back wall of the fireplace is already closed.It won't do any good, the beggar has a key!However, the wheel on this cannon looks bigger than the one on the tombstone.From here it looks like just a decorative cannon.It seems that this cannon wheel is too big to be merely a part of a decorative cannon.From here it looks like a wheel on a decorative cannon.A narrow ledge is on the outside wall of the hotel.You'll never strike it rich if you do that!4"Vbb"b-b.z'U zRrz:fz Nz `d !)+/6 XC%4#: 5!)+/6 XC%[s#:!)+/6 XC%dq#: 7!)+/6 XC%St#:!)U++I//%LM6#:!)+C_ _+/6%:E#F!)O#6%Z3#QN? ZJ,RQT$ [QZ3IQNL 6[Q;F +/F߯-I'+QNLG 6QZ3 $  6%Z3#QN? 6QZ3 $" c"e( :i te&R *u6eeee]R] RR R`R` R=R]C]C] C] CCC C C`C`C` C` C=C=C= ,}01&e%e+I _ eeR ,}0e\eEe'R ,}0eEe]eeW)eB 9ts6 7 5"e 7e 5e e!e"e#e# 7 F|fe$e% 7e)ZZ' 7e* F|fce+\7;$e 5 K~ae,e-Z' 5e2 F|lce3\5;$e e.Z' e4 -7ce5\;$ea a  M~oe0e1Za ZaZ )e6 J|nce7\ ;$e"""'e"") G`TeIe0ee 0e"") G`TeIe0e 0ee"1 G`Te%Ie0ec.;I Ie e'": G`Te.I#e9e c.;K Ie e]"' G`TeIe Uee e]"]"]"'"""'`"`"`"']/]/]/'///'`/`/`/'="% G`TeIe%t_+ee^ *u6ee`ea^**^* *u6ebecZ^e*^^**= ,}01 c-e ] c-e cee  ]e^^ ,}0ee\\" /aOse:e8e8\ e;e<e= /aOse@e>e?[[p eAeB3 6h@h'eCeGeHeIeDZ[N eAeB 6h@heOeDZN e^eB 6h@heOew :p eNeB3 6h@h'ePeQeReSeDZp eNeB3 6h@h'eN ceL\:eDZ eEeJ[  [ZZ[ ZZ [||[| [|Z [|Z|Z[d \ eMeB 6hDpceF^eDeJ++/eUL0 e/eVZ)ZZZ\Z\eX eYeZe[.e_'ed/ee.ef ]Z0000  ]=Zeg :ehh $:m'S@YJ(T`o 9j + K g  H ~  B j A e <]&R/Sm*\v> TsThe window's already open.The window's already unlatched.Ya unlatch the window.Yer not close enough.Ya cain't latch the window when the window's open.Ya latch the window.The window's already latched.Ya open the window.Ya cain't do that, the window's latched.Ya close the window.The window's already closed.Why? The window's open!Ya have no good reason to break the window.It's a tight fit, but ya manage to crawl thru the window.Ya cain't do that! The window's closed!The window's already broken.This cannon looks just like the one on the tombstone at Sutter's Fort!The cannon wheel is difficult to turn.But as you continue to turn the wheel, you realize that an ingeniously designed mechanism is raising the back wall in the fireplace!Ya turn the wheel on the cannon and raise the back wall of the fireplace!Ya turn the wheel on the cannon and lower the back wall of the fireplace!The cannon is very securely attached to the mantle.The back wall of the fireplace is about three feet above its normal position.It's a brick fireplace with a decorative cannon on the mantle.If ya did that right now, you'd only get dirty!Ya might get covered with soot, but ya climb into the fireplace!There's a ledge outside of the window.There's a chair in the corner of the room.There's something on the table in the middle of the room. It looks like...a handwritten and slightly yellowed note...a magnet...a gold coin......and that's about it!There's a table in the middle of the room.There's a note on the table!What note?You are now in the elusive room 12! You see that a wall has been built where the door used to be, creating a small closet. There is also a table, a fireplace and bird cage.On the floor, close to the lower left corner, there's some string.Ya hear the door in room eleven slam shut.To read the note, ya got to have the note!Ya already got the note!Ya grab the note eager to see what it might say!There's a magnet, shaped a horseshoe, on the table.What magnet?There's some string wadded up on the floor in the corner.It's just a hardwood floor.There's a gold coin sitting on the table.From here you see no gold coin.Ya already have the magnet.Ya get the horseshoe-shaped magnet off the table.Ya already have some string.Ya snatch the string off the dusty floor.Ya see no gold coin.Ya get the gold coin off the table.There's a bird cage in the corner of the room.Not right now, the bird is flyin' through the window!There's a bird cage in the corner of the room and there's a bird in the cage!There's no bird in sight.The bird's flutterin' outside the window.The bird's flyin' through the window to the cage!The bird's quietly sittin' in the cage.The bird's leavin' through the window.The bird has a small capsule attached to its leg.What %w2?That ain't too easy when the bird's flyin' around!In very small script ya see this engraved on the capsule: "For a clue to my exact location, insert proof of identification here!"Ya need to be very close to the capsule to do that!Dandy idea, but how?Ya carefully roll up the family photo and put it in the capsule!Yer family photo is carefully placed in the capsule!There's an aerogram in the capsule!It's a blank, empty capsule.Ya don't have a family photo!There's no aerogram in the capsule!Without gettin' yer hand pecked up too badly, ya get the aerogram out of the capsule!The capsule's nowhere to be seen!There's no aerogram 'round here.Ya stick yer hand in the cage and the bird pecks the livin' daylights out of it! It just ain't worth it!There's no aerogram here, just an empty capsule.This isn't an aerogram, it's yer family photo!There it is! An aerogram is in the capsule!There's no aerogram in sight. This is just an empty capsule.A wall has been built in this room where the door used to be, making this room inaccessible to a normal man.Ya notice some string lyin' on the hardwood floor.It's just a normal, but dusty, bed.Ya have no need fer that.The message is written on a folded piece of paper with only one word visible on the outside... CONFIDENTIAL!! Ya don't have a message.The back wall of the fireplace is already open.The back wall of the fireplace is already closed.There's no bird in sight.There's no door to this room. A wall has been built where the door once was.However, the wheel on this cannon looks bigger than the one on the tombstone.From here it looks like a decorative cannon.It seems that this cannon wheel is too big to be merely a part of a decorative cannon.From here it looks like a wheel on a decorative cannon.Walls have been built in room 12 to make it appear like a closet from the hallway!A narrow ledge is on the outside wall of the hotel.There is no door to this room.You'll never strike it rich if you do that!Ya don't have an aerogram.4Zvo': o K  o 9^9 $ w' gZP   d  ggC (8o ' 9  o s  hhffff, (!o  o   gg% 9     ghgfgfg o Z;Z;Z; 7a77k   +io  o  o  Lo  a ] g 9   e '   d m #8Si/Fa 6Rm-g~Ya don't have a lantern.Yer out of matches.Yer lantern's out of oil.There's no more oil.The lantern's already lit.Ya light the lantern.Yer lantern just ran out of oil!Yer match just burned out!Ya light one of yer matches.Ya don't have any more matches.Ya already have a match lit.Ya blow out the lantern.The lantern isn't lit.Ya blow out the match.Ya don't have a match lit.This ground is too hard to use a shovel.Ya don't have a shovel.There are rocks all over in the mine.It's too dern dark in here!These timbers look strong and sturdy.Ya look at the ground for any sign of gold.Ya scan the walls for gold.Ya notice nothin' unusual.Look, and you will find! F7 Restore F9 Restart Watch yer step on these ladders!If ya see a ladder, climb it.He must be in here somewhere.Ya have %v170 matches left.Ya have 1 match left.Even in the depths of this darkness, death has found you!Ya can't do that here.%g50"%w1."%g50"%w2."%g50"%w3."%g50"%w4."%g50"%w5."%g50"%w6."%g50"%w7."%g50"%w8."%g50"%w9."4+o: oeK e 9^9gg4 (,oe 9ee o seehhffff# (oe oe egg 9e e e ghgfgfge oeZ;Z;Z;e7a77k eeooeaeU6Oc}<Yr<Ya don't have a lantern.Yer out of matches.Yer lantern's out of oil.There's no more oil.The lantern's already lit.Ya light the lantern.Yer lantern just ran out of oil!Yer match just burned out!Ya light one of yer matches.Ya don't have any more matches.Ya already have a match lit.Ya blow out the lantern.The lantern isn't lit.Ya blow out the match.Ya don't have a match lit.Ya can't do that in an outhouse!Ya can't use that in an outhouse!Ya don't have a shovel.There are rocks all over in the mine.Look, and you will find!4j _= gb!b"zKz"R?P!)+ //6 XC%K#:!)+ //6XC%"S#:g !)&#F!) % %# 0 4$23&23# 0 4=  JNX 6 JNX 8 R!T 6 R!T 8 HxQ c! ;I: HxQ ;K ;c" P*T c! ;I: P*T ;K ;c"M+ethBthBeee'eue"e  " S~Yee ee Ke e e .e ``]]]/`///, S~Y vU~Ye%_+ee[e 0 4eeuuuu@ 0 44 >%e gMF 0 h^0 4 i^4eeZZZ{7 0 4e(E{{eeh h\0i i\4 g ge 7a77k e(e)ooaoe*te/ee+e 0 4= KxN}%N !Q.R %yK+!oop*Vo<]Y#S =/F`,XOver the railing you go!It wouldn't be safe to do that right here.Ya cain't do that from here.This is the GREEN PASTURES Hotel. It's about the only place of interest in this little town.Back Street runs in front of the hotel.A railing surrounds the balcony.The boardwalk passes in front of the hotel.The hitching post is fer visitors to tie their mules to.As ya look at the windows on the side of the hotel, ya notice there are four rooms upstairs.This fence keeps folks from strayin' onto the hotel lawn.The railing would keep an ordinary frontiersman on the balcony.There are four, count 'em, four sturdy pillars in front of the hotel!You see two doors; the main hotel door and the door to the balcony.That's hardly a lawn, it's just cut wild grass!It is a two-story hotel with a balcony and many windows. There is also a hitching post in front.Ya can't see the hotel rooms from outside.Ya see a ledge under the upstairs windows.You could see the lobby better if you were inside.Through the windows ya see room 13. Nothin' unusual catches yer eye.If ya just leave that mule, yer gonna lose it!Ya ain't even got a mule!Ya securely tie up the mule to the hitchin' post.The mule ain't close enough to the hitching post!Ya already got a mule!The mule is too far away!Ya untie the mule and firmly grab the rope that's around its neck. It begins to follow you.Yer mule is tied to the hitching post in front of the hotel.Through the front windows ya see the hotel lobby.Ya can't do that unless yer on the balcony.On the side wall of the hotel ya notice a ledge under the upstairs windows.Don't dig up the town! Do that somewhere else!!No shovel, no diggin'!Ya need to be in the water!4lYz"C z2Q z&Q z*J z&< ? !)+/XC%.C6 #F!)Y+%7k#F!)O# 0 4e"^0^4 ( ( +$Q7kܩ +< \ ^Ne (%M e# ^^ y %d+ *,> %:I+\rx&  " u_8&ee] u_e u_eCCCCCC8 u_,8^rx(edddddd000000dcdcdcdcdcdc111111dbdbdbdbdbdb222222 u_ e1Q/kMJe )eZ u_ eaZa] u_ e"Z"Z"Z8 u_,8 ^rx(e eeeLeea$ u_ e::C:C u_!e&etthBthBe+eee#e$^^e% rx&( RF)U`^s},_tP9lThe man says, "Howdy! You look like ya know what yer lookin' fer. What can I do fer ya?"Ya need to get closer so the man can hear ya.There's a man working behind the counter."I haven't been here long, but there's no room 12 that I know of.""Sorry fella, I just rented that room. The man didn't know how long he'd be staying.""Oh my willikers! I nearly forgot!! I got a message to give that beggar stayin' in room 11. Would ya deliver it fer me?"%g69Yes or no %g69"Here's the message. Thanks, I owe ya one!"Yes what?!"Keys are only fer folks rentin' a room.""Right now all the rooms are rented!""If ya ain't a registered renter, ya couldn't have a message!"Before you leave the hotel, you give the man at the counter the message you said you would deliver to room 11."I'll do it myself!""Later!!"No what?!"Great! Hang on a second!"You reply, "No problem."This is a downright fancy counter, and a fancy hotel fer that matter, considerin' it's in the middle of nowhere!Yer in the lobby of the prestigious, but hardly known, Green Pastures Hotel! There is a man working behind the counter.Ya see message boxes on the wall behind the counter.The stairs lead to the rooms upstairs.The message is written on a folded piece of paper with only one word visible on the outside... CONFIDENTIAL!! It's a hardwood floor covered with fine carpet.There are messages in the boxes.Ya can see message boxes behind the counter.Ya need to be more specific!"Sorry stranger, all the rooms are either occupied or reserved."The man looks puzzled and says, "I don't know what yer talkin' about."Ya gone off and left yer mule outside without tyin' it up! Now yer mule is gone!There's no bell 'round here!To that, the man says, "That's real nice stranger!"To that, the man says, "I don't want it stranger!""It's written all over yer face stranger, you look lost! I don't think you have a reason to be here right now!""Right now, you don't look like you know what yer doing, stranger."4 Wbb!b"zt?!)+/6XC%s?#:!)6X%=#:!O)#Zn2xB7. (A6G   c!; I ;Qt= +<F nA|Gr x&Q=Gr x& : K :c"  QE[  $  4' F    G AX%K r@vA%C r x&..e..]=].=.'.' ' ' .: (A6G nA|G& (A6Ge nA|G eee.Q (A6G nA|G= (A6G  nA|G8e e$e^^^'j be e   ee ec ^ QtEG8e e eoe"eLe++/e eee. B %64+3oe.] <-Z .baupj0AaYa can see the stairs through the open doorway.This is the door to room 13.This door leads to the balcony.This is a closet door. It won't open all the way 'cause of the supplies inside. Ya can barely see a few small holes.This looks like a door to a closet.From the hallway it looks like another hotel room. But it's just a closet.The door to the closet is closed.The number on this door is "13".Ya cain't see any numbers from here.This door won't open any further. It's a small closet filled with supplies.This door's locked.Ya cain't do that from here!It's a hardwood floor covered with carpeting.You see the balcony through the open door.The walls have nice wallpaper on 'em.The message is written on a folded piece of paper with only one word visible on the outside... CONFIDENTIAL!! Ya don't have a message.Why do that? The door's open!Knock, knock, knock...No one's comin' to the door.The stairs lead to the lobby.There are some small nail holes in the door. There may have been a number here at one time.This hallway has many doors. There is a door to the balcony, a door to room 13, and a door with no number.The door to the balcony is closed. LOBBY There's no need to. It's just a small closet.Go ahead 'n try!Ya got nothin' to do that with!These are just hotel supplies.You don't need any of these supplies.You see a small closet filled with supplies.4 !O)#   %oe. xPeeLe"e++/e..e..]=].=.'.' ' ' . &x8 lx~ee. &x8 lx~ e( &x8 lx~ &x8e e e e ee.e**V5If;PiThis is the end of the lower hallway. Ya see two doors.This is the door to room 21.This is the door to room 22.It's a hardwood floor covered with carpet.Ya see nothin' of interest.The walls have nice wallpaper on 'em.This door's locked!Ya cain't do that from here!The number on this door is "21".No one's comin' to the door.The number on this door is "22".Knock, knock, knock...The message is written on a folded piece of paper with only one word visible on the outside... CONFIDENTIAL!! Ya don't have a message.Ya have nothin' to do that with!4!O)#   `~k %+ %doe. xBee++/e"eLe..e..]=].=.'.' ' ' . x*ee. x* ee e  e ee.e**Ve9This is the lower hallway. Through the open doorway ya see the lobby.This is the door to room 23.This is the entrance to the lobby of the Green Pastures Hotel.The walls have nice wallpaper on 'em.Ya can see across the dirty, dusty street into the immense wilderness.It is a hardwood floor covered with carpet.This door's locked.Ya cain't do that from here!Knock, knock, knock...No one's comin' to the door.This is room number "23".Ya see a portion of the lobby from here.The message is written on a folded piece of paper with only one word visible on the outside... CONFIDENTIAL!! Ya don't have a message.Ya have nothin' to do that with!4bb"zH[z3bz;UzOczbzFz$zmz *!)+/CX6%=%=} %=#F:!)+ //CX6%Ex#F 9!)+/ 6CX%j#F!)O# 4n^~ I :c"  QJ QJj ;Q=| QJ|  ;Q= QJ|  :  %=pO ;nWx %A=J#e52JR23eZgZsgZgs) 9e Tve$\9ceZe*Z6e+eReJee e& e.e,65.5e))e 2 9ee e Ze-"e+eL0 ee e]eg 9eeR 2]@dee..L ee.G..e'..L..L..L..L..L..L..L.'e 1Z'= 5?oPr 32  5P &Cfo4a{!Yk21[#8>d6R~ A ^ j v Ya scan the walls for gold.Ya can't do that while yer climbin'!Yer close to a likely spot. Try that nearby.Ya don't have a pick.That's impossible right now!It's too dern dark in here to see!Nothin'!This door locks by itself when it closes.This door has a double lock on it.You unlock both of these gargantuan locks with the steel key from the far side of the door!Ya can't do that from here.Ya don't have a key that'll fit these locks.Ya don't have any string.Ya don't have a magnet.Ya need to be a little more specific!Ya already tied the string to the magnet!Yer genius is showin' again. Ya tie the string to the magnet!Ya already put the magnet through the hole in the door!Yer full of good ideas! Ya put the magnet, with string attached, through the hole in the door!Ya put the magnet through the hole in the door and it falls into the dark depths beyond the door!Ever so slowly and carefully, ya lower the magnet down the far side of the door.Time passes slowly. It seems like an eternity and then...Ya hear the magnet pick up some metal object on the far side of the door.Even more carefully than ya lowered the magnet, ya raise it again.Beads of sweat break out on yer forehead and the palms of yer hands are sweatin'!!Ya hope not to lose whatever it is that's attached itself to the magnet!Congratulations! Ya pull the magnet, along with a steel key, through the special hole in the door!There's no reason fer doin' that anymore!Walkin' away with that magnet through the hole in the door broke yer string. The magnet is gone!There's no GOLD in sight right here.You already did that.A great idea, but ya can't do it right now!Ya don't have a key.Ouch!There's a huge door in the mine wall.The ropes are attached to weights.If ya did that, the door wouldn't work.The door is so heavy that these weights are used to help open and close the door.The hole in the door resembles James' branding iron.This door has two keyholes.Ya see nothin' but darkness under the door.Ya see a small glimmer of somethin' metal. It's not gold, but metal.Ya already have the steel key.That's a great idea, but how?Ya pull the string and magnet back through the hole in the door.You already have the magnet.Lower what?Raise what?There's no ladder in sight.4|b2!)/6CX=%=!)/6CX%='!)/6CX%=;!)/6CX%=O!)/6CX%G!)/6CX%>[!)/6CX%>o!)/6CX%>!)/6CX%>!)/6CX%>! )+-#(   ܂}} ow d$ 3x$ G$ [$ o$ $ $  OO ) R2c ;d<8<+%Zr . Y ^.o o    d<%;=a+i)o _   ..o  ..aa/ ZaZaZ/ ppap:pK .@   )M 9G  oQ  Y%;X{amYa scan the walls for gold.Ya can't do that while yer climbin'!You're close to a likely spot. Try that nearby.Ya don't have a pick.That's impossible right now!It's too dern dark in here to see!Nothin'!Ya blow out the lantern as ya leave the mine.Ya blow out the match as ya leave the mine.Ya see a door above you.This must be the door to James' cabin!The light is very dim, but ya see the door to the cabin above you.Get closer.There's no GOLD in sight right here.It's just a wooden ladder!The pick won't fit through the small trap door. It falls down the shaft.4 b!)+/6CX=%8!)+/6CX%8(!)+/6CX%8;? ().O! OO 9N) 2;d<<%8aa/ZaZaZ/ppap:p+ .   )/M 9G )o 0UqQ P  Q,OX}Ya can't do that while yer climbin'!You're close to a likely spot. Try that nearby.Ya don't have a pick.That's impossible right now!It's too dern dark in here to see!Nothin'!There's no gold in sight right here.There's no ladder in sight right here.It's just a wooden ladder!4 b!)+/6CX%=!)+/6CX%=!)+/6CX%=s!)+/6CX%>Y!)+/6CX%>?!)+/6CX%?%!)+/6CX%v!)+/6CX%v! ) + / 6 C X % v! ) + / 6 C X % (v! ) + / 6 C X % 3v! ) + / 6 C X % ^! ) + / 6 C X % i!)+/6CX%v!)+/6CX%!)+/6CX%!)+/6CX%!)+/6%O,#:!)+/6%i#:! )+-)#('  ܂}}'o! $V$ 8yV$ (_V$ (EV$ (+Vp$ 8VS$ a|$ a|$ a"|$ a-|$ a8|$ Fdc$ Qdn$ ^d{$ id$ td$ }d$ 8`8i()+- ??()+- 7`7i ).O >> ().O! OOX ) R2c >FX ) R2c%dF 3D2: RW #cc: ci #cc: 9N)A2 PW  ci   ## <% Z ## <%H= 2 ## <%sN+i)o 8ZF|   ?)o 8ZF|    aaroc 7:Ac Ml7 7:Ac/   / / /  ZaZaZ >:>T Sfd >:>T,  $snss n+ $snssn/ /  ppap:pN .C   )/M 9G  )o *LQ P  Q4Qt}G~The mine walls are rough and ragged.Ya can't do that while yer climbin'!You're close to a likely spot. Try that nearby.Ya don't have a pick.That's impossible right now!It's too dern dark in here to see!Nothin'!Just look at that gold glitter!Ya struck gold!Ya can't reach any gold from here.Ya notice a mine shaft to yer left.The shaft to yer left is difficult to see.Ya reach out and grab the gold nuggets!Right here, ya notice nothin' unusual about the shaft.There's no gold in sight right here.There's no ladder in sight right here.It's just a wooden ladder!4*!)+/6CX%B!)+/6CX%B!)+/6CX%B!)+/6CX%Bn!)+/6CX%B[!)+/6CX%BH!)+/6CX%B5!)+/6CX%B"! ) + / 6 C X = % B! )+-#('  ܂}}'o Yt Ya scan the walls for gold.Ya can't do that while yer climbin'!You're close to a likely spot. Try that nearby.Ya don't have a pick.That's impossible right now!It's too dern dark in here to see!Nothin'!Ya look at the ground for any sign of gold.I'll be!! It looks like a pick lyin' next to the rock!Just look at that gold glitter!You've struck gold!Ya cain't do that from here!The pick is not here.Ya eagerly grab the pick!!That's a mighty fine pick!Ya reach out and grab the gold nuggets!Ya can't reach any gold from here.There's no gold in sight right here.There's no ladder in sight right here.It's just a wooden ladder.4ub!)+/6CX%t!)+/6CX% t!)+/6CX%t!)+/6CX%!t!)+/6CX%,t!)+/6CX%7t!)+/6CX%Bt!)+/6CX%Mt! ) + / 6 C X % Xu! ) + / 6 C X % cu! ) + / 6 C X % nu! ) + / 6 C X % yu! ) + / 6 C X % u!)+/6CX%u!)+/6CX%u!)+/6%O/#:!)+/6%_#:!)# ܂}}'o A$ A$ A$ A&$ A1$ A<$ *AG$ 5AR$ @A]$ KAh$ VAs$ aA~$ lA$ wA$ }A$ 3D2: o q #cc: oq #cc: 9N)A2 o q oq  ##<%z 2 ##<%maaroc 3TQ[ o 7 3TQ[////ZaZaZ 9TK[ od 9TK[,/$snss n+$snssn//ppap:pN .C )/M 9GoPP *MVvYa can't do that while yer climbin'!You're close to a likely spot. Try that nearby.Ya don't have a pick.That's impossible right now!It's too dern dark in here to see!Nothin'!Just look at that gold glitter!Ya struck gold!Ya can't reach any gold from here.Ya reach out and grab the gold nuggets!There's no gold in sight right here.There's no ladder in sight right here.4nb!)+/6CX%!!)+/6CX%!!)+/6CX%!!)+/6CX%{!)+/6CX% {!)+/6CX%t!)+/6CX%!t!)+/6CX%,t! ) + / 6 C X % 7t! ) + / 6 C X % Bt! ) + / 6 C X % Mt! ) + / 6 C X % at! ) + / 6 C X % lt!)+/6CX%wt!)+/6CX%t!)+/6CX%t!)+/6CX%t!)+/6%lY#:! )+-)#('  ܂}}'o! t#$ #$ #$ b$ b$ b$ b&$ b1$ b<$ *bG$ 5bR$ Ibf$ Tbq$ _b|$ jb$ ub$ }b$ u)vXY t vC22222 ()+-   ().O! OOX ) R2c !t*vX ) R2c 3D2: SdZh #cc: edlh #cc: 9N)A2 SdZh edlh  # <%s 2 # <%~ P # <%=Faa8o) Qdnr//ZaZaZ=1 Wdhr$snssn/ppap:pN .C )/M 9G)o m/QPQ>,OXx#Ya can't do that while yer climbin'!You're close to a likely spot. Try that nearby.Ya don't have a pick.That's impossible right now!It's too dern dark in here to see!Nothin'!Just look at that gold glitter!You've struck gold!Ya can't reach any gold from here.Ya reach out and grab the GOLD nuggets!There's no gold in sight right here.There's no ladder in sight right here.It's just a wooden ladder.4@kb!)+/6CX%!)+/6CX%!)+/6CX%!)+/6CX%t!)+/6CX%i!)+/6CX%^!)+/6CX%S!)+/6CX%H! ) + / 6 C X % =! ) + / 6 C X % .! ) + / 6 C X % #! ) + / 6 C X % ! ) + / 6 C X % !)+/6CX%!)+/6%cg#:!)#36 8('  ܂}}'o }n$ rn$ gn$ \ny$ Qnn$ Fnc$ ;nX$ 0nM$ %nB$ n3$ n($ n$ n$ n $  9N)  ##<%z*aaEo6 Gte///ZaZaZI Mt_,/$snss n/ppap:p+ . )/M 9GoPP! *MVvYa can't do that while yer climbin'!You're close to a likely spot. Try that nearby.Ya don't have a pick.That's impossible right now!It's too dern dark in here to see!Nothin'!Just look at that gold glitter!You've struck gold!Ya can't reach any gold from here.Ya reach out and grab the GOLD nuggets!There's no gold in sight right here.There's no ladder in sight right here.4^=b!)+/6CX=%!!)+/6CX%!'!)+/6CX%!;!)+/6CX%!O!)+/6CX%"c!)+/6CX%"w!)+/6CX%"!)+/6CX%"! ) + / 6 C X % "! ) + / 6 C % $j# : ! ) + / 6 % IX# : !  )+-)+-#('  ܂}}'o HD$ HX$ 'Hl$ ;H$ OH$ cH$ wH$ H$ H$ j"jW22222 2!2"()+- >pCsM2>2?2@2A2B2C()+- h"i ().O 14  ().O! OOX ) R2c &n=vX ) R2c 3D2: 1k6m # cc:  BkFm # cc:  9N)A2 1k6m  BkFm  ;d<###<% x###<%3=aayoj .kH e&> a%v/  2kH / / /  ZaZaZ 3kBx k d k ,/  $ snss n+ $ snssn /  ppap:pN .C   )/M 9G  )o dQ P  Q0,OXsYa can't do that while yer climbin'!You're close to a likely spot. Try that nearby.Ya don't have a pick.That's impossible right now!It's too dern dark in here to see!Nothin'!Look at that gold glitter!You've struck gold!Ya can't reach any gold from here.Ya reach out and get the gold!There's no gold in sight right here.There's no ladder in sight right here.It's just a wooden ladder.4  b!)+/6CX=% !)+/6CX% '!)+/6CX% ;!)+/6CX% O!)+/6CX% c!)+/6CX% w!)+/6CX% !)+/6CX% ! ) + / 6 C X % ! ) + / 6 C X % ! ) + / 6 C X % ! ) + / 6 C X % U! ) + / 6 C X % `!)+/6CX%k!)+/6CX%v!)+/6CX%!)+/C6%QZ#:!)+/X6%wa#:!)+/C6%0s#:!)+/6%}#:! )+-)#('  ܂}}'o /3D$ /3X$ %'3l$ %;P$ %OP$ cP$ wP$ P$ $ $ $ =sZ~$ Hbe~$ Sbp~$ ^b{~$ ib~$ ~ ~ :n>rC2:2;2<2=2>()+- 2k3l  ().O OO 8u8x ( 8y;{ ( ;|=~ ( /r9Z1s8[32: ^neq #cc:  #cc:: pfvj #cc:  #cc: 9N)z2 ^neq W pfvj >2     ;d<### #<%3 =### #<r& rs]\\;[%aao 5fS [fz n3 y 5fS/  [fz / n3/   / / /  ZaZaZ ;nM aftx n.  ;nM)/  $snss n aftx+ $snssn/ n.)  $snss n + $snssn /  ppap:p9 ..  )/M 9G  )o NQ P  ()o ;   Z('')o ;    ]'JS B^4sYa can't do that while yer climbin'!You're close to a likely spot. Try that nearby.Ya don't have a pick.It's too dern dark in here to see!Nothin'!Through the still darkness ya hear the faint sound of someone picking...Just look at that gold glitter!Looks like you've rattled some GOLD loose!Ya can't reach any gold right here.A small underground stream runs across the mine floor.Ya see no water right here.Ya reach out and grab the gold nuggets!Ya don't need any water.There's no gold in sight right here.There's no ladder in sight right here.It's just a wooden ladder.Try it without lightin' the lantern sometime!You've just accomplished an incredible feat! Congratulations!!Not bad! Ya haven't used the lantern, but ya lit a match!4u dbbztg z1_ zMv !)+/6CX%!)+/6CX%!)+/6CX%!)+/CX6 %Cr#:!)+/CX6 %9_#:!)+/CX6 %?k#:!)+/CX6 %@i#:!)+/CX6 %>i#:! ) + 6 C X % }# ! ) + 0 6 X C % ;w# F : !)#( "'  ܂}} "'o3 od$ wd$ d$ 32 '|,}#cc:#cc:#cc:w~) 90 cc< ) + < $F %) + < &F ') + < (F )) + < *F  9|>}#cc:#cc:#cc:~) 90 cc< ) + < $F %) + < &F ') + < (F )) + < *F  9N)b! '|,}7! 9|>} w Ql M#2QKM(  (   ) + F   . %Q5Q /G c F   M)+/ 9I$   M  +G  +/F  +G +/I M+G +<6- $)+N# Q }G 9x ) +  <% aa0ZaZaZaaaa  '|9$snss n$snss n$snssn$snssnm$snssnG#0#ppap:p>kkj ._ '|>}1 '|>}3=)/M 9GZpZpZppp ./0]k'k'k`k'`k=k']i'i'i`i'`i=i': + '|9}! "+?H0JKLMi?I0+,-.kk+k ++ + k k+ k +  +  +| m |;3=>?@0ABCD EF2   G2݆?^g`5:yG "5` @ g F ] P { 2 d  l PS6`This appears to be the end of James' mine. You continue to look for signs of gold.You're close to a likely spot. Try that nearby.You need to get your own pick!Nothin'!"Hey James! Look at this!"Just look at that GOLD glitter on the wall!You've struck GOLD, I say GOLD, young man!You can't do that from here!There is no gold in sight right now.Through the hole in the mine wall you see the faint glimmer of GOLD!You reach out and grasp the gold nuggets!There's no hole right now.The hole isn't big enough!With great anticipation, you crawl through the hole into the underground cavern.You can't reach the gold from here.James says, "Hmmm. That looks strange. I wonder what's going on here. Keep on going, Jerrod!""It's getting bigger James. Look!""I see it brother, keep on going!""Oh my, look at that!""Keep swinging that pick, Jerrod! It's almost big enough to get through!""My heart is pounding, James! What to you think is behind it?""I don't know, Jerrod, but my knees are getting weak!"It's difficult to tell what is through the hole in the wall.There's something on the other side of the mine wall, but you can't tell what it is, yet.You see part of a cavern through the hole in the mine wall.There is a natural underground cavern on the other side of the mine wall.You already have a pick.You can't take your brother's pick!The hole is big enough.James is not here.Why not get some of that gold on the wall?The hole is very small and dark. You can't see what is through the hole.The hole leads to some sort of cavern, but you just can't see what it is!You can now see through the hole enough to know that it leads to a natural underground cavern! You think you see something glimmering in the light of the lanterns!!It is now clear to see that in the underground cavern there is definitely something glimmering. Your heart begins to pound!!!You can barely detect a hole in the wall.There's a hole in the wall of the mineYou can see through the hole in the wall of the mine into a natural underground cavern!!Through the hole in the wall of the mine you think you see something glittering! It seems too good to be true. Could it be GOLD???!!!His name is James now!It's hard to believe that is your brother Jake, I mean James! He's grown a beard, and put on a few pounds. Those biceps are huge!"We'll have time for small talk later, Jerrod. I can feel it. We're getting close to something big!" says James.The walls of the mine are rough and rocky.You are in a mine.There is a small hole in the wall of the mine.The hole in the wall is getting bigger!That hole is almost big enough to crawl through. Your heart begins to pound!The huge hole in the wall must lead to something!Your eyes, unaccustomed to the bright light of the lanterns, take a moment to adjust.Although you are still squinting, you see a man across the mine shaft.You have followed a trail of clues left by your brother, and they have led you right here. It must be him!You move closer to get a better look.It has been eleven years, but there's no doubt about it. That is your brother!"Jake!" you shout across the mine shaft.You wait a moment and shout again, "Jake, I mean James! Is that you?"The man across the mine shaft stops picking and turns around.He looks you over from head to toe."It's me, your brother Jerrod!" you shout."Is it really you, Jerrod?""It's me! Jerrod Wilson!""I can't believe it! It's really you! I just can't believe it!""Let me get a good look at you Jerrod. I still can't believe it's really you!""You are lookin' good, Jerrod!""Well, I'm looking okay. Considering everything I've been through to get here!""But I'm wondering about you James. How are you doing and what have you been doing for the last eleven years?""That's a long story. I'll tell you all about it sometime.""But right now, you and I have work to do!""I'm closing in on the finest and purest vein of gold in all of California!""And the two of us are going to find it!""Well, then let's get to work James!"4P8= ?P!) j)6 X# 0 4=i  [] PZ! 6) 8) PZ j P[ je )N 9ee [e ee( ee e ( eooao( / )/M 9Gee7a77k e(e)3e 0 4=!o|op{)GT-r0This is the end of the tailrace of Sutter's Sawmill.This is just wild grass.This is just one of the many trees found in these parts.This is just another rock.This is where the tailrace rejoins the American River.The land across the river is no different than what is on this side.Ya can't be pannin' unless yer in the water!If yer gonna pan ya gotta get one!Nothin'!The town of Coloma is farther to the east.Historical note: On the morning of January 24, 1848, James Wilson Marshall found the first nugget of gold in the tailrace of Sutter's Mill. This discovery changed the course of history.Since then, this area has been panned out!The sawmill is nearby to the east.Don't dig up the town! Do that somewhere else!!No shovel, no diggin'!4= zWzO?P!)+-/6=%j6#F !)+6=C%^;#!)+6=%Ee#!) j6 ) s%x# 0 4=i e )N 9 /LPQg6 Qc7 Q]8(  zeB/LPQb6 Qf5 Qj6qee[e ee( ee3eee    e ooao( / j)/M 9Ge e 7a77k e(e)ZZe*e 0 4=!oop{)Trox FwThis is Sutter's Mill! Water flowin' through the tailrace powers the sawmill!This is just wild grass.The only tree nearby is being reduced to lumber.This is just another rock.The tailrace supplies the water and power to operate the sawmill. In the distance is the American River!This is the beginnin' of Coloma's Main Street.This is a facinatin' piece of engineerin'!There are logs and wood lyin' all over 'round here!This man has a hazardous job!!The man cain't hear ya over the roar of the water and the sound of the sawmill!Nothin'!Ya cain't be pannin' unless yer in the water!If yer gonna pan ya gotta get one!!The town of Coloma is farther to the east.Ya have no need fer it.The water turns the paddle wheel and powers the sawmill.Don't dig up the town! Do that somewhere else!!No shovel, no diggin'!43= ?#!)C%8c#!) # 0 4=i  /aPg 6 /aPg 8Ce[e ee( eeee  e e e Ze 7a77k e(e)ooaoe*3e ~'e 0 4=!oop{*V)1m ,yThis is where they cut these logs down to size for the sawmill. The town of Coloma is farther to the east.This is just wild grass.The trees 'round here have this to look forward to!This is just another rock.The American River runs along the north edge of Coloma. At this point the tailrace diverts water to the sawmill.This is Main Street!These men are cuttin' this log in two. There's a chain attached to one end of the log.The men are cuttin' the logs down to size.These men don't have any breath to spare for idle chitchat!By the look of things, that saw may need to be sharpened!The men use the chain to move the logs around.Those workin' men need that chain to do their job!The sawmill is nearby to the west.Yer on the outskirts of Coloma. The heart of the town is nearby to the east.Don't dig up the town! Do that somewhere else!!No shovel, no diggin'!Ya needs to be in the water!4: "= ?`!) # 0 4= =e[e ee( eejethBthB'~ee)e Z)e 'e Ke " "e .e..=je( e7a77k e(e)ooaoe* 0 4=!oop*.V :c=QEThis is the residential area of Coloma. These buildings are houses.This is just wild grass.This is just one of the mighty trees found in these parts.This is just another rock.The American River is on the north edge of town.Main Street and Bridge Street meet here.These buildings are private residences. Of all the buildings in town, the hotel is the most predominant.It's nothin' but a typical California bush.Someone headed fer the hills and left a perfectly good wagon behind!It's not yer wagon.The boardwalk lines both sides of Main Street.A fence is attached to the boardwalk.You see nothin' of interest through the window.Ya see a door on one of the houses.This is someone's house! That's breakin' 'n enterin'!! Ya can't do that!!!The Green Pastures Hotel is the main attraction in Coloma.There's more of the same terrain on the other side of the American River.Don't dig up the town! Do that somewhere else!!No shovel, no diggin'!Ya needs to be in the water!4xw= gb+zmS?S!)g= %HL%2L#!),/6 =S,&#F!) # 0 4= =d' PMd Q2L QHL   /G2c+FB9' S  ( (e[e ee( e( eejethBthB'~eerre   (Ze e 'e Ke e =e (BYee    (BY[ee7a77k e(e)ooaoe* 0 4=oo* V/P1UFp [There's a building under construction on Main Street.This is just wild grass.This is just one of the mighty trees found in these parts.This is just another rock.The American River flows on the north edge of town.Main Street is behind the hotel.Of all the buildings in town, the hotel is the most preferred.This is a typical California bush.A sawhorse is sure useful fer a construction worker!These were once mighty oaks!A boardwalk lines both sides of Main Street.A fence is nailed to the boardwalk.There are a couple of tree stumps on the south side of Main.There's nothin' of interest in the tent.This miner decided to pitch his tent right on Main Street!This man is lucky to be workin' inside instead of outside in the scorchin' sun!That man on the roof is a hammerin' fool!The man inside says, "Today's my day to work inside. Couldn't have picked a better day to be outta the sun!"That hammerin' fool can't hear ya over the poundin' of his hammer!The Green Pastures Hotel is the main attraction in Coloma.The wilderness on the other side of the river is the same as on this side.Don't dig up the town! Do that somewhere else!!No shovel, no diggin'!Ya need to be in the water!4T*2= zM?#!) # 0 4=i  6) 8) )Fb X )Fb Ye )N 9Me[e ee( eee =e ( ethBthB'~e ooao( / )/M 9Ge e 7a77k e(e) 0 4=!oo|p*'V5`2V_ There's not much to look at on the edge of town, but ya can see the Green Pastures Hotel from anywhere in town!This is just wild grass.This is just one of the mighty trees found in these parts.This is just another rock.Here's a great view of the American River!Here, Main Street turns into Sacramento Street.This is one of the many tents 'round town.There's more of the same terrain on the other side of the American River.Ya can't be pannin' unless yer in the water!If yer gonna pan, ya gotta get one!Nothin'!There is nothin' of interest in the tent.The Green Pastures Hotel is the main attraction in Coloma.Don't dig up the town! Do that somewhere else!!No shovel, no diggin'!Ya need to be in the water!42= ?P!) @FnZ%>R# 0 4=i e[e ee( eejee)e Z)e 'e Ke " "e .e..e7a77k e(e)ooaoe*thBthB'~e 0 4=,po{op*V =-A|RThis is the west edge of town. The Green Pastures Hotel is to the east.This is just wild grass.This is just one of the mighty trees found in these parts.There's no rock in sight!The American River is on the north edge of town.Main Street is in the distance; Bridge Street runs north and south. Back Street leads to the hotel.Of all the buildings in town, the hotel is the most prevalent.This is a typical California bush.Just past Main Street ya can see a wagon.It's not yer wagon.The boardwalk runs down Back Street in front of the hotel.A fence is attached to the boardwalk.Ya see nothin' of interest through the window.Ya see no interestin' door here.There's no reason to open this door.The Green Pastures Hotel is the main attraction in Coloma.Don't dig up the town! Do that somewhere else!!No shovel, no diggin'!Ya need to be in the water!4R= zQz zo ?P!) 2; 2;3R&23# 0 4=i Ke[e ee( eejeee thBthB'~e 'e Ke 7a77k e(e)ooaoe* =e 0 4=,poo{p*V2_HnYa can barely see the boardwalk that leads to the hotel.This is just wild grass.This is just one of the mighty trees found in these parts.There's no rock in sight.The American River lies north of the town of Coloma.Sacramento Street is just east of the hotel.Of all the buildings in town, the hotel is the most popular.There's no bush in sight.Tents dot the perimeter of the town.The Green Pastures Hotel is the main attraction in Coloma.This boardwalk leads to the Green Pastures Hotel.A fence is attached to the boardwalk.There's nothin' of interest in the tent.Don't dig up the town! Do that somewhere else!!No shovel, no diggin'!Ya need to be in the water!4CD= ztP?d!) %#R%fR# 0 4=i e[e ee( eejee)e Z)e 'e Ke e 7a77k e(e)ooaoe*thBthB'~ee =e 0 4=["p2Loo oooooo{op{*V c.=lThis is a distant view of the Green Pastures Hotel.This is just wild grass.This is just one of the many, mighty trees found in these parts.No rock is sight.Just past town ya see the American River.From here ya can see three streets; Main, Bridge and Back Streets.Of all the buildings in town, the hotel is the most prominent.There's no bush in sight.From here ya can barely see a wagon.Cain't do that from here!The boardwalk goes under the balcony of the hotel.A fence follows the boardwalk. There is also a railing around the hotel balcony.Tents dot the perimeter of the settlement.The Green Pastures Hotel is the main attraction in Coloma.The the hotel balcony has a railing around it.There's nothin' of interest in the tent.Don't dig up the town! Do that somewhere else!No shovel, no diggin'!Ya need to be in the water!4.= zU?d!) # 0 4=i ;e[e e( eejethBthB'~e e  =e 'e Ke 7a77k e(e)ooaoe* 0 4=,poo{p{*VcEdThrough the trees ya can barely see the hotel.This is just wild grass.This is just one of the mighty trees found in these parts.Just past town ya can see the American River.Sacramento Street dissipates into wilderness. Back Street heads west in front of the hotel.Of all the buildings in town, the hotel is the most prestigious.Tents dot the perimeter of the city.The Green Pastures Hotel is the main attraction in Coloma.The boardwalk heads west down Back Street in front of the hotel.A fence follows the boardwalk.There's nothin' of interest in the tent.Don't dig up the town! Do that somewhere else!!No shovel, no diggin'!Ya need to be in the water!4Hwb!)%#F!)+%#UXC6!)+% C# 9F  A7QGPL )+/LMI' )+PLQ xG )+/LMI' )+PLQxG )PLQG FM )+/PLGI  +QG Q Q Qx )+Q +FM#Q!GPL Q0 )+/LI' )+PLQ?G )+/LI' )+PLQ$G F)+G  #   /& )+PLQ<Gcc    Q4 Q* Q$ )+F6 -)+/($I( +/(I  w! n #Q#; Q3 Q; Qr $ 6*TetFor a moment, you and James stand in awe of what you have found. The silence is broken only by echos of the splashing stream winding through the cavern. The light of the lantern reflects a golden glimmer all around you. This must be a dream..."What we've found here isn't fools GOLD!""This is GOLD!!""PURE GOLD!!!"Your courage, commitment and perseverance have made your dream come true; infinitely beyond your highest hopes or aspirations!Thank you for playing...4Dwg ݗ   xi49Any key to return to the GOLD mine!%g69This door is immensely huge and the sturdiest door you've ever seen in yer entire life!There's an interesting hole in the door as shown here!This door has a heavy-duty double lock system to keep out unwanted intruders!This door is so heavy that it requires a system of weights to assist the user in raising and lowering it safely.On either side of the door you can see the ropes that attach to the weights!4r b bb,zu!)+/6 %0O#I!)+/6XC%/P#:!)U++I//6XC%uP#:!)6 #  c-3/+#I/+#IX  $ 2 $ 2 (+/II &^6`#2(+/I +/ I*+++- ݧR2 d $wMgc  : ^` +%~W ^` +%_""G ^;` f^`3 ^;`e f^`Ie Ue 0ee""G ^;` f^`3 ^;`e f^`Ie Ue 0ee"L ^;` f^`8 ^;`e f^`Ie0 e I;Iee'"A ^;` f^`- ^;`e f^`I e ;K Ie e]"] ^;` f^`I ^;`e f^`08(Ie Uec,e+< Ue e`"` "`` `` " "  ]"] "]]] ==F ^;` f^`2 ^;`e f^`Ie%Nf+ ee" "D ^;` f^`0 ^;`eIee Uee ee e&"&" "& " ^;`eethBthBe0e ee/e+e Bb>pDaDj>(_Ledge walkin' can be hazardous!Yer not close enough to a window.This window's already open.Ya reach through the broken glass and unlatch the window.Ya cain't do that through the window.Ya open the window.Ya cain't do that. The window is latched!It looks like there's someone inside. I wouldn't!Ya close the window.The window's already closed.Why would ya do that? The window's open!Ya reach through the broken glass and latch the window.You know you could do that, but right now you have no reason to.The window's already broken.As quietly as ya can, ya bust the hotel window!Bein' mighty careful not to fall offa the ledge, ya crawl through the window.Yer walkin' the ledge at Green Pastures Hotel!It's ain't that far down, but fallin' might be fatal!Not now! Ya might fall off the ledge!Ya don't have a message.This is room 13. Ya notice nothin' unusual.Ya see a dusty hotel room. No one has been in this room fer a long time. There is a fireplace on the right side of the room. That's strange...It is difficult to see through the dusty window. All you can see is a fireplace on the right side of the room. That's strange...You've got yer back up against a wall!This man will kill you if he catches you walkin' past his window!You carefully side-step on the ledge past the windows....there's no door to this room!4 b bb,b.zaz!)\++[//6XC%O#:!)+/6XC%aP#:!)+/6 =%M #I!)+/6 %bO#I!)6 #  c*++-3/+#I/+#IX  $ 2 $ 2 (+/II & 6 #2(+/I +/ I-3/+#I/+#I.  $ 2 $ 2  X^h`#2(+/I"(+/I+- ݧR2 d $wMgc  : ^` +%_""G R^l` ^'`3 R^l`e ^'`[e \e Zee""G R^l` ^'`3 R^l`e ^'`[e \e Zee"O R^l` ^'`; R^l`e ^'`"[eZec. [;Iee'"D R^l` ^'`0 R^l`e ^'`[e c.;K [e e]" R^l` ^'`k R^l`e ^'`R8J[e <\e1c,e+< \c,+<e e`"` "`` `C` C" " C C]"] "]]C] C==CC R^l` ^'`/ R^l`e ^'`[e%Id+ ee" "> R^l` ^'`* R^l`e[e \eee&"&" "& "3 R^l` ^'` R^l`e ee ethBthBe0e ee/e+e BfBtHe9c$Jc_; Ledge walkin' can be hazardous!Yer not close enough to a window.This window's already open.Ya reach through the broken glass and unlatch the window.Ya cain't do that through the window.Ya open the window.Ya cain't do that. The window is latched.It looks like there's someone inside. I wouldn't!Ya close the window.The window's already closed.Why would ya do that? The window's open!Ya reach through the broken glass and latch the window.You know you could do that, but right now you have no reason to.The window's already broken.As quietly as ya can, ya bust the hotel window!Bein' mighty careful not to fall offa the ledge, ya crawl through the window!But just after ya bust the window, ya notice there's a man inside and he's yelling......"Burglar! Burglar! Get that burglar!!"Ya never know what might be lurkin' inside one of these windows!Yer walkin' the ledge at the Green Pastures Hotel!It doesn't look that far down, but if ya fell, ya probably wouldn't survive!Not now! Ya might fall off the ledge!Ya don't have a message.This is room 10. Only the lady is unusual. Watch your step outside of this window!Room 11 is clean and tidy. Ya notice a fireplace on the left wall of the room.Through the window ya see a clean room. There's a fireplace on the left side of the room.You've got yer back up against a wall!Walkin' a ledge like this is nothin' fer a sure-footed frontiersman like yerself!Now you understand why the ledge is shakin' near this window!The man's not in his room right now.This man has a lot on his mind. He doesn't notice you outside of his window.4c & b!b" z j !)+CX=6%6L#!)+/ /CX6%r#:!)+/ /CX6 %:k#:!)+CX6%weL#!)+CX6%PL#?P! X)  6OY){#) X %w%uf ^4#i ;g ( QR MN / Z[ )O \] ) O   6Y " 8XC ux c!:;I uxK  ;c": :m>m c!:;I :m>mK  ;c": :l=l+%Ji ux+%Bip{o{p{o{" eejjej eee ee e]] e 66{e Xe (Xe Z(''e0[e.G... eeje]]j]j``j`eje]]jj``je}.Z6T<Qf8PrMiles from Sutter's Fort: E: %v111 S: %v112At long last you've finally arrived. This is James' cabin!This is James' cabin. You notice a path leadin' from the front door of the cabin to the outhouse.Not too far, but far enough, from James' cabin is an outhouse.Bushes surround the outhouse.James' ol' mule is at the trough by the cabin getting a well deserved drink.There are flies over by the bushes and the outhouse.James' ol' mule is somewhere 'round here, but not in sight.Go ahead and walk on in. It's not locked.The mule's home now.Ya already did that.There's some water in the trough, but it's for the mule.You don't want to drink any of that mule water.You're outside of James' cabin.There's a path leadin' from the front door of the cabin to the outhouse.This the outhouse door.The door leads into James' cabin.Even up close, it still appears to be a normal outhouse.There doesn't appear to be anything unusual under the cabin.There's no way to do that from right here.There doesn't appear to be anything unusual under the outhouse. But it's difficult to tell from out here.4 14g1B ,Y 1118b1113347;@BB/33 }}s}s ~o~a}vt ttata}\ }Y{QzFz7z2wwc y1t-t;sDrKpM|\oY !""wc P wNvet_r]q\pZ}]"axakPkMoMkMx^_{z_v]u[sYrWpUoTmQlPtU|q~q}}q~rtv}}wy~Af4A>oV kQ2b821*&l v)1x*kRwas\r[vg`~] |Q{E{4i d |5zb mTmumu& q{q]oZ oZoynapbrzrt4^f^ljlUfKVKEK4KDPVPVQURERDQES0 *@"RW UOU*EOE*D*C(H'I&J(L)O)Q&R'W(W)U*E*K&)HSHQLVL&H(T)T+TOFOF+XL G+GNSNS+ gKg 3K3 h"2"5lT5_lYfNVNDN4NwlXfM4M5O5]eOe]5ODOVOdOBz=9r!m!5$2$g'b'.*\*+,(,X.U.&0$0Q2M2!88J<O>]AOA]DRD]GXJZM[PZSXVRV]YOY]\O\]_O_]bOb]gQg_iUickYkgVODOy} ?LYdnyl_TGu#b#Z#O#C#7#h)0):)E)O)W)]-U1N6I -+-5-?-I-P1%1/181B1I6C6<646,6#:':0:8:?:F>#:>,>4><>C>IBFB?B8B0B'BF#N#V$^$JRZbZ'b'^,V-V4^3V<^GQ[>FQ[eoxyncYNEi%i-i7i?iFiMcmfv~XHU`mzxmaUI@MZeov i a X K > 6#8#D#P#[#c#i&^&X&N&C&7&/&0)1);)F)P)X)^+U+O+F+;+1+*-,-6-@-J-Q-V/N/H/@/6/,1&10191C1J1O3F3@393/3& 6"6+636;6B6H:G:@:9:1:(: >">+>3>;>B>HBGB@B9B1B(B F"J N"R V#V,V3V;VBVHZGZ@Z9Z1Z(Z ^#^+^2^;^B^HbGb@b9b1b(b g!g(g1g:gBgIiLiEi>i6i,i$k%k+k4k=jFkFmImBm8m0m)p+p1p9pBpLs6s/|7|A|J=FPZbl?GR\fyxmbXMD: 4ff#1#0#/)*)).$.#1 =IVb7 y0 r) l# ip|1s|lu¡&DSQ@e}v{Sd@TT@x0|w@|~y {x K+H.J1)19R1J1L2L;R;Q:LOAODOVOYO\O_ObOz5z9z=zAzEzI{M{Q|U}YpN|]RMHM5_f_ga4a3chcif1f0iki7`G`Y`e`=bRbbbDdDe_d`eUgUh3g2hll/llp-p+tlt)xcxa|(|&a#d!n}!Xx%I.cR&=V;}YxMu\qfm"BlQj0q1y|zxv0{rwn`~jxjxfP{e {lzs{{kwop}sqi{&jye}i2ghmptjvdyipm{jqggcf{ix}brL|XzQsHsDzLyGyBy=y9y5vemWm\#oemf$oomq$vjtm$vutw%vveMVMUQEQDM5M9asOsPxQx?x>tGxLv4v3x1x2tBtCzXzYwTwUuMuk? ?%&'{J{Js+s3`3_9_9cAcA_W_\_0c_0f_kgPgPqpqsvmvv~~UUppQpQhlhb^X^S^A^9^+tJtIz'z$>4! 1k81;;>?EGNRX[\bhiiA=ioomkj}or{}}wvoc_^^aaepw~y}~zrmlmpqq==?AEJR\ei<>?@[klmp}zxlfdbaichek hi}B 111g=1113347;@BB/33 ""s"s*!o!a")+ ++a+a_"\ "Y$Q%F%7%2((c &1\+-+;,D-K/M#\0Y (c (N)e+_-].\/Z"] a'a4P4M0M4M'^ _{%_)]*[,Y-W/U0T2Q3P+U#q!q""q!r tv"}wy~A9kA>0V 4Q2=g21u&3 ))1'*4R(a,\-[vg`!] #Q$E$4i d #5%b 2T2u2u.{.]0Z 0Z0y1a/b-z-ty}k^9^3j3U9KIKZKkKr[PIPIQJRZR[QZS "@*MWJOJ*ZOZ*[*\(W'V&U(S)P)N&M'H(H)J*Z*T&WSWQSVS&W(K)K+KOYOY+GL X+XNLNL+ 8K8 lKl 7"m"j3Tj_3Y9NIN[NkNuw3X9MkMtjOj]:O:]jO[OIO;OB^f=9q~m~5{2{gxbx.u\u+s(sXqUq&o$oQmMm!ggJccJ__J[['[+[JWSOKGGJCCJ??J;;J7M7!5#5P3%3L0(0L-+-G!7!W;e?}C}rzlz|wgwxtatrr]rmpipYnUndl`lQgOg]dOd]aOa]^O^][R[]XXUZR[OZLXIRI]FOF]COC]@O@]=O=]8Q8_6U6c4Y4gIO[Oy" ?LYdTG|b|Z|O|C|7|hv0v:vEvOvWv]rUnNiI r+r5r?rIrPn%n/n8nBnIiCiGQ[>FQ[eoxyncYNE6%6-676?6F6Mcmfv!XHUaUI@MZeiaXK>6|8|D|P|[|c|iy^yXyNyCy7y/y0v1v;vFvPvXv^tUtOtFt;t1t*r,r6r@rJrQrVpNpHp@p6p,n&n0n9nCnJnOlFl@l9l/l& i"i+i3i;iBiHeGe@e9e1e(e a"a+a3a;aBaH]G]@]9]1](] Y"U Q"M I#I,I3I;IBIHEGE@E9E1E(E A#A+A2A;ABAH=G=@=9=1=(= 8!8(818:8B8I6L6E6>666,6$4%4+444=5F4F2I2B28202)/+/1/9/B/L,6,/#7#A#J=FPZbl?GR\fyxmbXMD: k99|1|0|/v*v)q$q#n bVI=7 &0 -) 3# 6/|,|3u B!6:})$Ld_KK_ss'#@(#~@& $' U1M1W1W0W;M;N:RFO0MF OFO5M5M6M@N@N6 MA MCND M@N;gOdOaO^O[OIOFOCO@O=O%5%9%=%A%E%I$M$Q#U"Y/N#]MMWMj_9_8akalc7c6fnfoi4ih`X`F`:`bbMb=b[d[e@d?eJgJhlgmh3lpl3prptt3tvx|w|g>e;>1;":::'bId}FxRuCq9m]lNjoqny#zP'v$r0(n!j0'j'f$e $l%s${4w0/},.6{5y1:}6872/+Y5v;y6/2{5.88!<9{*6x"b@-L#X%Q,H,D%L&Go&B^&=^&9n&5])e2W2\0e,2f0o,2q)j++m)u,+w)-)-jM[MZQJQIM:Mf>,O,P'Q'?'>+G'L)4)3'1'2+B+C%X%Y(T(U*M*kAnborr|t|F~5ssr;!)2u-u5fKfK_b_beneqjRjRkQlRmRrtry|z}hh@;bPOTY[`ddcdd`.0R0 T6V>V0y0z7}/}.{0z1|0U3-3 2 ZZTT {,, { " ~ !!04!g".h|~(" |!<<9")*9'!b'1f##&#/5"-{-!"!5 AXz=[5S S =+7+U.U.?R7RWVWV>y8yY}Y}0\ g+_+-..fRbRUVVh :,9T9{:b")r.VHH JJL C% U T SR     [[\ #%e.0/+Z .e.ZR\ &VgV]U_ -[,`Sdy_ "{_yey|}}gzgPWW~WxVWTQT/S*S)S)0 0 RR S S*T/TLUQUWVxWWU S>T !S(SSY `xY WWQW /U*UPR^T'U5U^WS]QZ$~N~-x0xUWSW0Q0QS/R/0*0*RQ0#12.0341366447856881B0BILIL0j0jJnJtKt0%$u0M00WP9; ~xWQ`H_H/*J`JST`~~_xx_W]WY`gagYYaD_7^7{D|D`//ZY**ZY0[X]]UT ux vw~Y$9 [UWI`!'0H0o0_a=_Q~xsokfa^ZURNKFB><40.+($" |uhNC<9  2@RYbes x"//. VWWxx}~~}x"tWWIJQQO//**( w{nF  0Xpb& 'Uc|f||4|YU>\) Z X ] _us^]ok\[did[ kQaQO(IA0AJMJM0NIMLAL@Ii0iKuLu0vKuNiMhJpKX_h`hXX`WXhiE^E}6|6]E^F|E6~5{5] 5\G]Q^Q_H^F^G_GW_ W^i_i`~vxpxlgtoah[Wd^WYdZh^oetjwowwxOIQQCO= B*(0.@ @ 3E=MG@@D  $ bI$,7nGTiu鑦^."-'CAgMm;n?-D#f G$I+a4?iFPaT\ozb1b d~~yyssoojjee__YYTTMMGAA;;;4//**## "@hg hgmėa}}k~}~+#xxt`roʞldDΖv0vJwLuOiNgJhHh0N0NHOJMMAM?I@G@0Q]4[5`5z4|6EF~FF{F_W]i^j`ibijhXWW~W`D~7}YgYtMjLLKBKD0DGKGHGH0E5`K;EA`TT S RP!0!R(Sl0lHsIpIp0m3`m:`mAa|3 |eUeU]U;U0-9-0 8 0 a X-a[a[}f~c~cb_a_|\gfhfp\o\vfwA`Ay=_=x9_9yCz:rCsCl:k:dCeZ[U_T #q l. vwmFxjp"]ca [ QM/Pg}}J[Gfꗉ$xp)/nG 3W e _UI9 >]~~|wrmhR~RMMHC>94/*RMJKKLM *5%3886654332100/98:9;;>>AA@@==<<@@DDDDDDGGGGGG6!; ? C H H0C091> 4 sq|sworkmfhbc^WXYZ]^`adeghjknokjghdc_`[\xq{ksd l ^gZb=8 3.(#&*/49>CH~M~|wrmh~gcxbjaxgmfjfxlmkjkxqrpjpxvoujux{jzxjxki=54z4u4p4k4g4b4^ɐ*]\*a`*fe*ji*pn*us*zx*}T]^x4x9x>xCxHxM*4*9*>*B*F*J*ONJFB>94g4W4Q4?4/4g9W9Q9?9/9g>W>Q>?>/>gCWCQB?B/BgGWGQG?G/FgLWLQK?K/KxQfQWPQP5O/Ov ~~xWWxE//E**eci`]ZWTQiIHJJKMLLNO xEVDVExFQD.C.DQE*C B C*D D SDTDTCTET"E"T&E&U1E1U6E6U;E;V@F@VEFEVIFIVNFNWYFYW^F^WbFbWgEgXlGlXpGpXtGtX D.EVFDSDTDTETET#E#T'E'U2E2U7E7U<<?=AAEE>9LLOPPOMPSUT Z  \I^^`bbcdeeggjkkjhjkommpnt  E>> EBC?F F ?Iɫ #1*"N W5 +# \_[ B FUaa E_G_6^6{E|6}E~XhhX~X`haEEEBBDAA DC DDCCA'UUxJxJHA~ . 0V@y@ ,N!Q RR R TUoY|ZXT)S5S5N,NEDE4 I0{!rW5Yrz"~1I^^F FI A=86.' # "$&+/69 =H?432 0"0%1'-2,3+1 ,+*% # #$ (*+/!1*2,0))*&+%.!-/00- &+,0jZ;YA%%{{7twx z!{#|'}+~/E:?6:24.XN TFOCJ?E;?7:35/ #98``P`PWLTIHAB==8$XHVEVHRDQBN@L>H/XA2"TO353,6&66<+<;B0B@H5HEN:NIT?TNS>SMM9MHG4GDA/A?;*;:5%562!7$F12-!_S3$& VBQ=K9E3?/9*4&uLkr3mvnKv_\UNPKJFEB>=8845LO&124*.*443?3@4@4?$3=D ^4,1.}hah|d`d{```z\yX_X_\ sXcXv`d`wheht\c\vdddwlelrr1T;{Q{(cddlxdzlv\b\vXbXc`x`zhdh\V[Z[e\g\kr5Y5-+T ~ M=r4Y4-'         !#1P0E/B - ? + :*4)2)1*o6oIl6lIi6iIf6fIc6cI`6`I]6Z6W4W^>jB^BjF^FjJ^JjN^NjR^RjV^VjZ^Zj^^^jb^bjf^fjj^jjn^njr^rj;^;j^j^j^j^kk^^j^juv78~/~, -?-s?s9.s 8t9?-?s??0@0@0@ 0 @#0#@&0&@)0)@>0>@A0A@D0D@G0G@J0J@M0M@P0P@S0S@V0V@Y0Y@\0\@_0_@b0b@e0e@h0h@k0k@n0n@0@0@0@0@0@0@0@0@0@0@4<@CK F O I SDW7 : " 2 4 !  ) 5 6_ehb_&_<_D_L_T_\_d_l_____eeeelede\eTeLeDe+>+@@ZZ4G YY]]_ss]]]],,]]~,~+^]~s~t^kk,k]kskkp]z^ uu!ss^^\\FFDD..,,[;\svq^[FD.,/-E]tQQFrFq@g@hFDFD@9@8F)F+@!@FFG RTT DDA A @,@,D6D7@8@E@FDfDe@f@r@tDDErArBgD6E8ADRfAXAtAtAtddAdAGAG@G66A6A.A.@.AAA-@BV3BIBzB,,.,5,H,c,u,,/<#VG+cc+,+55+-0-I-w-Cu陹/0 ) ' % $ " !   m $ 1.u.c.H.5...@sAseeA-A-A7A7FFACu//3c/H/5////@o  (  ^mm-m]mtmms7nnnn||mymyyvvm\m\YYmVmVSSmPmPMMmJmJGGmDmDAAm>m>;;m8m855m2m2//mmmmmm m m mmmx|t ^z^{{^j^^jj^{^{jwjw^r^rY^YjU^UjQ^QjM^MjI^IjE^EjA^Aj=^=j9^9j5^5j1^1j-^-j^j^j^j^k k ^^j^j *)a^xjksr?r,?,fq,  g+f?r?,? ?0@0@0@0@|0|@y0y@v0v@a0a@^0^@[0[@X0X@U0U@R0R@O0O@L0L@I0I@404@101@0@0@0@0@0@ 0 @ 0 @0@0@0@4CDW_ehb_y_[_S_K_C_;_3___ __e eee3e;eCeKeSe[eyee}b}huhubWbObGb?b7b/bbbbbhhhh/h7h?hGhOhWh+++||+xx+tplhd``+\\+XX+TT+PP+LL+HH+D@<844+000+,($ ++++  ++++   <p)j llo)"h&_ #^ "* z r b bbb"b*zzz"z*"*Z ZZZ"Z*R*R"RRR J JJJ"J*B : 2*2"222 *   "**"  "*&    && &".&6>FNV^fnv~&~&~~~vvvv&^^^^&V&VVVNNNN& !)')! ~~~~~'z)z!zzz vvvvv'r nfb bbb!b)^'^^^^Z ZZZ!Z)V'VVVVR RRR!R)N'NNNNJ JJJ!J)FB >: 62 222!2).* " ')! ')!     ')! ' : C C:: B B : : B ; ; = = ? ? A B B PEVQGGH$01% !   '-#&11335588;;>>BBFFJ&&##'/E5=58=5=?=;8-=9-:?8A8EEAC7;7;?929?9/9;5;+9-9.9,' & n m :.=:=;:/:.>;CuCeCGC5C-CCCVVWXdWeXGWGX!W XWU5UXUUBbBJBBYYSOOGGAsAs?e?eAGAG:6:6A-A-??AA@@>.>.@5@59H9H@d@d>t>t@@FFPPZZqcjci^qmmmqyjkqkqdhdf^4l IFHIGxFpHcIWFMGBE:E2G,F#HHMNT XY] \ YYTSQQOL#L)J,I4J=HQJWIcLqKzIJLKIKL]Y  XS  +++M;M;;qqqMM ~r~s9:~,~+ jjpjI>iBJBiFJFiJJJiNKNiRKRiVJViZKZi^L^ibMbifMfijLjinLniLiMiLiKiiJLiMi ~~tv68~/~, 4 -9s%>9~-~-O~s~sO-?-s?s9.s9?-?s??0@0@0@ 0 @#0#@&0&@)0)@>0>@A0A@D0D@G0G@J0J@M0M@P0P@S0S@V0V@Y0Y@\0\@_0_@b0b@e0e@h0h@k0k@n0n@0@0@0@0@0@0@0@0@0@0@4<@CK F O I SDW7 : .PuP_ehb_&_D_L_T_\_d_l_____eeeelede\eTeLeDe&ee"b"h*h*b@bHbPbXb`bhbpbbbbbhhhhphhh`hXhPhHh@h@\YS\VPYS"\"V"P&Y&S&M*\*V*P@V@P@JDYDRDLH\HVHPHJLYLSLMP\PVPPTYTSTMX\XVXPXJ\Y\S\M`\`V`PdYdSdMh\hVhPlYlSlMp\pVpPYSM\VPYSM\VOYSM\VPYSM\VPga[UONTZ`fga[UONTZ`fga[UNNTZ`fga[UONTZ`fpgpap[pUpOlNlTlZl`lfhghah[hUhOdNdTdZd`df`g`a`[`U`O\N\T\Z\`\fXgXaX[XUXOTNTTTZT`TfPgPaP[PUPOLNLTLZL`LfHgHaH[HUHODMDSDZD`Df@g@a@[@U@O@I*g*a*[*U*O&N&T&Z&`&f"g"a"["U"OTZ`fga[UTZ`f+++##+''++/37;??+CC+GG+KK+OO+SS+WW+[[+__+cc+gg+kk+ooo+sw{++++++++        <13 x z}(6)7)}) "* % - = ==="=*%%%"%*"*E EEE"E*M*M"MMM U UUU"U*]*]"]]] e eee"e*m*m"mmm u "**" "*&&&&}qyiaYQIA91)!&!&!!!))))&AAAA&I&IIIQQQQ&Y&YYYaaaa&i&iii7h}h3_5_ y_|_7j }j  Yz Zz ~ { h h  c [ m u+:r $onDD%ZlK!([`;,,}:}:rr}}|q|q;;|+|+4 IiJ FHIG'F/H=48=4`=:8.;4;*909<8:5:>808>83GRDDA A @,@,D6D7?D?DDfDe@f@r@tDDErAXAtAtddAEAE66A.A.AA-@,,/,`F,c,u,,/<#FQ+cc++u陹/0 ) ' % $ " !   1.u.c.F.5...>4m n ' & sAseeA-A-ACu//3c/F/5////@o  (  M0"J!0/MZ5k0kxk%K)LLZ\^ssL^L^--NNWz]mm/m\mtmmt7nnnnn||nynyy~vvn\n\YYnVnVSSnPnPMMnJnJGGnDnDAAn>n>;;n8n855n2n2//nnnnnn  n n nnnx|~qu ^RtJcIKiRNinT_ll/l\lulls%'J|iQOiiM{M{iwiwKaIYJYiUJUiQKQiMKMiIJIiEKEiALAi=M=i9M9i5L5i1L1iLiMiLiKi i JLiMi]JeJsJ !~+)bba~p~sk r_, z\ ~,~,Or?r,?,fq, f?r?,? ?0@0@0@0@|0|@y0y@v0v@a0a@^0^@[0[@X0X@U0U@R0R@O0O@L0L@I0I@F0F@404@101@0@0@0@0@0@ 0 @ 0 @0@0@0@4B@SDW *P_ehb_y_[_S_K_C_;_3___ __e eee3e;eCeKeSe[eyee}b}huhubWbObGb?b7b/bbbbbhhhh/h7h?hGhOhWhYS\VPYS}\}V}PyYySyMu\uVuP_J[Y[R[LW\WVWPWJSYSSSMO\OVOPKYKSKMG\GVGPGJCYCSCM?\?V?P;Y;S;M7\7V7P3Y3S3M/\/V/PYSM\VPYSM\VO Y S M\VPYSM\VPga[UONTZ`fga[UO N T Z ` fga[UNNTZ`fga[UONTZ`f/g/a/[/U/O3N3T3Z3`3f7g7a7[7U7O;N;T;Z;`;f?g?a?[?U?OCNCTCZC`CfGgGaG[GUGOKNKTKZK`KfOgOaO[OUOOSNSTSZS`SfWgWaW[WUWO[M[S[Z[`[f_Iuguau[uUuOyNyTyZy`yf}g}a}[}U}OTZ`fga[UTZ`f __MrMr+++||+xx+tplhd``+\\+XX+TT+PP+LL+HH+D@<844+000+,($ ++++  ++++   FNV^fnv~&~&~~~vvvv&^^^^&V&VVVNNNN&F&FFF>"h#[&_ &]"j YzZz~ {hh c[mut^-01[[zE 3T~wD? q}miqiqjqj njqx``wqcПk\`U`TkZmbjZhYfXdWqzda`PgPkVqVgO gN`NeOeSpl qOlNnTlVoNkNnOgR`RiTaTqWgWqZq]q`qnqso[o\fUgVcQssn^n^--}}|.|.]]mtmt4PE E|tok`][TMKG>:<c:@GIMVY\eilvy~ZZ;d@@S::kS:!:K:2!:A5N6NQQ6i^x/v3Y3it.\.V.S.egZcR*R3M3'0(3E3A/*/4J/ L/97D;M*0&1)=):%2%5B%0E) M)K% M%? =FA Mp'o)`)Y)R%0Z% b%l%h:ea`R$R^ X>BEY]e98243!2#1%E&M&S&[&ki .lElDyXyWlplXn.l6RhRplpk/k0jID MMUZ RR\ SC LG>X _0`ch ` X I @ @;WH`adg`XH>:9>5A5R49 4. 5$hAhQh9 i- h$ /A/Q0N0G0C /9 /QL: Q6 :!:5i#e;A D Z ^ $b#t.**/1&m&n&MR\Y_cGDC A<,X  -46#A!I"V"^"f#j#W+F+M4J.4$n,b,;+1,(636<5`7m6%F9CnD I9#9U9}9hS2R3M46r-]-A.,.<M)aR)3$`C$\$c$k$T$\RC ME MRY U-J.K$EsFmVmVlFlWsOq6QgQhNFM6N5G`>a0a*y1y/~'~ 88D41E;E;$66Sn4n:k:k8kSMMM;F;LL BBFd8_D FdEe NRUX [ NRUXCLH@DeDdEcKIKOKUK\KbKhKnKtYOYUY[YaYgYmYsYxbObUb\bbbhbnbuAANRVWXeeUM@@MN4Ӧ$#vw*w:yHwKv[w`uctkspqpmoiqdrat^s\rZoVmTnSkQiOiMkKfK\JWKRKNNKPKQHTIWHXEX>Y;Z3\,Y"[]]ZWUQNKJHEB?=<98#9$7&4&/',#$"#$"#&!  "%#&d>+Y150Y;+)!"V%M(M,L0G2G4J7I`?j=o;o8u2x/{-|($}~j]ba^c|wa  u\\\uu:J=mPLPLQ`Ph=O>aMMN]MiV>Pe`MZ9q:2j@ÙiGhA^Co$v$qe^OmbMa_aEeMclg0k@oqsL_LgMh3J'Q&N-J0F'Q,k.q1o0j-Z,P8J)P/oa e xm` ]ad/q)-qŲ2o*Y*8` com(R+_,f-j*\)N `+S-`.f/j0n/p.o,O.N0M2L3K6Jab c d i4oQ$#U$Y *[Y*[YM¹BECDA3$=-23"4  [R39B'&!iR#4;BZ5!9#) 9A#+6:A*v;2%~#)1#/00 -l* )%B"" I' -'$0'%FG ,EL K .RS $TN=   yGz } MUV CJFGFF6"LUL^]nn]p*t]ot t o^` h0jlk"m*l2m9mAkXkdlfjljldornѡkl Kqitas]uVvCbo[nb=h9^>_6Z;-b2a(b"c$h"i_qZrRqCr?q8r%p orea\ _!^)fe"b_\ilpq$ o'f@\C *\@jCiPjShWgaYI[U\a[iTJVXTi.W\XdWi]I&^hQLR[R^bIeI+P edYCR^EfDeCaC`EYDm^- 8K9b;k3M%5R4Z6c6g:l0O0Z1c4f5l7m2j-P.Ye#d,$P#V#`%h(l)j-q)f&e%V'tWb l"u#xZbp|zum v"y%tvmdbmtz v k e  \abkwrg&$1 A"" |"%xA-{+p K@.n)v39: 6t+s"1`o1u7q0rcpgn_qjm,nnep \o[l$]lNWl ap lnfp`r\oYmolap]obrfp`mollkkniponqoeq`r`p^lZmgofmikjhmiqlXlVkrjmgjfep_pkmkopnbnas\p_mYmgpZL |&x0r;q[q]p^qcqepfpgqmuxuzKFzD@8("4IH$KLJWM^LdMkLoKxG|EC4|/x.,w(q(n$wyxv|x x xrlc]YPKD@ > <;99::?@ D&F'E,F/G2C5G8C;C>HBJEIIFC&G&O(O(q3F-L.+G +O,)K*V2E,UoA B E a g poAPdmp s nS @=< =o9n pbp9% tk qo j;<BnR6G6m5q9r:o6n:q9v/u/p 1p1I4F4q0q0n5L3O0o1s7p:t9DZB@_/[ u={3G ,O5HB B BK0r01t8u9sh N"V!alo"F%U$a$f!i"n pS]hCL]jo%p//K0T/_.d:I9]:k9mqO@`?j@sDv:FjE\B^DTDLFIGVI`HmIvGwIw uQvu r$r&s!wvyqss2v5w9w=u?wBx;AG BGKQQjnosusoqnh]ZOGsElJgJbP_N[SZ[[sZ{^fls|z~}zqnRV}T{OxNvHsE=Wm}pzxxzu{n`~sR|?|;{2x)v#t#``xx%3QRSu}}vJ pHprrsuquKt_tHdӚùkorТgv_u[v`S{ZVkzprJrrdJ`L]V^m`v_jb_`WcO\odvcmeafphujti`kNnJhLeTe]oqmfnWmPykwcvUwM}l{hzW{Q~Vj}c|ZiaSig]PENXafcYLIDHMW_LSbd`w%c̯\~dwel $QiuDmyt{ot$Qus1wm"{lk$CIj1hDBh1i2sJqJTgv msg5if$o%gFuGmGu? >>=<a=^BXCXiXCVCVj _A `?[@WFUGQSQRQ!Q+P.Q1Q9R1>-A,C2Dΐ? ?BCE#YB*ºRɻ#=1KR=S\RbSgPHQ[OTN^KcGbF^GeJiLlMhO_D8BKB M4E5E3MHѺ4iѻ aZOy$[1=MɓC:4)N"9B*<;ÛACA1@Q>Y=[A?=TVYu]:Y+XTUYZ[\KJ G7HALIIJSGSbO[N`K~NJFJ>V [YU#U0[2\4]6WoUSPW>>GGGN?z@@A&A NJwObS=L1KJQ#)I]#GZIzFxEslRrVqYpBVTIWVX{TzR{LIEI,EN @.==$@N> F JGiKnGLrILMLMGMHFG?CK=M;J1I)I$M&JX"mU W,(Z%TV MWM MJKHEB+B!A @:A= BC @\@`>Q"@ >R@QW@LhG&FD[DZK\X[a\gYUYeZh\I[:`:W:#T:RDS[B/JOFU,ACKPGJcN]MiK}JGDTXsRtGDLD?>P;0@N?XL?H?GEFRG\DbErD}DLMIHM3N+FGCB @@@$>U4 WNOTUYZS#S.UDWD^CUg^aSkBI[jT? V?^>"DILLQCVWgSQ><>nJt-FwHrAsf?x>|>pGMxIUyaWrZ}i@C%aG(L'PLHNTbYbT"W% Z%LSHTOEQJEYgKZNWSQ>Q)@],B[CBKABIK#NdPT YVF;JA??? ?)>->}===G=d=k<< AAAAAA!A'@-@3@9@?@E@K@Q@W@]@c@i@o@u@{????????????!?'>->3>9>?>E>K>Q>W>]>c>i>o>u>{=======???????@|@v@p@j@d@^@X@R@L@F@@@:@4@.A(A"AAAA A== ?*>,>7=9???D@G@R?`Al?wB|B?A ÕĔҹoMNQW]elqPP)T/V1W;Y=Z@YK[QYV[r\wZ\Z[m2ABKLP +9Q\kED#GT:0YV:Ij@=0- ùB/+ @waFP8@ACCE@D ;E!R:ҼN+A4<S<əQ:IGRCJQ_⺜G[IcMdPcRgIr3-C)2#I=I#YS~ɢa*K2Y[B#I$F"S0P2O9F=E?CBB@?:K@W?T;VLWcQaJUFQESCWAZX}MLvLmDvECBCGISWUXNIHAHO#K(D+U9WFQFTTCMDaIiWvP~D{FVYPEGCW#C(IB*"@/H(L)mK6IPZB\CaGdJoKsIyI~FEC?=9653//+&$ nq{{x}{~tlc{{ytmkhca~\~\yXsXj[^_WdShSjVrWw^yi{zbXWVQRXb5c 7c5/1i+egi\h[hUrXm[lUV{yWSwkWj/12f3i26hjZ_.el^TBC BCB*C:BJCPX?P6N.PON OHl@o>t=;$LB!;-!;<[:]@U6S?TD9CJCJĺG IJ!M9L:LAK=D8HMGNEM$$flsuDL= GSH?U(O?6\$N>EOAJ@aDeCl:f/n*n!qs t}Zjcch_o_vecce]emt|s}bzCt*"= ,? A E .H K$L NQ T VW DG?=MPGCLRW>==5J?1m@/(=9%D/F3MJ0M2G.K+R+R2EV5+Z2Y8 U-A4 G3 X.EMIK OJRJ@=KAN@AJhHH&SFKGDFIPFIrnx% v"y"x|~;m>e-bdHbkvmhe_cɔ_# G*LN F"+?$hR%X)Z(DH7K7OFA@9b/q!panvmkvrd[+b[@_CfFi`FpHvWHST!V%@@>="A;@F>=>FR8SDRFSGV;T9UF]^^i]pk~jiu|KL)=[vB1JrCs\qS:\xY;fuc+-emxpyp*s|vxw~vw}yyw~94|c)%xxB2{ q#mks WqZsZl\VW2l'e ii==M >O>AAP@P@@\@q=[=t >[>tA]Aq??P?\?h @??@@ ? ?@@??@@ ?!@%?&?+@*@/?0?5@4@9?:??@>@C?D?E@H?J?I@M?N?O@]?^?_@b?c?d@g?h?i@l?m?n=== ====!=&=+=0=5=:=?=E=J=_=d@@@ @@@@!@&@+@0@5@:@?@D@I@N@^@c@h@m=i=n6k9j\X bL<<<>?C;;s3w/(#)7?FQSU\fyy}y}q{iycu[s[a\`[_[MXs;s[[X*# bvChzx~}~{I!{{z{4 n'u wxrs(p.m/j2k2m4n6r:s=y>=><@BOOSQRSxWt_ubqeghbhVeOaK^KXFUGNLHM?H=C:A8A5?2A0@,C)C%@BIM IKOR[BoNm[p]qissutyruqi_XUJHKIBC0p2j4A0A.i%ACQ.F,k)l#p,k2V*m&B.D.U-e J3RZ[XTSI C#BJSW^ehkmnq6AA):r8k * R!B:C[Cj9i hfha!b#d%d%b+c3dA8fAfFeHfJdJcPbPeYh]f`gbeeffњ}f be^U_S^N_LYHRYPdJc>x+@:'HFFGIJHK%2 NL'E%b!a#C&HDaW\v`CxHLNPhMqKLKJq!o1*j0%C#c[/`plp`GF R"H!DcU^dg[\c_T R aehh`PX`*b+R*F+F,U+^BW?I>T@W9`8Q9L8G6D5U6_4cNaOUNMLMKUIVSTRJUHTPTRdee[dOfTg^fbyS|C}T|\~aXV{Q|^[YeUf]ecSKMO@K7H"DP_ceW`fOkPsRqToQtRwTtPo*NqO{NOO{QyRzM-L0>'3*EFHJI=5:B)ôCHOrNNMLC9lCJY )Hj#*9m:o>oBn_\ TY\[nr G)O,K,_4N4g;REPQTVLQsSwb[gWgaJsMyKI>LPsOOynUnQ$1YmKfAUj=j*7m7i3iVr)![hB_icjum2iC0zmshsokg~rwq+f&c2!dI# md$mhp hjp*k#)?#BEGPlQOBGQI U ^ cVc]Z)S,(_=J ;S.DQJP$QSNaQ cZ pXsPwHGJW>rJtMNICLHkCl>oPpOxRv;nBADEHNPC>6M7Y6dLSM[L_Ma{EzN{T|[}b W \e\f L!V [MceYde?J@TAW K3)- ;O/G&D$CBZ$1G\!Ax%!;ABDCCqGqVfX[WTZQXO\P]N\Q]V\]^eTURaQcSeUdXL1 rd@"* $veu]sb9DW^finoVJ]&$l`^[X]"?]=`IV]"TaZSZJmwZIj̄_XODxGx@z)M#Vp pm!l&l'k(k)lCl\mmppwx{_yYyTyTT4{̴-{ PsONoMMOoNNQsQPPQQO OvO{OOONNNNNOwO|OONNNNNNPPPPPQQQ|Qw44{C{Cvtr rn!m+n?mLngnuon4T$4[6\?]D\L^X]_[c]j^kas[WSMKEA?9|8q5k7V6S8G9<<8<+:'99:; <=<_o^p[xW{V_t \kSwRQEG}DrAs@p=qC;B9Qlɶ! < QO NQQRTTQQML KNL)M2L4M:P?RFM?ĶOJ%DNYĖᕗBX;^8i8nY[XfXnVr< = <=$<)RA@Ms>b+."MGF+C&?#=M!N%R*R!TV!UW.ˬM)N2Q5SQ<[;`:j;o9K8S9]8e< ;:L0a4$.LHC;:Q!UST1N-WBO?PBQEZOGQILJJI6AJ@L:dDO<;=?%O(P7UGTQ=Y8M7R8[9b9k :zGzBN{:QySqGaJFqH}LPF#0#)?-#C-I/J(S-lV:Y9?BGOISBJED E*AA#@?HIPQ(T0S:X@T?XN[NJLHV=P:N9_J:)C1O-W/,G>KD FI.CC$F NT% YL SXU]PhGJfElWj@QM?]@6C=;LPMXN[2TaThIoEXQiG^6J;P7T'@?@?=K?BB=@G>{*CzBCMvNnYxTx3"@CvfD|Mnk\oUx A>Q"Q NO7QR8OP7RS8SSPPU V. OPPOO P POOPOPP Q!P%Q&P*Q+P/Q0OOO OOPP!P&P+P0S1S,S'S"RRRR RRUV=56=V>[KcXfigug^^d5;;2/t1[5O6>M8DA2GCNAQE>TJ1OMRFVW59j9rK|G{P}R{NzJyGQ}OGDLRMTVGpIyPyQp4 vѼ u{qksں_w_g[gZbY[[V\IY?[3Z(] \ZW R OL GB? >,?3=8=>BHBKAPCSBWD[J^MaMeJhGfDjAk?nAA?WMIF FB><C ;$=&@(?);+:-@0A2<4=7@9H8O;U;[:]9d7j1n,l)j$i!i^moqrw vpbX ~xgwuvzyrzqgi.opoykqrqZhZp[qZrZY]^^q=emqeQ?CtWXXnYppoMC]x~cBFNYvX~~|zvod_WPQeRdQcQ^VaWeZgP$ON>9E7M;P:SBSIPKPQSVQ^M[EZ:Z5Z*Z"\ `#S%L%C'B(@ `h jkP_9_ /`!)#=w1A{ABDFGGCBBCBZoQcSfRTUVjt~z|r~s|NDj j EQ0g>TcRjUnQ|}vx~}P*"*RQOPOPROV Nْ2GHIMLC3J*ŕ"HSIGBATəŠWUXZ![YWYQIGRIP@M@H>C@>>5?,@#(F'O$X$[QPUYWUTRROWPYUZTXYYA3JZ2Ӭæ?6j,1I 1;2*?) JC$J%N#Q$R'V(Y,[ VZ\Y!WUSRHEAC(F<3?*?&GWEXWS@R;N9PoLlEkCk@mApFmIpKwLpOnBB:1LMyNOOKG>tBJ"PbPf8a0`8b4`3`LgZIhGhP`L_KmDwILSM0XMRQUVTXS\OdNiNtJJJDDNPQeVVL\6\l9`6_2_8d5b:[xwywwvnklvjti~ihuxsr|{b`w_be~drfve{WW`_zaevkywrs{O[NRMANAOOJYLOJDJ@IBIRGVGYENFA7Z6M7B5K3Q5V4Y1Y0H1A/I/T-V,M+Y(W'Z*B*M+B`!L#H!A"= E Oai\H]fgC G R Z fjjYHZbdY bj V Id!H/W)Y5QIUQVNHT PKLaV \!V)Q3I7PDPMLPFWsbyUnt|z|}{#e{LJFmC Q(J{%J4S5S'Q/R1R7Q#PQQK$N#D$C/F5L7A5F8B> N;MHNJO[I:J?IYVDXBYTZ^VWVTX0U(T0q|rntnuvkjku|.s~`{aNM~KHDD{JuKlNjHnCkH S.UE0Y0M5L6Yi]iT i Z ifXT`I$JD#ED0K1WBV1WBW(V T&WKX^U]fgav {KE}Cs)N(V,L-Alw&Ta1dei_%Caڛ2! k41q)i"f b)cɫm"M(_-\˃yx嗉E+xm A3G CC MNF!"G H.RfR`#""3ThTpUmUjZqr t}sDD E i>|@?F.e193iQ>@=?|@1hhE LLgL_LFF[FhFKK8EE5DkDuD}JvJJm JKKDEE K `````Lk`````[p1r@CIBZK G G&K&K,G,G2K2K8G8G>K>KDGDKJGJGPKPKVGVK\KkGkGqKqKwGwG}K}KGGKKGGKKGGFKKGLLyFzLXFXG\F4L4KK+K1IrJxJ~IKJKJEr0["5[2+["%]Sh4f}$a5^8_3_y\\w\\77j7r1r'yr rmfa(_7_7B6A7@7[[[88j8_8P7O8N8L7K8I8F7E8D8n@rbimp srss4Ha` aabJYKkDjI DFJ#J0D2C4GMGbL_NJMNMUN`OeHoJLOHaaXXXQ`z_@^&^ QUwPbT;S1TUN#hGIcKHMRJXGZLSP_F`rXlFSrA[u+GqMqG% K#oR)`V&]"_'DW Q "KG^KThHU [aN)V]#XZVzYxZslMrIqFpBIKIHIG{KzM{SVZV,ZQ _.bb$_Na Y UXiTnGSr)Jb#GNEGKFVLRLRGMWFX?CT=R;U1V)V$R&JG"mJ H,(E%KI MHR RUTWE]+]!^ _:^= ]C _\_`aQ"_ aM@NH@ShX&Y[]/UPYJ^\TOXUcQ]RiT}UX[KGsMtX[S[`aO_N`XS?H9FCG;EULUK]D:HJkHYR5W?XEYRX\[bZr[}[SRVWR3Q+YX\] ___$a<`EbK`f_o`x_~`LKaJ4 HQPKJFEL#L.JDHDF@EOJgE[FiJIITHb SSYYRRXX X``````````````XT @XXX(X.X4X:XFXLXRXXX^XjXpXvX|XXXXXXY0S0Y`S`SYXXXXXXXX{XuXoXiXcX]XWXQXKXEX?X9X3X-X'X!XXXX XTTTTTTTT{TuToTiTcT]TWTQTKTET?T9T3T-T'T!TTTT TEEgg4><;98 <(=/;3:=;?R;Q9b;m>pAi?`BiFkEcGxY%5;O~CwT}AaOtUIC51KEɻ>:v6k7n8qD=IWmTiVaY\ZR^U`a]g\nop>seuotsQO PTVS RR[_ro=Q-ZEHOIXK^JkNjMbNYLPOIRKUTT]SlRnW^WOZM]QbTgUj\hllrmil`m[o[xtwfv]s]tg`b< cZdbaeblY.ܽN'F&D$A*?5=2<6=,.;Rk2JSj1VZZF٭џ B@C7A?>B V ZUT&KJ3C4B5<9U5Y9ZIYFXCMBFC>C=E@H[McRcaTfTmk[hVucHIVO.<3>4=1- L3JG&G=9I$I12XDECABB=O"T$V)$CEĕGGHQJSJZL`KkNDcUMWUU[VaTDDMGKEAEFiV'k]ifjmu^viwskelnJJGG'O(M1M8I6A?@$<&;<QPSYQ_QgEMeWgaem`T#)K/#R-LHAlTV1>G>GDKDKJGJGPKPKVGVK\KbKhL5F5FLLY77K\K\7L7y34OOp}{xeu\u\r]q\p\Lccmw{y~4bP*ٺ̹ <}<|@y?wBxEuJsRs[ubvfyf{imousvrrkqBoMjWgXfUdWaRaN]O[QVPOPJRGOCQCS?T<[:_8[5[4R3H5>99<6>2?-A+E(H)L$R(Y([$_'d&g)j(m-o+q7s:qC,G.V-f,g+l'r%s#promns uutnVIHE FLQPKGCDG&F*D,Ga&aN]&]N[P[,^+P+P(G)GMHODPD/C/C*@/0B0BQ?SmEFmmDrAEssAJ^0F2BRASXOA-C3V*\1Qij꫽|[u\jSZM±AN-\+^'h!ikki jghT,TJOHP,;8:N6O6B7=iQK i_?A|A|ZK@R39?V'h2"lmybo+d-]7WOMeR i V GFT\ggXbfSb!hL=-=)*Q)E(R)Zi Q!HHi&G$T$X$G>O=6MIN&LII9J(I)H=IKY,WA@H-HGK=UAc=iBq~\]R,QK9:8D8POh$j3 (N*Y+]'_ H Rh_Ui}F?GGI"O&Q^N SL2YrFhL^O\Q\Zcajjsvxrrlfeex_v]t]s[mWiWhVgUfVeVdU_T@T5Y.[-[$f#g noppopp4"##"$$&%|(q'l#l"j"nnnotz }zyxqcYm1,BDK,ibY2,3;:=>8A9G9Hj=?=AEEKNSU]$m"k$I%H%Dm IKGF"C mCgE:A:?i=i??@?4@4>bXbAhCB>@ggBB{A{<RaKCJ#L!gJF Wi5?@C?R>f}?GZ{Bz`}a~aB8A6e4e2d4ALlm lKTGT_S`R`P_PFO^91g`g`%4i2o1342322l.U]_lMX]YNLwcBqeyd- K/,#I khiA#e+e1d7d1)DdIiarbt`y_`@aeefJb3Mbscf`d_{\ROW6LVZ*(9l +*3j "$,), oRJЛqqp-o6n wm o'h7k2mEfLhNimdefRKKfLs i [ Q H I [hpsf/c0X/O-D,X-d&d*Z(R)I&W&bgYJJ\d9d8S=W;H<@=@=INBLVM\H^EcJwLSZadWT^ebUTzGt@mYgGORJ^H`HGFGOVPdNJIKZWe+w3t3}34/%.45-.I-Y.b'U&^'bJ[fUc U ^ jqNDNSOYM]XaXe%%/6A4dLlRGR_}B|`+**,l6kpJSVL]jr_NZbV(E&M$d$Y1E2Sk'k%j!j kkquu&}-x6wYt\q_s}sww=w=nnggfggftffdJdIg>l7l)lll q rv4X^VSPRPSTPL~K|M|OuRrRpOkQhPeVbV\TYOYMWLRLPOORKUISFTD[E_BbA`?g@m?|ACEJPT|W}\|^ya|d{j~k}n}rxv}y||~~vo9i8m8w9743/-)%#~ | y u n i f ^ \ UQLKNQX"Z$X'[*Z+V1U3Y4^7a9i:hk|lRqRpYo{}N|SqWrWqxme{Rq\pn U_hquwz!~%}(+,{1|58}@yb+D+2"UxRoP`QYSOVM Z"c"k sx#|.%v$k$b&p'~%[&c)k'a(\,{+q,d,Y.c-r/y0v2|/V2d1r3f3\5~6i7{CyBrAdDvEzGuH_GXIdJqMvRuOiMaMYPTSNTMUMJUK`KVOYIpKtTwDxCt6v1Z-g,p&z%n!cV']'dLh0l@gAn#^TwoSmQXn_qdojqrt:  *Quxvxuvu|T{qwqxUz_NVbkpUO5Y[YcWmUehyft0]o_b^V[T\[\dYmrl_TMSXequ U b k t v|RWc Z _ m q z\nXQPWdncgd]cWf]gefjgnjpipsrtgtYufuqseWM]gmswsk^nsus]TS`wR\TtfuRakqaXYcustqdhdZTb\i[w\_``zUysTOVXUcUhSlRfS\SVZ'oi^WUPYbjo`lt[eou!ktwOUN_s"Iw3jz }°qp%~(,"2~% 6C{F|#1Lw%1Qw#19 VoSn]rbqZ+dzI,i|sx9}swyxyw$ww#Yj}pE\+[m \d iX jc`k)q")x KgMp@FfFm@DrhMl&5q1s,pI'p"%s"nK\m0`I(]$][[Od`g[ZDY@Vfopkltl hkm" r+_X"W["UVUebWhl~~}zzzxyqv_rt y>ahq&,({H{JDC=<2&8 xKuutu1t?t@sAtSsTrUs`spwtxBA|{{|4!" #!#'"*!7 :"E#K#O!T"Y!\"a"e#h&i*i+k2k4j5l7m9}668;998Q-/,./;WhVYTVPUOOQLNKMHNDIEDDBA?C>F;G9F8B8=:9;19.8%: :97799: #f0*BaC09j=;:8990i5j8lVfFb>c7b0c'e%d#fgxIg2LnIwKJJIJJ)c'W'K(E'<&4($&%'&8D.453(422 34?6I:Q9Z8`5a>b=R>M?VAbPbN[MSMLScR[TcDEEPG[FaIbH^IVGKHF;KKX5h 1!IA*1:!2FmEuDo@l?n@v>pVFNG_HaNURg)d%e=uKw>9KF=HMLC& #"#%$&9%2'F&N%W"U$L%E'D:3675/4%%96 1ú&D%u2Q3Y2b+T,6+H(7(@-*- **(.,>?=#0C/;1$) 40Wb7TRYI$<,B-'X>\>R 0c0**dOkMLMiKJNiLKPkNM//c))d 0````````/++ / /++//++!/!/'+'+-/-/3+3+9/9/?+?+E/E/K+K+Q/Q/W+W+]/]0**<0</. +@/+@/"+(@/.+4@/:+@@/F+L@.R/X+^@ NmMsMyLLLLKKKNnMtMzLLLLKKKMMMNNNNOzPnOtQkPxP~OONN:?:?/0011P PQwRvRteten`kYj?j?;;knqq"v&w(0Mk\k4hKAA4ZK!{qokhgd fjkom9'8 8:: 9%8&95:<9C7G8N7S9]8a8g6k3j1m,l*j'i%m$u&w&}$$'*.68EIJNMLOxQxRwStWwZt[v]s_t`xcwetlvrrytrosnlhb[SLIJJ}OwNuRpMlMjNiQeRcO_R^OZRVKWITHSFQEP@R>P;R3P-SPP RRSjMҵٴeQeXdt^t_UXPWNaQau,l,(k(*upml}rcjJ9]S)k)]թyaqhoflgkkijgkflimkonopqtorqK ʴڑ'ٔЩv  w r kmuWPWmYn[m[S&l&v&XV'~rk?& xB~.AuBlEiLi$11SnRiQ[RPQIRGHH IIK!J'I2H@IKHZIdKi\mel IfDe=g9f7i2:kDiYRYmaU<) <ڜ "$@kt| xl f s xq g iv | ~j mwtkjlyyo53y4m3k/n0t/~->OA4 LJNBM:N0NQʲG ? =:; 2>"EJ!I%#Y@)9,$1=#*M D=*E'C.9Mj<jRG@;@:2AJ1+*;=4J;#9M$LA*13CNҹHQAS?UGTC:;@?$9-:1B,A0E=?AFI?P9PESBTrfp]qOoNm\neii.j\kOhZhcgjy`/yOxWuZu]w`ud~^W~OM'2KC\QOXyTxYvcoajUi[OF? =O O6C7@HI=RFGPBR?SOVUNUWUbPjKeEb;hDk]`grgcjPmQsZ}YVDrE|A{7v.u%t%on k KL NON*N3L*K7KDLPNFOQN]NfL^@@<>@MHDi?8i97j78=k> LLLLLL L&L,L2L8L>LDLJLPLVL\Lb9l`i8z8LcL]LWLQLKLEL?L9L3L-L'L!LLLL LNN NNNN!N'N-N3N9N?NENKNQNWN]NcOkO=m=s>y=:l:r;y;~>l>r?x?}PPmVmWqZremhmue{eaapp|yOWXNG"!)!%&',,t$s$n1n2mEm2m1l1WYsQOO \teninvf{fbb4Qkcabggegdcjpqz~ĹӛбUNJD@864.,$# !{wrokb[WUPK!M$J*H.G3I5L6K9E;BBCHALDLHPKQIUKWGZI[F`IeGkNmLqItLvV{YX[Ydkpy~~lbYWQJB=81*%jO I) [c4LI9JzC*%9Q~MxL} }; +JA*u2r4t;u=i=a<[>V@HBVE^DjEtGtjMrWuYsatbvhwltqvvu|x{|~||x~d~]}Y~EYd0~;uZQDk=\>d?kBjCgmz wq!b Z%Rsͤs's=1%FrFrGmJD:C,@btY"9F;CHGIRJ\IgJjHG)>s9h:^8T:J7S7^5g6n3o2qtighq~tgdkpvyqcpxutJ=|m}a|ZyYru,tqshvay_y\zevgulnqpiocrZqSmMoTpYn^lpfo-hjgah\fdenasfM&gYeQbM_N'aU__`h^q_g]c^U]MVKTUU_VeSYRKPmPeO\PVP`RiSm0r1d/]/S3L-R,Y._-g(i'c)[(V*O0K'N'S%Y#^"i$p&s$f%['U(]&f'k'ga>KW[c_ Q,M(P$^#f%p.Y/g/q7g>i@lHRDFFoEqWtQkT[TO_T^`fPghepoRpTqYnguh}\}i{pkjq|rxw0PsuaY]!n'^,`4VLYb_qnnMi{zty{c3fmquvtoih[J:gЕ"ZVOMOSW^xñ^tGuDwEF J*9wѤ7}5.+/zѴ*xٲ|3Y:3uJF>94*.nZ Urں"9KrUsR:C0ʱٱfJ`KJD.Hj$eMLIMYNKLkMaL_NgNmVhXhWRZK[XZbcVc`bjjPlYkeArCWDM=G^10DbQA^@U@`@f@fBbBh@jAU@O>YA[C]>]?a|m|m{X{V{{}} |O |F|K|e|u}}4S>E0020.-+*'%#" #()&$      #15:D         0< &#      z4I 9*3;! 9, ":, $3+ -4;:=:1(  22--    ;!! \!$)JB29=?DGOWXbefmt|!! !\j   ,(+,#&)$/$3(8$>"G'K+Q+\"a#h'j*n(u+|&%'*)&L9$#%#}#xs$q#o&k%i!d[ Y"Q!NHD#B#=!:"60 .%#!##&ѻ)'<"I%#% #"U ! /0/1/y1i1e/W1T1F4A6=76;/:*=&= ?=<=\,'1223}2{3g3b2U4L5G8=:8>-@B ABz5p7iG? ?Q?u610 ]][}[pY`VVRINDK>I>I>Q>QcDTKWTYZ\g`pbzbdees[67ĩ֓vQmReR`SYQXNUPNO %_^`^_M56:|CxIpKjMbN^PZPTOʱ #^\]]]\ ]^MMROaQ7]] QDU'YR['Z%] (ZRT2`>eHiTk^oiqzrrssvtvvvvmsivbvXqMoGk9g2b+a#_!`)c2c7g;kGlKqQrXr_vhwkxmt|wwwu*49@=EMPTOv1lujw_u]t[sYrQqImCk8g4d,b)^uڲ~ytq~wtote UMLG.yY2z9{;{<}P1J5<@NOHCB;863mf`ZUTo٢ЫҒܹɒɩ~wqw|wnanU]_beowzfbYQPKFFME?9622A@61/0-z.{7};}9=B~;| 3y Ruozxmgd\KH><9|B>R>VJ[S`acggofxihhgiig 68~;z@{AyDrEmIcKRM=OBّYIX YYXDCD-B6@@;G:M7\5_3j4q4}34332F@ABLBXA`?g>m=p9v9}6{6=RaB#aK_D_@];\7[3X6S1U,V-Y2[)Yz6y7w8s8n:g=PAFA8;<<:=6?2@-A&BCB [(Q+RD^M4 Qe*Z8a`<<==>>==<<;;::99:;??@??@;a P = #)t#ofblB*$I+l;pG{m|{zVvlS,.~B V.j$N { zWGGG΂PtTWME"0C(,1/=)E.77J2m8 ])(m.%*,M,ęQ˗Ha3g#Ef+g%g /l?r Ju Yzk~p"| ZG@+2@GhN&WanI"% mwIp&OmRwOBDF@IfOWkX ; 1:">" >+@,>"e8a:"j8L?gPqM|H\V>!E6V2[;11r2g1d18mM3<'?@ >@]]] ^LL`P"gkPtM{HƀAn9-b8Yfv6EAABGIBIQBab=r8i|6*P);""驲 ) +@*S#',+ +* !)& 'lln!l#m&llmk%k%jji$ihggS ۲b:! RRSSTQQP~`"'1"2}P1#h  g l#a ,b OJ $=b< J/ƹTBL<׺%N  |,wJ,j;>  := '/89;&,"?LGPST]Xi[w]^_``cb}at`g^_\RWITBQ?OV#[*^0a9fQKmUn`rktuuu ENMWVZ_^h`rb}b deEMMPVS_WhXrZ}\\^DLLPUS^VgXg`qZqb|\\^"X.^;eMk_pxsst rqxq_nMi;c.\#VQQ;dMj_oxrrsNP_VVRhWrY}[[]|uy!#2# 1=agI+a@("iAA "mY!Ta"B\-dHixze抖ɑ *嚇RV+5h35|."*-&9(E)X)A&). &#% (: !B F$/Y%.!.#")#&)12 ,9)B% E&Y*Y&"7)F,&j0G$cB :/ &/.g(h".#J J--*1G$8h6/f<0B/I.M0T-_+b)$h.o-iv0z+B*˄+%-C-,,93E. 74(55 356`6I87F`QcVg\fcjimslgl[gReNb3\c9_DbJf3\~jlli #-' I"f)-$*0 4;h?@I"jP+iT)%^$b%ag(@o*u,z*+}(j1'4)3,(5,xZ@YbI=| 6z W1M@7bPPO P3L>L>QDTMXW[mbzbeeyryawMqBm1g!__[!_l!m"m&lkl,)__]]$)*z#&yyyxlv zzBz,I( kbH,N s p. $N v x"x%yG,s2s;s=uM@wGxCn#ww wwxJym { %|('|% M#'E++D}H MV Z _ci"m o1@4=@>h&476W6 8 8X:W:LBAQD\Z\a\A]A]?\>\^^``_`E`E:7^A`@` ] a \A7:7887\>\FUE[R[PVE9I@@9?:?:G9M9NBB6*.0105[PPP[9LLL9[U\%\'TP\.I:IJJ9P@9mfff!p!4u3p!m~N34!}}xt!t:t?tUr?rVpApW<Or:rttcZ{{y wwpoklga@ecwvpp!p:q: #BA"g"9x91[b0@Y~zuzuoijbYG-0 ssr0q?n?nHkTf^aj[vTN  !!~ n5 1)% }љn١jm{2k{a>q:u9|7~67|8y9u:p;lo=sM?Q@ 7;7Wcss'q+q(|xnqve_  _bq0s/-7 79H9)] ?9B9O9X@ASE KD7<9T]-]GWN=E;NsDqEE_H_ 7 ] RC >o>u5v2x0v-x*v'u wyx xvwu>v>w5w>v0w*w"w(vw \P\[Y%V1R5PQG;N98H;C;=:H<05W1Y(\_a cdd[;VFRTLYIaGoBuAi;U EYGLKbFx?oAlBiCZIYEZ<[PR[LgT JbCY+ )(")5''')('~(u)#y!i 2#- +*!+5)u+0i*+)))|)4(*)*), .,+ ,5*u,~++,**+++ ,-3 1/0(/5.u.~-..-,},w-2- :i9887MKJGFGӪԲѳżHt@s@s|? >=<;99:989:}>GI~RH~I$BA?=yI@ @B~J5O 5N.M+L5IAFJDIF4KH;ACE{/3=CNOS[^`d}a{bvktlqjkojnjo@tA29DM}T}Zz[w_ycvesirjprdHBprpsvsqs{qssqvoslslvivfvdx_zZ{[}W|kʱomoozpuoppjrAZa2J!! yz{"x0y1x3z9x5x/x+xxyyxhtnrbx`ypZ|Y{"J&-5@GNQ~UZ~a\yV}G~xvwtpqlkcYK<-AYa !$;`"Q!:J>FGJQ\Tw\⺒©FB:5!Һ P19AJ` !%A9Q:;QiK1Z`8>4 <B@EDHGLJOQ,U,X+[: <A CH JT Q VZ KPKRKSW@[[! feL#K#K(L(L,K,K0L0P#`P4[3P0[/P,I`P'W'a2o1o-a.a*o)o%a%9H9 H!9$H%9(H*9,H.90H294H6a7ai5ad6k7M9[;T8 d; h: n9z6_gckgoktoys}w{sb>b?f=f>j<4 (3=ID91' jb,GP]g[Pfy\}VKph^wXB$P;Nlb!p_#+Q 2IV#Y=)S1:IL+\IT_q_3P+id1;B:-ãkmL@jGy;C:`+ \o;,>SLNSK=PRI  &0" '!1 "E+    *4"y#"x w%$@#&@!h%&!22I0"/1|0m50I/2"34O552" G ?"JJG hf + 1#|#$y$#i'$B"˝" ^[(W4R> = ]Z(V4Q;:9FJOwSnXd]VdFk.pr\Y(U4P:98GJPwTnYd^VeFl.qsgbhkjo[kLp#Ur"om&m5gCdI_P^HaAf1i!mnnB]:`.c<_;k/mX`PbP\9S[;IaWjUoQdVaQkNoKcPKXVUuJ|GwH~MvOECCEK9ch%Yo%ͱTs?@u)2It"#`fOiouDz@f}k|ę |"{}+r~l"v}~"{]8"#8>J\jubte|IM,0 nqqirq s yqrrVQF> H>K!)R1Z3+ -&!ٰkq)mptnzoYmj;#mY}ark1GgDg[f\fCiBiZy=yR{={Qx>xRpAjXjVo@rBlYgYbEaJe[e\d[aMu?yPxRuFuHwR<|N|L~<}P~N?|P }O>zQxPuBuEq@kYjYjZlWoIhCh[aFeVeXaGfW yPDBDSETECGCGSOOOEPEPPRORG[J EQ@G<@CT>H>IBT;D HPLDKDHNNEIS;@?GDU?HAKDSFTFCHSMDNDQPQE( *+) )+200/,/4.{(***.w.(-.)   %$0" *UPgNg*V)VNh"X=mXYe@l^@_D^G\G[DXGWESFWCW;Z-Z)X'X$Z&\$\Z],m ę et śRś ^!H Nmk m n^/UE>;9@:/:+;:<A>=:745?CFHLQRPNQ R QMPQPJFB><:<BGJM=CIIGN * " F P H "CRk(B1E:D?EACB?A:?:>>?CF9>B3A#@A?շ K IA:׳4?@<?B<;CFH@BG MIBCD;=?BL@>L NEN3"!       "%&*+.0;ʶ $0 (-0/,0+  $%$."/ ,/,! $%.  "     $$C="L$J$9 18;;9;96&  4J 2 '  ": aR?Q8S"R#V#[!_)`-_P_`^c\cWaR._@^O_!R$[-\FZ`[bY/WN]!XJ8C:CDQGUCU:J8C:Q=T:M:MA Q &.7?KR [fv{ wmok_SH>5+)(% *:@grk "Y)3iJcI2P9rRsnh_RF %,JN`u &0& (''(%(;&Q(X(c(j({**+*#!Y"" !-,,,Q%..0@0H2U1X1a207ҙ6;x> x>p=g<`;V<B97809+8%978 9: 046y9l;d;n.W5O6,777 785u4e2Qn/j4f3p4u5~61`BPT93YII#lL0ITYS05z>ib;S?A99:7- ./0 323 2+3.2-1@ERAHJIOJVIYG><|=$0KHGRHV?U299+:?:; - 58B;9m3i8e7V:q81l2h4c6U818&8 89u<6s7n4j9p9m5q9g9V; k:`:o3t3`1922343y7n8( *))a%*=)R*Y+b+k*s,--554i0a0X0L0F/(.,'(()e),65d1K12/( )***`%+B*Y,b,j+s-..4431|134{4z2o1h/a/X/4-<.3*T+M/s2z542 ++*,g-2 @CEhJf jhk.m2k7n?jDkFiUhZlglpitkijlI'H-J2JPN-NE=O?OCR?* T=F?NAS@R:й #&     #[#k(B*.'##A.GDkQJIMQJU3ZЬXWX[WV] ]6+-͵V] aeZ $ZK^a c k4L3Ke0R"L"\Z%9ca%^,^3]<[A\DYDY=[4[-])]&+288,'"#$!", +!"'+  38 >CP#q{"' 9DQ #r|4@","3"E($+$ % "3 42 ;3R3D2""4 47@&@h!&|#s#kIf""o#K"G%m=#/45HO7LDNDSO@VLf^PjVksV{Z nYX"G+GG"HD"AA~@y@h>b?FPʛgbvehcb``_hI`,OaIdnAg:d3c*iC_deVTXC`FgK# 3nQ-d̆fqGVI=a$iwnBasC͐;>"CFJHGGbjC 0 1 1O(1J?gE$49Q )|,rCˌɈ##D39@C P#r|' 6x:Q7A7$ZP-ZQ2[զG<9 B6?@ I;CE*<J  DD )@K  MKN !T W!\@<??#d&) 1BNUvĆInx%bR";"Fa- HYbed!c'i 2e*=`EfObZh+cehobwjdDebOg@|WoSgYaWO=O8Hk1QLGL+M#B{C63@2`L4"$4d5D46#. i"* F'&j1$H#W%cZ!gl$v&/wg&h č&)J J:'GI1h0/f+>'-(T)I(t*,j)5.F/U0(,466e1f1+)kY- uj oA#{no#quxv}w|x6eSyCsC$Qk1Xy5Bg{3Q#`v:s2ҢB-p-w;R0(|,Kw[v#xDn#J|5@SB %-3>FNQ{]}gzs{x}mc`uC&#q"mp4@vtv6tCqMs[seutr}sP|NRV]rL# o np`rI#r-+t1v';sBrIMqfTp-\sjsrt}rͅqhpĒsIuji%~~a|~@spg}+d}j]UI(A6,# ~ }~>/vMRT X[^P{J{D}0n+ @Dev~yzDzzz{8#/~%O*RV*ovnmkdpXp+Jl6qm#oR R QQDCDQGSEaEoI{JMPU[_P `c_c]^8] `9a9dOdO`4 {{}w}|y}wssrronlkhjolqqsvquGC[YYֻCNVWZ_addf c%`)`/d*c1e6a<^BbD`IcMeHhFjHlAl=qBo8s4r.t.u*x0}.~3z;|CzILLF??DFLKHD>853/-)&%)./)+&*& p@oAoHlTl\m]mnj|i}hjihnpttrsuywnvjxc}[WLL|YzZv`t]uQvFyDz?ys@sJtSx^9*ūwH&@C2y6yFuCpCmAlHmLa1c,MOpL (:C~OwXyY}]{`E* T;J3P) T37 U Q 0% @; `?;G;DIARVD\7X;SGJC864>9E3 FAFIDIG<@<@ICIc\cNlQ xRnF\J>GT`O]H^BT9Rɢ/S#+X#W$\\LKaagjhjgifgefddccbageljyjSebc`4H8PIY :2  #.) ?W  A4D$i:!9&1Q1($ "')/1'"$#* +* )(*0*2)5343!2`+121&#'8"4.3*:f~LN^XaceR_j`w]}d, -,!+A%,-,2+ - .-!,a'-2,4 223 3+ ,&+2* 32 22!1@0"/A<@E >QWU[Z`_ecGgt4t{yg~W\afwu/s:sIvBq7! &29<9- OP OS rHpRq]phqxnmnpqpr|tisct`s[sRubvosys}lknyoonco[mRmqijljkf^gj^"xe"zbU|_3#)r#-q:jIgPnlVs`qgrB]hWfIOd9a1b(gq rqz,|"} &.04v$FrNQu F} :};u@kG;CPYMDAC1+3A^MJ]zmV{ {s%}{y{Md{bi@btt&rE6n+BtLp Ym.i )l 3gM|+". 84@63@:hJ&NX^II"m I'OgbDd@?Zf.[7k:"#4 .39"D+7'" %"&$#$&.&(' "&'%#"'b-#)'I;,78n7&5/3"4b fibjC`bg6Y@^D\!dn-]f #G#Ia ia(Lfbbfb[S egxO|Jugv^NK)I[,LZCZW[V:#?d?A HFLDIMVI[n9%42"/"42;D:>-CHR_ZeaUY fbB\g>i3g-g6j;k2p-l3h>dEj@l4p3f8`?f;`AbIM9o=h'j#Ro(e*d'j$qr&z+n#~=.>~G|H>:78:@;4Ӫ2/2,,}&}-z','~%$-%'{'v$j g$V6Klci`Xdhiimwnji l jg`Z ZX Y`gje_ Z] bfi c ` Yg_XOJGJJQT[PQZUbOWSOoq w~w usw}uwqtp}~z{F!!~xroQ%' #    } #* +hzD  O@rllaex#|k$9+9#BE5=`l+e/fddDn c]a!.`$i^'a!_Fdjdb!^*c[0`0c-Z /U +) *( ** -, /2695/)%$"         LNUZTSLIUOLDL?UJUEL:U?K7:73*3%8.4!65$6539<416;8DLOBOKIKDL?K;@;U>@X903"2 345F?@?@DCI;IAOZ>P\9 `9 c4WC^CVH_HVMbMVRcRVWcWV\c\u[0vV vQPvL{LlQnG7Q8I8MPQ8S9Q 9#P$9(O(9,N,U3:0L0T9Q)UT&Tbsk\]c[WSKaX|U[S[NVJRLFKFD@=:751+C=CHD@DEC< A;@{w|gVE@EE$V%VUVkLk\#BbkIh`\_Tht>.H.,B+;% F&.L"?!$:ND N G=;G; G O RMT+S.CO0O6T3Y' VZJXmN G(@%8EMPĂ]ˊ^[SQEV+<@ LR ˊ" @@h&퇣I"ql28m4@I8?5L2HO.A-E+?D-<@-Df.B+Jk1M'HHG GK"KPJJ"(w 1|<"Ct+Qr^u"coTj"Bl4h'ovrz#x,,9ZCb}pz{Igz,jqJcn+dH R~RoPoOmPklnRokqcqc~ere~TpT~xnmpwqw~y~yroxpxp xonxrx~dqd~SpS~QlYmlolplpjpSnPnQmQmgoPmPmSpdqxr`*_*WNWU`^`^]t]u\w\x]{]|\]]Nhttpnmhh hz~4D 7 !!#'*&)(+-0,+--372..3/240.3,-*-)+)Ɨ. +/.020%(%&' B ;4d ],q,,+y (Ybjosq}r~txz}}{Z apt&rz}&4qzMٱPZ1I:@GHJN1S7gѻi{k0k,[{[{h2h{h{jtjmaen )44`4d)d)) 10(667KLdd(d+dZd+YXIXI5959X*X5K:9IIH5DJ5b1IY9Y8ZKYQ%:Z:5H5HZ;ZJ>J9a9b4c1 )W8W8R$R5LM8M8HHC8C8>>989b   d d778JKd `5555$5-555>5F5O5X5`555%5.565?5G5P5Y5b05LMeeZfZfNNMg%pg b`QO ]imm:gXkAk!j$jFg&_,m?is>z?}@~Cl(i+ij3?:uvz||} ~   !<      $")( & il 26>  1 ;  $-26}:9<9;7,& ܒ   4"q = ! s      B? @F>S+J@~>y>s~? :0  Ios x ytp.  !$##uo!n! RIny{}!x r~.--,u(n() *+$$t$*qC -P ,+n*u*-/0333~2z1p-/ 01,+*r)~,{+x*.|2x1v01|/-.GV=V?TAWsnf_ysmt{zWG=M@SBYF`HfKmNv!Q$U(X+[._1b+b+a..1`1g!ngmg^gKg9gZa _6_g`g`:8AB6-:-\.].8G7GgFgF:8>66C-: /6/^F:H6Hf_6_?`<`:a8a7af6/6H6 $,s g--g4j*j2g=gDj8j?gM=TETEQg@\9g:\3g6\2\}}xha_\ZVSPMKGEA?;:45/0  (/5= < 3 . #  #03688/+&x\xgu\tgq\pgm\kgh\fgc\^`[\Wg+~" >+++>Z"q#y#B{ '""&%'&I*,(XY `kKk &$ 3+"qL"6wxwz {y} | =&&%t!$ "t"I!%')y$}'o$#ˈ*,++ 6.99$5Ns2 p0 CCBG@ΝGyKpMI4"885m>I7MkRpWCyT~\ZZZSJemf (%MIQV6囤E-+0- /- ! &&&") *#@ @#h&&E#1pb/y6xI?o,Fv>ynLyPq[ocoXwb|krspxyuCmrgkƗinvƞn}-{̗vyf{oHmGIaiKPaMU6b__XbvVbpP|J DEFOZ13)A)J¤KRSR )QɚAxh       /P 4;;AAGGMMSSZZ__wlglpmYlOlDl9l=m/l0# _R+LhZkzD Os@ h)c ^aSGGk ? ub]+#x.`)22/@-dJ1DS-^-%+j.i"p3qqwppoowrXrZpCpCr=rorzsntctTsHs;s1r-p;qArFqUq^rrqtrlrqp,,%:?RE17E]][+[,Z-[:[#7'5*1(*+#&%'*)&̹$*#:D%#"#',$.#0&4%6!;D F"N!QW[#]#b!e"io qz#~##&Q;!)'c"V%#%#"J !  /0/1/&161:/H1K1Y4^6b7i;p:u=y=?=<=C,'1223"2$383=2J4S5X8b:g>r@BAB%5Ci/76<:;==@X??N?*6106@17D)5TV C)Q2R:R?SFQNSc\j[z_`^`^_50A6:#C'I/K5M=NAPEPMQYSbVgYpXz[\[\]TTMR>Q7HQ 68!;%@$A&D-E2I2=/9)9"6$6%6&7(8,81:8=OAYA8<%E9E4I5Q6T7V8Y9]:a;c>= = <<;;::99:;? ?@??@;a"P = "ȃ0Cw,n/b)Z.77J2m8 B)(2.% *,M,>">+@s>":8>:"58S?8P.M#H\I>)YU#bYnZt\|]lB!Z6"USBmYI2D;11-281;182Ml@]]]^?P_WZTRSfZp[x\h;]7V4B11 1321MRIQ\"g4P+M$HAn9-=8Ff)6ZA^BGVBINBa==-8i#6Щ0i)2 ӣaxsttu~vy xl,@* # #ln~l|myllmkzkzjji{ihgg S [22⺡ RRS STQ QP!:A9 ʯF9+̼FW:  #4(ʬ31Y        ' / 8 9 ; , "wv|z~|i$I }m` T91Z;.}*r&f(Z)G)^&). &|%(e !] Y$/F%q!q#})|&)1$,f)]% Z&F*F&"h)Fs&j0X$c] ep &/.g(h"Č.#J Jr-u1G{8hi/fc0]/V.R0K-@+=)$7.0-i)0%+B*+%-C-,,93E.Ö7ț4(5΋5 35Ŏ6`6Ig7 #-'I}fv-{uo kdh`_I"jO+iK)%A$=%a8(@0**,%*+"(jn'k)l,(j,hYgjhk'm0k;rFpJpGmiMl]peoqq|rsrsrs|||}{zzuwmxivhu\xRwH{EyB{?yS#SZ4]_-ʺ IIBP*9bR!!&()4 F ',/_3ZS;V^fipv|~~~~}zyP) s"iajvvttlsht]w\uTtPuKtCv?w>xJoG8Jwnvji lmpljk!np$o(p-n1n6r;sMqKpInISbXr`qiqzstt}~}}vwsykzhwexhv]x!_yX{QzI}E{A|={>yS4AY1[]^/.^]\ZXTSs~svrtxmyfpXpNmJm\yWzG{EzC{@{?zFq?r:r7qjh"yt~~}<|6,(#:t/y+w$w#}mѴj~y pɜl0op:!A%,026ARPK:RR{C`]{BCsRqLr2ar1Zs2Ao{"BY2vyzslgr!Aѳ>}08?B~F}YRJE18;6ѹ\ULGG/!#Q]Q# I PWAG60*)|Mz}C x{2u;yKOJ[~mj| ?(7%$#My|$.7=EC+H3u -r%s o pn|" z RW@fyx|@P~hI&HQCI6"~ "m"VI0^BbN_OafnczbDe@ffrwk{ėz ouGw"Wv+`i"v悊"᚟|icas)b I*,n nIgYkFY9WC#SIgAFR]_n ^-%gQ Kf efZZWxiiuR{y{{qrqyqppFo>xBY*1gi hQig,k4mR#G+[I4baDdQ`i`dhiag͖hfkb]bbd uxOJg$) ,C b`X#N Q W LW#c@WMXI.Tn8RO!y"yif#iPPhG?C.C.K"K"ML TSUylnlk{ksxs^x\gZNR8O/L$pIv"懃moIf`OwDo@mftmolkgkĈy x#c"i+mp"w怄"vvvʜpxsknkdnmbmm4~Y~Y_Y~_nZ_ H9)"Z,;AJ-'2ec"c'f+h(j-l-m)p)q%su vy{|zxz y} }~  y  rjlmon r poruvyf__\aq Rlx^ ``^?]M_Y]`\pZuXx^w`uavdyjzmxlwiwgjfigJe>f,db` X 5 % :[b e4c,e b9 .        ,1@EMW_`[`a%  $2'   6BEU6&J%MǠšՖj stv y}_RKJC>}n7q-o&p%s"rtw{|$'06=DHIjkh!k#j%g-g1h4d3`1`,Z(W WX@NйI*A;"(2i11)#*#21)"T"URS"6I'a+y=oWٺT TUkIj i j]\OPW[lRnLjDk?mZMUM PL MMGN7B:AA@E@FAAABHOICCNCWL[[lrYB;76+3%4 7 6 32/ . -53648675L""R(OPQUTSS'Ab CAA$C&Iw! ?lC\BYDS+i[M , :56KUEtY977:34<@G@OAMEIAT"6ZT}<*%!*+#5#:'@$Vf@|f=9-b,0M: \3i]<01ԤǗGRR-Z4^,W1^ =X,wA r.,.02LMOQZ08  ɲ( * # c2a"MI&  !"&%(''(  $ '$#&& ) (()0 )* -*++*@*0 +0+0-2-$626%;7;'@7 @6I6@6C9H9P6 R6R.R?P9 YK"[M[4.'`4'12<*BCF5F%\8-]2X9=$8*5(*'&!'()A8B9D:P:EH!J"F%B%B5B#0+ED]<^5E7Q7P<vPvi{o{TvPnJnai[iFnJ\,}g`*\fAQ2Q&R!T#  )    lQy\W<2- 2, D,}PPh38==BBGGLLQQVV[[``eejjoottyygaQV[LGB=83.@) {g]whZYgC^{WvSnLiHiKiOiSiWven\v`nXv[vWnPc{[h{`{dl{irSf ]8 0^2d3d)a,b bd   /DT^I0!!+29IX^()!3\v^l`V_Ga-c4b:bCcWao`t^v`nexbsckdUd7eLfTfYeefqhwixftemM#K,L2IEGGI>M&N.M;KD"),>#287:3@=;l(B%?>B=?I ???0C.8E=*D.H,4F9I 4L.-M'L$&RN,P 1P 6R":,B5<2`G2 G5 H/H,G)I&B&B)B,B/H#@#D /*/-00#OXZ@[USXXaa\]Zgkmkoutwx{oz+c|# ]dNxRz`UwT?FD7E8G7H8P7Q8E:P:CC!"),'($"&+!,./-13356;?@ ?DA"'((",/@" . :%%""#!&")$7&M#m"o ) !X&9_#+<:o C'5:~}"$"3 1 cY t jM40"eJ!;Rsu v*t.sGrJqNpOmSsRwOuSqVtWwTzQ~S|P|?{;|-}%|| nfr2uwy{zuszjeorh#.J}urpomkfkir*;`< 35(53509)9*B`*F@,1;C.7/3.2071A2I1F.D.7 < :)-F0'8" F+G-::1927>1D1,b%oaPuQw8!;M* %# 2A) E k 15 R@DIYNUZ\e$j$p!s)Q++ɒ+*#/+"!I59Pi2iIoZXI8? D;HFNѪ8P:S[gUL7 7T FILO=E-,)3#-41DY6C>D?G$w"#hk_oLVGAY1i9oBZCSC2,?,D- ESO5V6`;j;r<|;A<;;a! :&G%, /5-66ZD}B'2*:)?*D*P+T,Y-`1h3s5}433234G-DRP3W5\7`:g:n;@~;::::;;_:]9[8Z7X6T5P4N3L2J1I0X,[-g2l3s43236*`F+N,S-Y/a3m5s6|64445H-S2QRBRc9l:Q,V-Y.[/]0_1a2e3j4p5}5a9_8V4R3O2M1K0J/ ;+H,87m '5ZcmC_E<"Ln$&#*,0>*# %) "  %'4   m (.aPQT\3]8?;< 6 /:=?C5QI KLB 2*` ^]aacd g hi gg dq uww{= 3#%g.  _ FneO-jX~YSfPWoZGkVIlLadS`NieWeLaeb fhmu ubkbnq p m`O-`Jugx[aUpKB A#&)%4'>(F'N(Y'b(e)i*k&g%c%T$C"6#1%E$X#e!iz{&z/y@zOwOvGw3y$xv!w(u0tGsMqQtMtJ 9 ?< C?BDFCJ P[G) POK L HGD D @@< <8 951P.0%0'++Z0++1[")J #M$S!X)^'ld(h.p$Bp--I$(.<%3% WQ,K,N 1K.5G;G$8LN86 <9 B7H9N:GS:Z>c>p>MpE~>C>DG??JJKmT L(>%4Q0VMUW#jduca_Ecn+ox}n uf w t"q @!f\)m],r]Cv^˂\ɈNKI#mHdjKbJ ]KZM^_`__I _n _%_u"v" ww"wx@h& {\I]$"$m%I09EON\Dc@SfA},~k(4 DqTm"\d+Md?Z"7]Cg"9wHH"CIEDKCRGDQ>SBAF@;@5>b.>>I2B,OvInRXE91g^yVabbC -C*C BB/6,6)66 8 40- 0,+*)'&%% P "P M#U'-]&Hd+l+r%e*,5$ !* + hz {DltO@}u~sayktoc+X#g|irmim`etnxsduhDlgic{a].JiJE>F@jGFQcY?q@b?/Z=gT:hM8E:G5J=5J644EG:Hh9Of3P.P-X3WV]]$Z]iUSBS M%JCU W,D`W*I=I:J:T;HD.D+G+IHIdIIdDDGdGHG,GH=E=7=4@4AHAH@5@>4 d@@AdAe=g==56.9(<#@!B3??103'3"34 333)<. - ")!u+),i 0Y%) : ,* 5#A$#:12*ʝI- )ʡB32  -!K *#!0< 9 312*/#¹1#21#2%.&-%'$ ! !'/"8AGLLNLM F#Vn&'&1':$;";#8$*(22' ( 8983+?%@1B,8(7191:,?5A2A<.'.//0-1+0,'?-c-6-/-*-#.. /00 1-)*%.9,@$@)A-@6@?>5k>lFEF(90%=ٺ9"8 ;<;766 51@ 3321*/1PI{vsmfe_USEGEB<=7239db cc#e)d/g1l.n1p7q9t3w%yx vwz }z|HS꒙@REJ?:8c0 e:"2;9EM?;d;2*000*::t]H9H {smf_YY\^w_f_fSdiJhgbniZsgRxiggbiJg~_IA9" #^R?@@ @A?MaYQNQ5`66"5'545 C2@10=7::8;7?/6/(/#00 12277<61#1(22250;0>8+768?9we ba663C442211`10c4c633c3c555CEC5 44* $ vEU&vd)d8i+C+O&_$c+,#%*%""//c/~dʲO#&(3#4$H&F'N$_} ˳fN:3 "$2N!O"]_aO~..c.<.3.(.// 01 ob WPPO82 ut>l>cPIPIMcMcJIJIGcGcDIDIAcAc>I>J;b;b?b@bEbFbKbLJOJNJIJHJCJBJ=cRIRIScScQN: =Q1Q:S:S/V*V;Y;Y,[0[;^;^5/F0E3E2F5F6E9E8F;FFAFBEDECFGFHEFEEFeEeFhEiFlEmFpEqFsEuFtFxEyF{E|FEEFEFEFEEFFEFFEEFEF9999999999}5}6}55u5m5g9e9@9>9<9:9899>8?;?<>?>>?A?B>E>D?H>G?e>f?i?l?t?r?o?x?|?{?>?>?>?>>?>?>??>?>>;;99775 `1< F;F2H2H6G3G9842:2;->(B1@2@7C?BDC-B%D%@"ChBrCvB}CBCBB44,4454#&&((~-~/~6~8~:~<|<{<|:y$p$I0H.E2B40E6B80E:B<0I2s"2|zzxvvxtupwlxitgwe{b~_\shttojrrruhhdi&fogwh~}lzjj7qA$EY]^^]P@F&LZ]B H W ^_ANT Y\FF ^ Kn~qlglk}#)dv#pszm}{ဌlƉ}qBCJIVVLD_x{{{M}sxCpylygyc~`^J~qm m(qk%gl FM \[ivigtxuthgge,dr| t.rr$N [D EG \|6{6{8000{0y0w0s0q0o0k/l;j9 l7o-0v-0j5 h+QRCh:j,j*h<0 `-%B;! $ %(##/(/0 /49:<0eL!# "   + ,5-=-=/5/5.<.ri h"o!f$`d&al(@t(0{(P--//1I)@K,9L.P,Q,O/L2K5S)U&V')(+)*(*1"#9190#;" "2 u "n-;"Y*"ʶ1,)# " *<«A3,CA>?=;=#AA!DC6!7)5!,%A-4+ #%#$j+ga,o&v2rky xzr+L#T\fr`}ʑd{DY9Af.higdqFojac#bc'b,e3l7q/9wg0yh(z"z{J~J |G2h4f;?FKVB˕CIpSe,ocR:(&  $`*I-\qIfwj"z[ɅY͓WhQĊNIyPjiNi^Z%L\@ca7Z@-Z9K.P+#U&J I-B7+7,7?EVlSLy "6n+ #D/}* GF%N1L8R@KiUVjfSfhKhvN€PcMN&MϙVʈ^)4=m3*.*b+`$$#$+5FVfkj`SA5*@ a h l ed$2%+-&,,:&A+% 06$"$)/ljNnn mXYHl@ (=@> ? C"-+ &#/$%A# ',"e: 7(7 8.:.60<06.! =.  lPAmlj jkkZ]Z"_aTT"_U^T_U` U _T`~~wwqqii^4Tk'e:19}     $&),9<72%s4*A@ $7,2:G M N M U Zbco  &/7C E D >94.&*:CDA'&%.#+"/%4"2!,2$ϗ; 3 0 31!2:>..6 -"3D"&%+#2@ []`de g hmomop rstwxy z {}~   #:"'% -- j v4ywPu[tgqltlvhxl~mk~gZTP&!x#1?HU[aegj!lmjjpsrkkhkm l ijgbaYPA>; tZ#J),:|9~ws$z$3?rD#:I+! $J;")X',[ \ZXVY"["]$\+`$c)d$h'i!k l'#(&I$ K * d"]("%)$e&cGaG]H\G]F_Ba'1GJJKIJIF:+)5;<=;=+_']:_:F,E;A@@?BA @?A?@I PD C=@A = @ 034A4B232F4M6Q:Q?2SDF!YK^W`]_b94RT\!V`1bn1#REeTmCXu]~a`U"gQlpVY]_gnrw{LHj@lB:AK1RP3H4G2C289<>@?=;:G:<2rDlItKeHe:\9obL3?=.ikaqK0aCU4]4e5w45 65594G0C0:1C1(0!;k `L36B6F7!R;UBT[!3W^cr4EP$Rbgoڼ|мͻJ~Km )3Hiɔ@p>|<51tղ( 8^7W ?FLE%34bLG:/E':B@D?F8M1P2>Gh99779T -RMoEfFnXoX_W\5d@9d@e>g@i>q.w^aVcC2 gs*!SEВ21AI;H*~9z&-=jkxp{q}[a+*>6=73736=6)6 )2'4 919!/1K/&9&7*2*:(<%$09)1 0-;%4)&.$/2027&0&8&8-6#7 9;%120:*1&0:1);+5 8)5-3"8-21!PH&l & [#) S "Rk"KH" L'ZJ0!f(RiIw(V*A-'+G+i.1//O BYn$1w&w'p(g'Z#W"R#O!<$:!S"m02p"w$SA/(/G/N/j34533 34:B 95Wq M #    ' #% ,!"%+#)#,)*-"*)&"3údZ4- 56.)!%    '*    ?$.?? B'D$BEGGKPNKLO M RS ONOJ JD@>M3#FD GEGKF^a d `bf k gfimr vu x  #j%ݱ3$LbT:ѻ#c]oMtw|yyyx˕w—qFoAf+ab^ ^o^`r]l_f`Db_k"jpXhK"ah)c/c 'y |}} w xm A $(O,h17bk  a`` hYEDgF*_KeKuJfMCL#I Nˍ:?DiN1kL'oog"X9?<{z%{4yAxYuf~}%'-3}J~W|c}hk}kzfxgz\|8~0}'*>FHI< N;QTaew o{~9EOd KL :AP[eiidV>IW^d<c0bDaF^G, a21:8+ _9_08H5H1H.H+G'G*&E!G* EG*GE&?'>#?$>!?">)?*>,?->/?0>/>1@2?5@6?8@9?<@=??3<393(3.C(B"C B8D>C A#DTLKZWRJT|ON[-8|Lr-2?]`9TDKQQQ^g^m]Aq]\g^A\`Śabqx{yB{ bJg*%e o/j O@LND!@C?)"( $y{&_t\rL&{}!~{/ y!_'^c+aC0`@'C!n o`LfLmHlDgCtGqIJPP'O*GE*8P;*6P;+4@&6&4 5)!2 ;9@ 7 5 3"MBL=EDJDQAN;J8AF?RF^UUYlcnB><58*|*}R)V+X(j.o-t,N*@+ "b2P+TD'Y$Q \a2_5THS L X)^ -c)y){b d ).O1|'AD}AuFhOrGLnNVOl:m4Bd[hdC\ecdz]vctX_ih^n[uVtQjPbK_QnF`t?q8ng<,8kQUKObCC>/'.L,\嘀Jv+g"ua@ƃÙ6:T76+633+33 8@9?9?=== 9= 5= 1= /< +< '< #< !9#9%9'9)9+9-9/91:3:5:7:9:;:=:?:78>&,:2&V5Yk6l?o>q?r>u?s6p7o6l7m>m8n=n7o=o7p>p8q>q8r=r7t>s=P6j8"m7p7'R2T1rlzl}mkzjsk}k llrsm ljj kk4& E-, ;4*, / $    !#%&1((* .2 7:<?CCGJM ORTVY\^_ccee'g.i2h7j9kFjSkciqgze{e~cd_^^[XVWVSRQQQONMLJHCA=95/+(#!x|| } wtmfbSLIo:nGmPmRnjqfp[rXqGq@p3y+x8u;tHuXubvdwgxhzf{h{k}miknklefaa_bbfg--$"$--+y$&(*-17:BEJQx@z&PRS$T(UDV=W,VXZ\%'$="`O\_TU&V4^`WV( ST#U1!+[ ,.;>DJ W^_ `ef 3:*@+CU >ADFHM : IMM)K0K6MGNWQ_PbQeOfL8MGKQKVMYL^MbObO_LQKL#J0J7IGGKESFZF`LaIYL(K.L9'T!0;HMTXYZYVY!I#Y*Y,[5_;`D`E_OgaUhdmhlild]>J '$&$&}-z8x@wRxazdze'&3.)%~'pJ|3L!C4#7HPVUX}[{Yy[5ô<~HHMPSTOU* zN{FzA}8436zUyR(,5DSX]_]^}]y\{[_B^`бQbcdefg~h~i|i|k |W|a ai~jgba abTfgi)j/p6s9x=xA{K}SXXWPNJHEA??A@N¢ ABJZaQae#g+i:o4p4q6r;s8t9wCw>xGzS}Y[[XO³APBYF`CEZ@yR~N}J|G{3n8s&ifeZcdU !aP'Y(W)G+1*F)O*W,[*Y(Y)X)R*X,+'ALB=E)E6S5<4.#X ;/\-F-9gle\dGfldmekdMb4``&b4c8dAZj[T\'[jQ9S\ThR>`S6/(6]^V9X]\TL,3?HzU 1y> c @--*0 ;. 4Ec3>2D+1= J R Y _L Ӵ>"ACG JKK J J I I H DC.+FDF̛ :=">=< ; 9 ;<=< =< ; ;: ?? >:6_7K526!6?8G:V9`8E8``l_R_kD-acTEd 1i# (|*z0$/ w:vAuNpZoIweAU+AZ"Y3 Y M!X"!#"$P9 Ұ{*YN.OZH`GSJEHUJa-I-T1:HUXV^+ 5XP1)'&44|=|F}N~STio$n+q0z8}?FJOSK>=?P1K5F i n vvtp1[5F0&"I$WbVb[` LCUgOWdJW]gXXYTXNXI)ZD,Y?CZ:Z4Y.Y([##\d[gj gcf]gVfPeJeDc>Ic9na2%a.a'">"=<<; E C -BH@A?ɓ< B*GNUW+\NVD\zQO*?@)D(G)Pa(S(V+Wk*V8> G+ P# V$F`#?!9 1d)D  . i!+/(F9jAH!Qc!S!XR@/:g4h.$ J:)J=0<5G=@h>?9; ==/~&wC w^ ~){0vFoTnpdxd^Mc JbHaIiFa[(Z,\0^[kZuZkdndwengmgrTi?a8a8j["Z4`6``m)G#B;1l'B&5_3(5)4869C8H9S9]6^E6W+6"5 4L4V 4B 4<5-5$"7N 7S<^@>]>W@?Qh3D&4>413&I6."7B8O9Xm:VIW_ QOZb @DN@ Vf84tVs l _ O :1/( )-|R@7 .1,/-G'qxxfT,6H\l+". /0.I.-lklOpynmvysz~yz!#F g!q wR!LG9 2 $%A"i#"gf&i[jijg'vh!T!C3}96|7::77433220023}ax_y^\\\%^_0.dffcbxe)Z*Y(M+M(=.<,0/0,6a0K##Q"^"i&Z)+q.EQDIDBFY=S>O@MBNCPCQEQ3V K:#SQHTBQ BUBXBPNNL:TRRUHH<-<5  4b  aM+MZ*Z<.N\i( ",6=C-9ENS_x}1ܣ*{y{%|2zN|e||xz~|}x +)00% }~}<N~j1Kdv/@?N@9AKA>BECUECFUHGJTKKJ=R?x=AZB@4/2^3|400o/Y107.5p6{:7i9Q:.;[:n;{98;01/.56a|ae^92&&O'N'ttBuBu&N  sB  %P%sDs uEtFuJtKuQtRuYtZuatbuitjuqtruzt{ututututut'P&Q'W&X'^&_'c&d'j&k'q&r'z&{'&'&'&'&'&'&uAu@t?s?&N&L'K&M4h44/u/u4>4>////44##nneef$  !%).28<@EJOUZ_ejquz  =Q0QvQQv# #  "ee^^``bb$*$ ii'-& " #,s,s..-/StSt/sSsUUSVYuYtV@,-,-.@.@-?0?S.S./-S-U@U@S?V>Y/Y.Vrtrtrrpspsrssut-t-?-.->////R>R>/u/uRR/u/ususvs>VuVyqx*_ $Fc'g% !T9T)a5]o6oZZT,TATrTTTNNsN@N-NNH-H@HsHHHBBsB@B-BB<-<@V/Vu!&+"0(5-:3?99D?IDNISNXS]Yb^gclhqnvs{y~#$N  G΋M ȃC|~xwJvms r(p%kn Migebd_E] +\X ZU S QVN"P KG@I L@EhD&A=@ IA"6::m2I4 61O. +&D* @,f&$k  " +"" #'j j jZX11 0 X VU0 0 j  1 WXU/ /00  !!2GH?"K2  +009Xpw  a Q1\\ZZX XV@Oi LYPIi GYE23L MO GSL J Q   LAJbI1 J! HRG!N2<=2<<2PUWonvbwIn, wn v lxw|k j l |}ly| pxx; nk nvx "3 : C5A1D@<84"n% E FGHD EFGGU H VJYJZF GHIJJKK L ]L]LL M ]M] MMjl GI22w6xw]]\\aa444/*/*4a4a/p/p44##nneef$~zvqmgc_ZUPJE@:5.*%   bQoQ)QQ)bo##  "eeca^^^``bb,,,,..-/S+S+/,S,UUSVY*Y+V_,r,r._._-`0`SqSq/rSrU_U_S`VaYpYqV`rqrq``r_r_prprrrr__`apqr+r+rrp,p,r,,*+-+-`-q-a/p/pRaRa/*/*RR/*/*s*s)saspspaasaV*V&qbq'bu_YcT efTva5]o6oZZTsT^T-TTTNN,N_NrNNHrH_H,HHHBB,B_BrBB "--ɤ)*(QKH/FC0CJ*+++$$)$' $"F9?7>:<=?@BBDEC8765ABFCBŔ[ep}Ꙍɟ̟WCL"8g2ƝGCƟp-̎g$2,#/f) QYGfIjaq~ia͚w"Q[RbFbB- +)3O4J(g"ǐ蔢),CˏɏMK#HdG79!2k5kw$y]]\\]aa4 "$() !    ',6FIZ_gnrp q nqx}}ytt| "$%-/116:;?@CEGIMMUWZ[_adfghnrsux{|~}zuurs62J B"*),/ x   xh#ҥ$1c G22 2ux{|qq;Tr!"$#  ; * !#"vxNå!iaT <\RSmcacehf;ѣi[JA9+hgfed;8pm`UC6 )&!       $"-70=DR_j$& u!t!xvr"* 3!$B?1"=:00+-.4 2j$:%&),;6[Asr@rr@Fr0q*'&#32)9RSMNIHCD=@>08P3349 /2749prxtzo~mtszqvtn{:ss f !!*b,ZX$ij`YVRT7Iotlzk|cZYihf_]\[WVw堦ԥup< +!1+*nl"4$h Y]bxmwpnimnjuf Ow_tXONzdcbR-#BP?53*Ү20-CU LN#DaA??+'A&146@IRR\v{xVTR>:73D /w-~C3*L>4psbZ`xj{jj}v~ Oy< /ɢ-еX2K2&p9-*0)iGF61'&=~=>Bu#7r8{:|<{9y8t!|#%(')t!a* p  r 0B{0:{;87%eh$+z)( Mx)nn taAx(("! $ٛ Cb22"),1BS "),03=#;%8+6,50322506/:-=+A)B(E5o6l3c/_-`+g,l.n,k-i-c+g*g(l'p)q5oTA DHP(V8[@[@I TA iO8PQ+jM#њ iI[ECE!#H)#M1P9$Q;ɱ项TBDHDlEjEgDeEbE_E\ EV EO 9l     8GDGEi"^][XWTRPNLJHFF\AP>'m>= 5-40/7.9+<%E*lbaEI!L)P1T9ZAXB@/8CCFJ&N-Q6U?d@ fe d-,X>T4P+L&HD>9%4./6)?0d,h!E ClСAc # #!M;J$!L90E0L=YA5AeJ+YR !'# ,09"P&: 9"x#%$ !! Y"Q!## Uc9!9 ab ZYWQXZV\UOVTVUWX`YX^XUTRY%+93:$-9S,; $9)0fy$|'%ko!^c _dkpF,5oApInLjMjJmNkQfPcNbFaCd>`@^B]F_I_M]PYOXPbQjRpQ{R~QT UTI"IAJDQLaNb@gQlQkLoO}M~>}?MmQ3Qs2PVrZwPxPyHx@vVCWKZM]L^I\E:"I-g7e?cE2)jI40qE4+!;y;%A:=l5$#I h,! KYA%Y A I/,70/B5'15z:IHPVJ]B`?^AcIeNmJiEp>neCk:k?d?\>]>e>\;\;^?^p pddbbd>aBBHHMMRRWW\\__ffkkpE]!]\F!EE!JN0R0VAY1A ?:%5.06*?'BD237+<#A!A:D)D;G1G;J8<%<;7-7;26?!?;4:L@7?,@NECF7F4E(F'I7HEGNHRKFJ7N(NEPSQFR7P'Q7W'X7Y(Y7_'^'_._8a(d9'f08f!8lFkSkRgEfSbFcFbR`F_RZF[FXRYSVFV :2%*"2)-%4-1%;;<) A2*#.&6!1*C=8$10.5,8*;(>'@&?B=Y&7I 7"09*(0#19?94'&&-.90+!="-3;Afdgi!f!ifi#)kT#rX|VXlm\dU\RBXgI\hWqX \ X bb"'r,n;p |A$FNL{ Nw# W+X/\.G_/]2[7b8Me5l/Co6j=vAs:u3v/J|5m{D [H((%-6M=< >B - /E(+ Kf lo s x˘_a"O Ybp@fqhn@qjhon&ppun_If"ZW(m%"OtsDv@]fYQkhāy MpBn"jx+yfd"}{"qmi;=%i)V-U2U7Tb5]*MI1L,,P)Pn3G-H)HKFGPJPOPPYJZG`CK_Q_gPgJg?Bf<>E?FDGQVINUaP^)\i1]7da:4:,>3C3>&B)b59]W0`X\Z! a^btw _Ip}pOoJY^gnIoOqL}N)G,`DC`JaOPSS#NdMSKTL JMSKa@_J_Q^Q^N]F cKJoIpQqLrJB}P|KEkd_o! o lc_s{yGc]c^b_cacbba`-`j j kkkkllkl#l(q)p3p6n7m8n9m8l9k9`D`DlEmTlGcEaRaSbFbVa^aZbVb7a.a0oFlP&+16@EHIJTV]U?976("#2Nbv{yyttszvwzq|q~ke^[UN@?><;88210)$3LssszzLBUHGECBA@1/.,)P $LU6/)LTXLH>;GLTWJWvwxypc^4M c oor;=aq=c=====B>A>A>A=A=A<B=A>A>;=aq=c=====B>A>B=BA> R;=qb========<<<<=<<<<=<<<<=<<<<=<<<=<<<<<>>>?;9aq9c8b=<;7;7:24q:34A1:12B5112B52B5qE5qD5sC5AAsA61rB3Aq9D1Bq:1E:12C1:898774  ;?q>r=qA=A<<<5=7q5=7q5=7q5=7q1=29>8=9=9=8<9<8;9;9;8:9:8:89881BEF1HgHccBBI !?3?38?38?38?28?27?117?1133?1321?621?61>71>7=9=8=8<9<8;9;8:9:8991481C81DCeBFbbAaF D 9!?3?38?38?38?28?27?117?1161?161?612?61>7>7=8=7=71:7A86C57D36D61D53D25D7C9C;C>D?2B?4?9!?3?38?38?38?28?273A<172A;1611AA92611BA8822BA693BA584BA395BA286BA87BA88BA619BA42:BA3;BA1BA?BA?1BA?2BA?3BA?4BA?5A?7?:):A:C:BaA:BaA;AaA;D;BaA;BaAaAaA>E>BaA?AA?CA?AaAA?1D?1CaA?1AaAaA?1AaAaA?2E?2CaA?2AaAaA?3aD?3CaA?3CaA?4aC?4E?4CaA?5D?5B?7?:*?5?3?3A?3AaA?3AaA?3BaB?3E?3BB?3BB?3BB?3CaA3?3CaA3?3CaB1?3CaB1?3CaB2?3F?4BA?4BA?4BA?4BA?4CaA?4CaB?4CaB?4CaB?4CaB?4CaB?4CaB?4CaB?4DaA?4DaB?4DbA?5DaA?5DaA?5DaA?5DaA?5DaA?5F?5C?7?:/?:?5?5?5aBaA?5AaBaA?5AaBaA?5AaBaA?5AaBaA?4AaaA?4AaaA?4AaaA?4AaA1?5AaAA1?5AaBaA1?5AaBaA1?5AaBaA1?5AaBaA?5AaBaA?5AaBaA?5ABA?5ABA?5AaBaA?5AaBaA?5AaBaA?5AaBaA?5AaBaA?5AaBaA?5AaBaA?5AaBaA?5AaBaA?5AaBaA?5AaBaA?5AaBaA?5AaBaA?5AaBaA?5AaBaA?5AaBaA?5AaBaA?5AaA?7?:====<<<;1;1;::9998877766554433224V q xB .3d3aq3d1cB222223A4A3A322q2q2q2q2q2Aq2Aq2q2q222A2A2B3B3C3C3B4C4AB4AB4AB4AB4B4B4C4A4A4B4B144 -3d3aq3d1cB222223A4A3A322q2q2q2q2q1‚q1‚q1‚q1q111B1C11C3D3C3B3AC3AC3BB3B1B3B1B3B1B3B1B3B1B2B1B2B2B2B2B2B32322 ,3d3aq3d1cB222223A4A3A322q2q2q2q2q2q2q2q2q222A2A3AB3D3C3AB3AC3BB3B1B3B1B2B1B2B3B1C3B1B3B1B4BB4BB5B5A5 -3d3aq3d1cB222223A4A3A322q2q2q2q2q2q2q2q2q2222A3BA3D3C3AB3AB3AB3AB3AB3AB2BB2BB2B1B1B1BA2B3B4B4A5 .3d3aq3d1cB222223A4A3A322q2q2q2q1q1q1q1q2222B2C3C3C3C3B4B4B4B4B4B3B3B2B2B2B2B3B4B44 .3d3aq3d1cB222223A4A3A322q2q2q1q1q1q1q11111B1C1A1C3C3C3D3D3D3D3AA4AA4AA4AA3BA3D3AB3A1A2B12B2232 -3d3aq3d1cB222223A4A3A322q2q2q2q1q1q1q111212B2C3D3D3D3BA3BA3BA3BB2C1B2B2B2B2B2B2B2B2B1C2B1B3B1B3BB4A54 ,3d3aq3d1cB222223A4A3A322q2q2q2q2q2q2q2q2222B2C3D3D3D3BA3BB3B1B2B1B2B2B2B2B2B3B2B3B1B3BB4BA4B6B6A7 -3d3aq3d1cB222223A4A3A322q2q2q2q2q2q2q2q222A2A2AA3AA3C3D3D4C4C5B5B4B4B3BA2BA2A1B21B31B31B326  13d3qc31cc2B22A2A22B3432‚1r1r1r1r1r1rA1ArA1Ar1r1r1r111D11E3E3E3BB3B1B3B1B3B1B3B1B3B1A3A1A3B13B1A3B1B3B1B3B1A3B13B13A33 13d3qc31cc2B22A2A22B3432‚1r1r1r1r1r1r1Ar1r1r1r1r11A2D3E3E3E3BB3B1B3B1B3B1B3B1B3B1A3A1A3B13B1B3B1A3B13B13B3B3B3A33 13d3qc31cc2B22A2A22B3432‚1r1r1r1r1r1rA1Ar1Ar1r1r1r111D11E3E3E3BB3B1B3B1B3B1B3B1B3B1A3A1A3B13B1A3B13B13B3B3A33 13d3qc31cc2B22A2A22B3432‚1r1r1r1r1r1ArA1ArA1r1r1r1r122D3E3E3E3BB3B1B3B1B3B1B3B1B3B1A3A1A3B1A3B1B3B1B3B1B3A1B31B31B6A66 13d3qc31cc2B22A2A22B3432‚1r1r1r1r1Ar1ArA1r1r1r1r2r222D3E3E3E3BB3B1B3B1B3B1B3B1B3A1B31B3A1A3A1B31B31B31B6B6B6A666 13d3qc31cc2B22A2A22B3432‚1r1r1r1r1r1ArA1r1r1r1r1r222D3E3E3E3BB3B1B3B1B3B1B3B1B3A1B3A1B31A3A1B31B31B6B6B6A66 |H 13d3qc2aba1cc2d222223432111111A1A11111223AA3E3E3BA3B13B1A3B1A3B1A3B1A3A1B3B1B3B1B3B1B3B13B1r3B3B33 13d3qc2aba1cc2d22222343211111A11A111111223AA3E3BA3B13B13B1A3B1A3B1A3B1B3A1B3A1B3B1B3B1B3B13B3B3B3B33 13d3qc2aba1cc2d22222343211111A1A1111111233AA3E3BA3B1A3B1A3A1A3A1A3A1A3A1B3B1B3B1B3B1B3B1B3B1B3B1313r3r3r 13d3qc2aba1cc2d222223432111111AA1111111123AA3E3AB31A3A1A3A1B3A1B3A1B3B1B3B1A3B1B3B1B31B3r1B6B6B66 13d3qc2aba1cc2d2222234321111111AA111111123B3E3AB31B31B3A1B3A1B3A1B3B1B3B1A3B1A3B1B3B1B31B6B6B6B6B66 13d3qc2aba1cc2d2222234321111111A1A11111123B3E3AB3A1B3A1B3A1A3A1A3A1A3B1A3B1B3B1B3B1B3B1B3B1B31B316r6r6r4 Pdy 5q4r3q2q2q111q2a45a66a77A88A911223211111212221121121324M X0q(qqrBqqqqqAqAqqAq1122211111111(qqrBqqqqqAqAqqAq2222211111111'qqrBqqqqqAqAqqqA11221111112211'qqrBqqqqqAqAqqq121211111111(qqrBqqqqqAqAqq1222211111(qqrBqqqqqAqAqq222111111111111(qqrBqqqqqAqAqqAa1a122111111111112'qqrBqqqqqAqAqq222311111112211'qqrBqqqqqAqAqq12231111111111(qqrBqqqqqAqAqqq112321124 B qqqqq qqqqq  8z| , baebadbadabdabdabdabdaadaaaabaaaabaaaabababaabbabbbaecececcadcbccbccbccbccbccbccbbbbbacbacbacbacbaacaaacaaacbaebaebebebcbcbtxzx , baebadbadabdabdabdabdaadaaaabaaaabaaaabababaabbabbbaececebcaccccccbcbcbcbcabaabbacbacbacbaacaaacaaacbaebaebdbcqbabaabqbaqabrbqusx , baebadbadabdaabcaabcaabcaaaabbaaabbaaabbaaabbbabaabbabcbacaacaacbcbbabababacbcaabaaaaaaabbaacbaacbaaacaaaacaaaabcacqcacacbcaabqaaqcqaccqbaqaaaaquqxq , bacbabbababbaabbaabbaabbaaabaabaabaacbcacbcbbbbbbbaabaabaabababacacbbbabababacbaacabaacaaaabbababaabqaaqbqcqaqaqcqacacqbbqacebqaracqss, bacbabbababbaabbaabbaabbaaabaabaabaacbcacbcabababaaaababababababbabababababaabaaaaaabaacbqaacqaqaqbqqaqbqcraqeraabbaacqbcqaabbcaqaqber r k1 qrqqqᑁaqaqarqqBAAAAAAqÂqqqqrrq22221111111122' qrqqBqqqqqqၖqqqqaqAqaÑqaqqaÁĂaaa2qa2221111111122' qrqqBqqqqqqၖqqqqaqAqaÑqaqqaÁqĂa2a2aq2qq2aq1111111122' qrqqBqqqqqqၖqqqqaqAqaÑqaqqaÁqĂa2222a11a11a11qa1122aqa' qrqqBqqqqqqၖqqqqaqAqaÑqaqqaÁqĂa22221111111122aqqrqaaqaq, qqrqqqᓂqqrqqBᒁqqqAqAÁqr22221111111122aaac( qqrBqqacÒbq‘qqAqAAqqArAqAqAÁrBAqCqq2q2q23B11B11B11B12AA21AA1AABBAAAAABAA( qqqqacAbAAAqBrAqĂqAAqBqāqAq223B3B11B11B21B21AA11AA1ABABAAAAAA( qqqacbqArrAAAAABAr1r1q3A3A3B11B11A21A11A11AA1AAABAAAAAA ( qqqacbqArrAAAAABAr1r1q3A3A3B11B11A21A11A11AA1AAABAAAAAA( qqqacbqArrAAAAABAr1r1q3A3A3B11B11A21A11A11AA1AAABAAAAAA( qqqacbqArrAAAAABBArA1r1q3A3A3B11B11A21A11A11AA1AAABAAAAAA( qqqacbqArArBAƒABArA1r1q3A3A3B11B11A21A11A11AA1AAABAAAAAA( qqqacbqArrAAAAABAr1r1q3A3A3B11B11A21A11A11AA1AAABAAAAAA( qqqqacAbAAAqrqĂqAAqBqāqAq223B3B11B11B21B21AA11AA1ABABAAAAAA( qqrBqqacÒbqqqqAqAqqAqqqAqqBqqÁA2‚23B11B11B11B12AA21AA1AABBAAAAABAA( qqrBqqacÒbqqqqqqqqqqq“qőqA2Aq2q23A11A11B11B12AA21AA1AABBAAAAABAA( qqrBqqacÒbqqqqAqqqqq“qŁqAqA2q2q23A11A11B11B12AA21AA1AABBAAAAABAA) qqrBqqacÖbqqqqqqqqqqqqq2qA2q1q13A11A11B11B11B1B1AAAAAAAAAA4 [ bebnoooadndhbacidbqgqdbrccbqbcabrabaaaabbaaaaa !!!1#!1!1!"!$1""A!AABaAaAAaAbAaa !!!"!"!"#!!#A!!AAAAAAaAaAAaAAAA  5 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa5 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa5 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa5 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa  $v $ BBABBABBABBBBBBBBBBBBBBABBABBABBABBBBBBBBBBBABBABBABBABBBBBBBBBBBABBABBABBABBABBBBBBBBBBBABBA $ ABBBBBBBBBBBABBABBABBBBBBBBBBABBABBABBBBBBBBBBABBABBABBBBBBBBBBBBABBABA$ AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA$ AAAAAAAAAAAAAAAAAAAA  (Fa           4D" | 6P} ;3e3e2br2e2bA1abA2A222A2A23A43A3A222q2q2q2q2Áq2q1q1q1q1q1q2q22212C2B3B3AB3E3D3E4D4D4E4E4B1B4B1B4B1B4B1B3C1B3C1B3B2B2C2B2C2B2C2B2B3B232321 ;3e3e2br2e2bA1abA2A222A2A23A43A3A222q2q2q2q2q2q2Áq2q2q2q2q2q222223A3BA3C4C4C4D5C5C5C5C5B5B4C3D2D2C2B3B4B4B4B444 ;3e3e2br2e2bA1abA2A222A2A23A43A3A222q2q2q2q1q1q1q1q1q2q2q2q22222B3C3D3D3E3E4D4D4E4E4B1B4B1B4B1B4B1B3C1B3C1B3B2B2C2B2C2B2C2B2B3B232321 ;3e3e2br2e2bA1abA2A222A2A23A43A3A222q2q2q2q2q2q2Áq2q2q2q2q2q222223A3BA3D4D4D4D5C5C5D5D5D5D4E4D4D4D4D4C4B4B4B444=% :3e3e2br2e2bA1abA2A222A2A23A43A3A222q2q2q2q1q1q1q1q1q2q2q2q22222B3C3D3D3E3E4D4D4E4E4B1B4B1B4B1B4B1B3C1B3C1B3B2B2C2B2C2B2C2B2B3B23232187e7e6br6e6bA1a4bA6A666A6A67A86A6A5q5q4q4r4rA3q3q3qA3q3q3r12q22q222A2AB32AA33AB23AB3BB4CB4CB4CB4CB5BB5C4C4B3BB3BC2AC21C22B32B41B7B7B7B77798e8e7br7e7bA1a5bA7A777A7A78A97A6A6q5ƒq5Âq4r4rA3q3r2rA2q2rB3rC3D4G3DB3BB3BC4ACC6D1C6D1D6D1B7DB7D7D8C8C8C8B18B27C7C7C7C7B7B7B7B7B7B777:8e8e7br7e7bA1a5bA7A777A7A78A97A7A6q4Ăq3łq2r2rA11q12r12rA1B11qC12rE12rF12DB11FA1‚CBB2CB1B2CB1C3D2C31E2B6D11B6D5B6D5B7D47D47D48C8C8C8B8B7C7C7C7C7B7B7B7B7B7B7779;e;e:br:e:bA1a8bA:A:::A:A:;A<:A8r8r8q7Ãq6Ăq6r5q51q41r41r41r41s5r5‚r6A6E6CC7CC7DD8DC8EC9EC9FB:E;DC?B?199e9e8br8e8bA1a6bA8A888A8A89A:987q7r7s7r6Ár6Ár6r6r6r5Âr5s5r5‚r5‚r6E6CC6FA7GA7GA8ÁEAC?9:c9e9e9q8g7aCb7aAA88A8A89A9:98q7q7r7r7‚r6ÁrA6Ár6rA6r6r5Âr5s5r5‚r5‚r6E6CC6FA7GA7GA8ÁEAC? (Fa 25149 54795 71:74 27752 525557317 Ig % '5e5e4br4e4bA1a2bA4A444A4A45A6433q2r2r2‚r1ÂrA1ƒr1ƒqrrrÂr1‚r1q1BEEB2GA2HA2IA3EA6D8C9&8e8e7br7e7bA1a5bA7A777A7A78A86655q4q4q33q3Á32q2r22r22r22qAA21CA21EA21F3GA4GA4EA6C8C9#9e9e8br8e8bA1a6bA8A888A8A89A97766q6q6q5q55544q414BA3CB3DA21DA5EA6C8C9;e;e:br:e:bA1a8bA:A:::A:A:;A;:88q7q7r6q6r6r5r5r5q3q12A15B6AA8B9;e;e:br:e:bA1a8bA:A:::A:A:;A9987r7q7q41q51r5r6As6s6q8A9;e;e:br:e:bA1a8bA:A:::A:A:;A9988r8q7q7q7q7Áq99e9e8br8e8bA1a6bA8A888A8A89A9887q9 7e7e6br6e6bA1a4bA6A1666A69=<7e7e7b9==4>9>;?<?=?=??????1??1??1??1??1??1?????????????????????>?>?>?>?=?=?<?<?;?:?9?8?8?8?8?7?6?6?5?4?3>2>=;77777789:1:2;3?2?2?22(P?26877473872462615 4 33333333 33331497?6?6?6 ?6?7?7?7?7?7?7 ?7?7?7?6?6?5?5?5?4?4?4?3?3?3?2;5:38732333333333333333345616273===247(P?26544443842432312 1   133Ꮑ9:; ;;;;;::9823 12313243:::2479(P?26544443842432312 1      12313243:::24794  ^xH1111qsssq1qsssq1qsssq1qsssq1qsssq11r11qsssq1qsssq1qsssq1qsssq1qsssq1137rsssrrsssr1qsssq11r11qsssq1qsssq1qsssq1137rsssr11qsssq1137rsssr11qsssq37 ODAAAAAAAAAAAAtq2q3q3q3q2q ODAAAAAAAAAAAAAAAAAABAAAABAAAAAAAAAAAAAAAAAAtq2q3q3q3q2q ODAAAAAAAAAAAAAAAAAABAAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAOD "ce$9aa6afaaaa4b┲3babaa2aaaaabᒱ1a1aaaaaacaaaaaba1a1a123a58"?;?;?;?;?;?;1?:1A?5rq8srqrwrv{qqxyrqs}ysqwuqvqqqqqtqqquuys1sssssq1ry t1qs11BOJ11BOJ11OEH1A?= "5555555555555553111 11122 252717 1bbabbbbbbac2baa4b4aa4c55u2vrqqqqqqqqqqqqqqqqqqqqqqr1qqqqqqqqqqqr1rqqqqqqqqqqq1qqqqqqqqqqqr2w8x ohdqeqjqq1jqaf1obd1nqba1rqqq1brardac1cuie1oi11111111?111?111?111?14?34?34?34?34?34?34?34?34?34?3 2r1tasauat1qazasar1sauay1rarwauawrarauay}sqrrqs132E2AB2AAA1AAA1AAA1AAAAIA A A3 1abb 1bbb bbba Abbba A baa A a A a A a 1 a 1 2 2 13 !6666666661615251515152221111111121111121111121112134343434 !221112111121212111111111121111121111121112114141414r4Y% X* 8!!$ D( qqrBqqqqqAqAqqq1122211111111111( rrrrrqqqqqAqAqqq122211111111111( qqrBqqqqqAqAqqq1122211111111111( qrrCqAAqqrqqArsqqsq1132211111111111 4' baacAAQQAQABAAAAAAAAAAAAAAAAA' aqcbAAQQAQABAAAAAAAAAAAAAAAAA' baacAAQQAQABAAAAAAAAAAAAAAAAA' qacbAAQQAQABAAAAAAAAAAAAAAAAA(( qaqrqcqBb“qqqqqqqÁqAqAqAqqÓqAqqqq1A1A1B11A11B11C11AA11AA11AA1AAAAAAAA( qaqrqcqBb“AAqqqqqqÁqAqAqAqqÓqAqqqq1A1A1B11A11B11C11AA11AA11AA1AAAAAAAA b"' qrqqBqqqqqqAqAqqqq‘23311111111111- qrqBqAq“AA’qqqÁqqAAqrqqqq23221111111212111( qrqBqAqAAqqqqqAqAq‘q‘qq23311111111111' qqrBqqqqqqAqAqqq‚qq23311111111111- qqrqBqAÒAAqqqAqqĂqAÁrqqqq23221111112121111( qqrqBqAAAqqqqAqAq‚q‘qÒqq23311111111111 ?f' aqcbqqqqqAqqAqAABBBAAAAAABBAAA' aqcbqAqqqqqqqBBBBBAAAAAABBAAA' aqcAqqqqqqqqBBBBBAAAAAABBAAA& aqaaqbqqqqqBBBBBAAAAAABBAAA& AAAAAqqqabqaqaqACCAAAAAAAAAAAAAAAAA* AqqqrrrrrBCCAAAAAAAAAAAAAAAAA "-6AI[ft ) AAAqaqrqbqBbAA•Aq–qqqAqAqqqÑqqÑ2B2B2B2B1B1AA1AA2AA2B1BAAA' qaqrqcqBbBA’AAqAqqAqAĕqA—qqÑqqÑ2B2B2B2B1B1AA1AA2AA2B1BAAA' qrqaqqBcb”qqqqAqAABqqBqő‘1BÑ2C2B2A1A1B1C2AA2AA1AAAAAAAA' qrqaqqBcb”qqqqAqAAA‘ÁÂqq2B2C2B2A1A1B1C2AA2AA1AAAAAAAA' qrqaqqBcb”‘qqqqAqA‘Ł‚rq—2BÕ2C2B2A1A1B1C2AA2AA1AAAAAAAA' qaqrqcqBbAA“AAqAqÁqAqArqBrqB”Õ2B3C3B2A11A11B11C1AA2AA1AAAAAAAA' qaqrqcqBb”qqqqABqAqBÁAŁqAqqBrqB”Õ2B2C2B2A1A1B1C2AA2AA1AAAAAAAA' qaqrqcqBb”qqqqAAqqqA‚AAqAAD‘2BA’2C”2B2A1A1B1C2AA2AA1AAAAAAAA( qaqrqcqBb–qqqqAqAqqqqq˜AqA12C2C1B2A1B1B1C3AA1AA1AAAAAAAA) qqbrqqBbbAqqqqqqAqqAqqqqAqAqqq111A2B1C2AA1AA1AA1AA3AA1AA1AAAAAAA 9~') qqbrqqBbbAqqqqqqAqqAqqqqAqAqqq111A2B1C2AA1AA1AA1AA3AA1AA1AAAAAAA) rqbqqqCqbbAAAqqqqqqqAqqAqqAqAqqAqqAqqq‘q33A3C11C11AA11AA11AA11AA11AA1AAAAAAAAA) rqbqqqCqbbAAAqqqqqAqqqqqqAAqA‘qqAqqAAqÖqqq–q33A3C11C11AA11AA11AA11AA11AA1AAAAAAAAA) rqbqqqCqbbAAAqqqqAq’AqqAqqAq•qAqqqqqqqqqq33A3C11C11AA11AA11AA11AA11AA1AAAAAAAAA) rqbqqqCqbbAAAA’“‘rr•qqqqqqqqqqqqqqqqqqq33A3C11C11AA11AA11AA11AA11AA1AAAAAAAAA t4& “A’‘qqqrrrrqCDFBBBBBBAAAAAAAA( A–”ÄÃqqqrrrrCqEFBCBBABABAABAA' Aqq‚q‘sĒsssqCEEADBBABABABABAAAA( Aqq‚q‘sĒsssqCEEACBBAAAAABABAAAA*R| baadbbb aaaaaabaaaabba aaaaaaaaaaaaaaa abaaaaabaaaaaa dbbadb abaaaaaabaaaaa aaaaaaaaaaaaaaa aaaaaabaaaaaba4d  ; q%7q334;;q;;q;q;q;r;r;q;r;r;q;r;r;q;r;r;q;r;r;q;r;r;q;r;r;q9BrB4GqAIrBuv2s#3q3;;;q;;q;q;q;r;r;q;r;r;q;r;r;q;r;r;q;r;r;q;r;r;q;r9BrB4GqAIrBuv2s#33q7;;;q;;q;q;q;r;r;q;r;r;q;r;r;q;r;r;q;r;r;q;r;r9BqC4GqAIrBuv2s#3q3;;;q;;q;q;q;r;r;q;r;r;q;r;r;q;r;r;q;r;r;q;r;r;q;r9BrB4GqAIrBuv2s-&77qb7qe7qh7qk7q2l4q3qiqb1qa2q2qfqe2qbq2q1cqh3qcÂ3qk4q1d‚4ql5q1qcƒ4qqiq61qc‚3q1qfq6Aq3d‚1q3q1cq4r5cq1q4qq2r2q1q14qcÁq7qqqcq1q2q22q1d‚8qq1dq3B31q2cƒ6q2q3d4B3q1c4q3q4qd4C21rcq1q3q5Bd5ArA4bqq2q7Bd1s1A15q1qq9Bra4qAq24q2qq;B1dq1q1Aq32q2qr=B1dq3B41q2r?B1d4B4r?2Bqe3C3?5Be4Ar?7Bc1s1Aq?9B1r5qBq?;B7q1q2Aq?=B5q1q??B2q2q??2Bq-&8qb8qe23qh2qb1qk3qc2k3qe2iqb3q1g2gqd4q2g3dqg4q2q1g2aqj5q1q3qeqa1q2k5q1q2q3cqcq3jq5q11q6bqdÂ3gq68aqgq4dqcqAv2q2gƒ4aq2c21q2qg3q4d11q2q3eqq4q1d1q1q2q2dqq3q3qe1q1q5bq2q2qa6d17q3qq1qd7d15q3q2q3e6qAu3q2q4q5e6c11q2q3q7e7e1q1q2q9e5q1e1qq;e2q3qd2=dq8d2?aqc8wv?2e>?4e<?6e9q11q?8e6q2q1q?:e3q3q?bq-&44qa1qB4qdbC4qgbC5qibB5q3iaC5q3q2gqabB5q3q5dqcbB6q1q5q2aqfbB6q1q4q2qhe3q1q3qq2he2q22r4q1q1hAbq4q‚q9qq2eqCq6:q1q2cqq5q8q1q1q2q2q3r235q1q3rq3q2qb1q1q33q1q3q2qqe822r6qq2e8Áq:q1qq4e8;q1q1q6e8A8q1q3q8e5qaq5q1q2q;e1r232r3q1q1q=cqa2q1q41r21q?dq91q?2e:?4f9?6f8q?8e5qr?:e1r23q?q4q1q??6q W?2c?2b?2b?1c?2aa?2b?2a?3q?3r?3r?3s?3s?2r?21q?12?28132f31h3ar3qqq3qqr31qr41are511f512<=95qqqqbaqq1ab2 :9b8b6b5a4ab4bb2aa1cqaaqqaqqq1 :9q8a7a6qa43q1qaaa2>c=b=b=c=aa>b?a=r=r=rAŁ>2q?6?6?4rq?3u?3t?3r?2ƒ>22q1q2>2q=2?1;8;22Ar2qr2qq1?1qq<5?3>4rq?3u?3t=4r?2ƒ>22q1q=a1a1q2rq:a1a122q1?132;1a'3322A223422q?r2q=r1q2>2q=2?1;8;23qq1?1Ă?1AAq?6?4rq?3u>3t?3r<4ƒ>22q1q=1a1q2rq:a1a122q1?132;1a4 &aabaabaabaabaababababaabaabadbdaaeaeaeagGGGGgbdefeAbBaCDa#a1b1ba1b1a1b1a!!1b1ba1b1ba1a!1ba1a1ba1b1ba1b1aa1b1a!1b1b!1b1a1qaaqaqaaqaqaqaaqaqaqaaqaqaqaaqaqaqaaqaqaqaaqaqaqaaqaqaqaaqaqaqaaqaqaqaaqaqaqaaqaqaqaaqaqaqaaqaqaqaaqaqaqbbbAaCD3 Vo'bgaaeaeaeaeaeaeaeaeagggcccccaacaacaacaacaaccgggaaeaeaeaeaeaeaeagg'2ab2aa2ac2ac2ac2ac2ac2ac2ac2ab2c2e2e2ca2c2ca2aaa2aaa2aaa2aaa2aaa2ca2d2e2e2aa2ab2ac2ac2ac2ac2ac2ac2ab2c2e2b5'4a4aa4aa4aa4aa4aa4aa4aa4aa4b4c4c4c4b4b4a4a4a4a4a4b4b4c4c4aa4a4aa4aa4aa4aa4aa4aa4aa4b4c4b5a6'6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6a6 7$ggaeaeaeaeaeaeaeaeaeaeaeaeaeaagaeaeggaeaeaeaeaeaeaeaeaeadcaggd3$2ac2ac2ac2ac2ac2ac2ac2ac2ac2ac2ac2ac2ac2ba2e2ac2ac2e2e2ac2ac2ac2ac2ac2ac2ac2ac2ac2ac2bb2ca2d3c4b5a6$5a5a5a5a5a5a5a5a5a5a55b5b5a5a5b5b5b5a5a5a5a5a5a5a5a5a5a5a5a5a5b5a5a564^ " 1CPc$lW"!!!q!q!qqqqrsq!!q""q"+#""A"A!A!B!AA!AA!AB!AA/,!AA/,AA/,AA/,AAA/,AA/,AA/,AA/,AAA/,AA/,AA#2+2"AA41AAB11AAq11512AAq1522AAAq2112AAq3312AAA4313Bq24613AB29112ABq442113AAq23513Ar736AAr115:1AAr182316AAr1?;Ar1?921?;A5661A1564AA57A-$#//" ,%A%A%A%A%$#qAA!AAqA#AAA!!AA"!AA"!AqA!AqA!AqAtAq!tAq!qqAq!vAAq!tAA!AA!AA!AAAAAAAAAAAJA!AB!AFB!AAAB!AAAA!AAAA!AAA!AAA!!AAA!!AAA!!AF!!A!!AA%!AA%!AA%!AA%!AA%!AA%!A& 0qaqaqaqaqaaqqaqaqaqaqaaqqaqaqaqaqaaqqaqaqaqaqaqaqaqaqaqaBqaqaqaqaqaAqaqaqaqaqaAqaqqaqaqaqaqaqaqaqqaqaqaqaqqaaqaqaqqaaqaqaqqaAaqaqa2A1Be1A1Ae11B11Ae11Be12A12Be11Be12B3e4Af1A4Af4Ag21‡4g11g3h1hbhdhbjbjakakmmmm ""!!!!!"!"", $##""""!!!%%($!AACD!DD$K(,D+B++AAA+AAA,D,B,+A*AA*AA&"AA"&AA&""'$$-B-- !&&&A&B&B&B&A&A&!&!%"%A!%!%!%""C"B!B!B!BÁ!Ɓ!„!!"!!!!!"!!!!!"!!!"!#$#$#$#$ !DAAAA$!$!!!!!"!$!$!$!CABAA!AA!!ā!#!#!!#!!#!#"$"$"$"$ hM 0ba 0aaaaɁǂłÂ 0aaaǁƁŁāÁ0aaāāÁÁ0aa c  #+$&#'"(!"&#'+*)!+++++++aak++)!("'#&$)!("'#+++++++ #+$&#'"(!"&#'+*)!++++a+ak)!("'#&$)!("'#+++++++m+ #+$&#'"(!"&#'+*)!a+ak++)!(")!("'#+++++++m+++++ #+$&#'"(a!"&ak+)q!(q!("'#&$)!("'#+++++m++++++++++ #k$q&#q'"q&!!q"q#"#q##&$%#q(q!'#+++++m+++++++++++++++ A"""!!!!!!!!""")//!/////.A/-B/-BA/-B/-AB/-AB/-AAA/-AA/-AA/-AA/-AAA/-AA/-AA"2+2$AAA14!AA11qAAA21511rAA2251qAAA31642qBA21192BA311244qB31532qAA637rAA1:511rAA613281rAA?;1rA2?91rA?;1A1665A465175AA#$-//":'%!$#$%%%%%$$#qq$"qq#!qq"!q"!"!!qq!qqq!qqqq!qqqqq!qqqq!qqqqq!qqqqq!qqqqq!qqqqqq!qqqqq!qqqq!qq!Aqq!!AqA!"H",,,,,,,,,,,,,,,,,,,,&%&#$&!#'!"*!*"%#"#%!$!&& #""q"r"qq!!q!"$$"C!A!B#A$A$B"A!q!!! &&!&$!!!!"!!$!$!!BA2A!!!!!!!!q1q1!!!B!!BA  #+$&#'"(!"&#'+*)!+++++++aak!$$!$$!$"!!$!"!%#!%#!%!!%!"%#!#$!#$"#$""$!!!%!!!%!!!% #+$&#'"(!"&#'+*)!++++a+ak᱄!$"!!$!"!%#!%#!%!!%!"%#!#$!#$"#$""$!!!%!!!%!!!%m+ #+$&#'"(!"&#'+*)!a+ak!$$!$$!$"!!$!"ၱ!%!!%!"%#!#$!#$"#$""$!!!%!!!%!!!%m+++++ #+$&#'"(a!"&ak!$$!$#q!$"!!$!"!%#!%#!%!!%!"%#᱄"#$""$!!!%!!!%!!!%m++++++++++ #k!!"$!#$!"!"!!!"!"!%#!%#!%!q%!q!%#!#$!#$"#$""$!!!%m+++++++++++++++ 1^$"!!!qq"q""A#q!%!q%q!q!!q"qq#q#q"A#q $$#"qqqAq!q!q"q $"!!!qq!"q"$A%q!%!q%q!q!!q"qq#q$q$A%q $$##qq"qAq!q"q!q4 r  (Db0'd'aq'd%cB&&&&&'A(A(A&A%q$r$r#r#ArA"ƒs!A"!s""A!t"A""t#!"t#!A"t$!#t#!#$"C$#!D!%E'E'E'BB'B!B&C!C&B!C&B!B&B"B&A#B&B#B&B#B&B#B&B#B&B#B&B#B&B#B&B#B&#%#0'd'aq'd%cB&&&&&'A(A(A'A&q%r%r$r$rA#r!A#ƒr"A#A!s##"s#""s#"A"s#"#s""##!"C#!#E"$E'E&F&CC&C!C&B"B&B#B%B#B%B#C%B$B%B$B%B%B%B%B%B%B%B%B%B%B%B%B%B%B%%$%0'd'aq'd%cB&&&&&'A(A(A'A&q%r%r%rA$r!A$r#$r##Ar##!r##A!r##"r##"r"#"#"!C#""D##E'E&G&CC&C!D&B"C%C#B%B$B%B$B%B%C%B%B%B%B$C&B$B&B$B'B$B'B$B'B$B'B$'#'0'd'aq'd%cB&&&&&'A(A(A'A&q%r%r$r$rA#r!A#ƒr"A#A!s##"s#""s#"A"s#"#s""##!"C#!#E"$E'E&F&CC&C!C&B"B&B#B%B#B%B#C%B$B%B$B%B%B%B%B%B%B%B%B%B%B%B%B%B%B%%$%!/(d(cq(%&cc#!%B#%"!!"A"!!""A"A!!"!"!B!"A!B"A"ƒ!!#A#„„A$r$r%r&r&t&t't't't't'u''E'F'F'F&C"B&C"B&C"C&B#C&B$B&B$B%C$B%C$B%C$B%B%B%B$C%B$C%B$B%B$B%$%$$&/'d'qc!%#cc#B%!!"%!!"A"!!A"A""!‚!"!"!B!"A"B!A"‚!!"„A#A„$r$r%r%r%t&t&t&t't't'u''E&F&F&F&B"C&B"C%C"C%C#B%B$B%B$B%B$C%B$C%B$C%B%B%C$B%C$B&B$B&B$B&$&$%& #!a>aa>aa>aa>aa>aa>aa>aaaaaaaaaaaaaaaaaoa>>a>aaaaaaaaaaaaaaaaaaaaaaaaaoa!a>aa>aa>aa>aa>aa>aa>aaaaaaaaaaaaaaaaaoa>>a>aaaaaaaaaaaaaaaaaaaoaa.aa.aaa!a>aa>aa>aa>aa>aa>aaaaaaaaaaaaaaaaaaaoa>>a>aaaaaaaaaaaoaa.aa.aa.aa.aa.aa.aaa!a>aa>aa>aaaaaa>aa>aaaaaaaaaaaaaaaaaoa>>a>aaaaaoaa.aa.aa.aa.aa.aa.aa.aa.aa.aaa!aaa>aa>aa>aa>aa>aa>aaaaaaaaaaaaaaaaaoaNna.aa.aa.aa.aa.aa.aa.aa.aa.aa.aa.aa.aa.aaa [!a>aa>aa>aa>aa>aa>aa>aaaaaaaaaaaaaaaaaoa5'25'2a5'2aa(aa)aa)aa(aa(aa%"aa%#aa%#aa##aa#"aa#"aaaoa!a>aa>aa>aa>aa>aa>aa>aaaaaaaaaaaa7aa7aaaoa4(24)1a4)1aa(aa(aa%"aa%#aa%#aa##aa#"aa#"aaaoaa.aa.aaa!a>aa>aa>aa>aa>aa>aaaaaa7aa7aa7aa7aa7aa8aaaoa5(15%1"1a5%1#aa%#aa##aa#"aa#"aaaoaa.aa.aa.aa.aa.aa.aaa!a>aa>aa>aaaaaa52aa52aa7aa7aa7aa8aa9aa9aa8aaaoa5%1#6#2#a6#3"aa#"aaaoaa.aa.aa.aa.aa.aa.aa.aa.aa.aaa!aaa52aa52aa52aa52aa52aa42aa9aa9aa8aa8aa52aa53aa53aaaoaNna.aa.aa.aa.aa.aa.aa.aa.aa.aa.aa.aa.aa.aaa4& < e& ,3222A2223A4A332222222222222233333444444444444144 +3222A2223A4A3322222111111111113333333131313131212222222322 *3222A2223A4A3322222222222222333333313121231313144555 +3222A2223A4A332222222222222233333333322211123445 ,3222A2223A4A33222222222222222333444443322223444 ,3222A2223A4A33222221111111111A3333444444333312122232 +3222A2223A4A332222211112222223333332122222222121313454 *3222A2223A4A3322222222222222233333131222223231344667 +3222A2223A4A332222222222222223334455443221213131326  .3222BA2A22343B211111111111111111133331313131313131313131313131333 .3222BA2A22343B211111111111111333333131313131313131313131333333 .3222BA2A22343B22111111111111111A113333131313131313131313133333 .3222BA2A22343B211111111111112333331313131313131313131313131666 .3222BA2A22343B21111111111123A333333131313131313131313131666666 .3222BA2A22343B211111111111222A33333131313131313131313166666 {F .3222223343211111111122333333331313131313131313131313333 .322222334321111111111133333333131313131313131313131333333 .3222223343211111111111111111333331313131313131313131313131333 .322222334321111111111111113333331313131313131313131316666 .322222334321111111111111111133333131313131313131313131666666 .322222334321111111111111333333313131313131313131313131316664X  " W:$AqqqaaaabbArrrqqqrrbbbbbbccbcc1Aqqqt1qr2r1rq1rtbababaababa1aa1d1d1d1ac2222A222t3qr4r3rq3r2t2qr222ab2aa2ba2b2c3c3c3c3d3d3ab444A4445qr6r5rq5r4t4qr4qr444b4c4d4d4d5c5c5c6c6c6c666A6667qr8r7rq7r6t6qr6qr555d5d5d5d5d7c7c7d7d8c8c8888A888t9qr:r9rq9r8t8qr778c8c8d8d8d8d9d9d9d9ba9ba;::::::qq:t;qqrqqq=qqqrq=qqrr82qqqq5sqqqq5qrqq5qqqqq4qqqqqqq4qqqs4rqqq4qqqrq3qqrqs3qqqqqq3qqrqqqq2rqqqqq2sqrqqr2sqqqqq2qqrqqqq1rqrsqq1rqrqqqr1rqstqq1rqqrqqsqqqqqrqsrqqssqqtrrqqqqqtrqqsqqtrqqurqqqrqqqqqqqsrsqrqqqsqrsqqqsqqqrrqqqqqqrqqqqqqrqrqqqqrqrqqrqqqrqrrqsqrsssqqqqrrqrsrrqrrrqrrqqqsqrrrrrqq11u5u8t:r=J<<<;q;q;r;t:u:v:tq:tq9ur19us9ut9tu8utq8utr8uts8tst7qstt7utt7ttt7tut6qsusq6ttsr6tutr6tutr5uutr5tuts4uuus4qsuus3vutqqq3uutqqq2vutqqr2qtuuqrq1vqstqrr1vvtquwvtqsqvvsrt1uvtqt1twtqqq2rwtqr2qrtsrqr2wtrqs2ytsqs2wssqs2xtsqr3rttsqqr3qqrssqq4utqqq4ttqqq5rtqqqq5qtrqqq5qtqrq4rtqrqq4rtrqqq4uqqqq4rtrrqq4rtrrqqq5quqqqr5vrsrs6ursrt6trrrqr7srsrqr7srrqqq7rsrqqq7rrrsqq7qssqq7qsrqqq7qsrqq7ssqr7qqrq7rr471'5q?8q5q?8r5q?8r5r?7u4qq?5qqq4qq?5sq4qq?4qrq4qq?4qqq3qq?3qqqq3qqq?2tqq3qqq?2qqrq2rqq?2qqqr2qqq?2qqqqq1rqr?tqqq1rqq>rqrqqrrq>rqqrrqqq?rqqr1rrq?1rqq1rr?1qr1qqq?1qqr2qqr?1q25q 6q6q5q5qq4rq2qq1qqq1qqq1qqqq1qqqq1qqqqrqqqrqqqqqqqqqqqqqqqqqqqqqqqqrqq1rqq1rqq1qqq1qrqq1qqq1qq2qrq2qqq2q54: ?99q7r88bA8b8b5aa13b221a2a15a14b1q13a1qq11a1q21q1A2a1121221111299q7r88bAa8ba8ba5aa3b121aa1111q1A1qq21q2A1q1A1121221111299q7r88bA8b8b5aa3b21a111q1qq1q11q1A2114211b2c12312qyq231115171917177777;;;4  0́́́́́́́́́qāqǁ́́qqā́́́́́́́́́ba́́́́́́́́́́́́́́́́́́́́ 0ȁqāʁqƁʁqāqʁʁʁʁaaaaabbbɁǂcłeÂgi 0ȁȁȁȁqqāȁqÁqāȁȁȁȁȁȁaaaȁȁȁȁȁȁȂaǁdƁeŁfāÁhijk  ~5!!""5!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!"""5""""""""""""""""""""""""""""""""""""""""""""""""41:Q__[Qa__[aa__WaaaaOOAaßQŸQ‘tQⓂtQᕃsQᗃtQᘃtQᚃsQᛃtQᜄtQAsAQAsAQAqqAQAqbqAQAqbqAQAqqbqAQArqbqAQAqqtAQAqvAQAqqrrAQAsrtAQArqtAQAstAQAbrtAQAcqsAQAdsAQAdsAQAdsAQAbbsAQAbasAQAaarAQAabrAQAbaqAQAdrAQAdqAQAdrAQAdqAQAabqAQbaqQaaqQdqQdqQdQcQdQ™dQ™c×daOOAaaaa__WaQa__[aQ__[With the help of this pick, you just might be able to retire in a year or two. Maybe sooner, if you get really lucky!4% % %q 7qppp 7qqqq4,(                 #     /1 ( % ))*)!%%%%/8+L)) *)/ +4d  4    54)???4L%,? ???4PW^:;:;:;:;:;:;:;*?*?4e29@?>=<91%??4)"??4????<<<885522/,*4 w mjggggggggg g g g g g ggggggggggg mxk 4\$Lt<d,T| 24 Men do therefore fear Him: He respecteth not any that are wise of heart. JOB 38 Then the Lord answered Job out of the whirlwind, and said, 2 Who is this that darkens coun- sel by words without knowledge? 3 Gird up now thy loins like a man for I will demand of thee, and answer thou Me. 4 Where wast thou when I laid the foundations of the earth? de- clare, if thou hast understanding. 5 Who hath laid the measures thereof, if thou knowest? Or who hath stretched the line upon it? 6 Whereupon are the foundations thereof fastened? or who laid the corner stone thereof; 7 When the morning stars sang together, and all the sons of God shouted for joy? 4 p pw mjggggggggg g g g g g ggggggggggg mxk 4\$Lt<d,T| PSALM 23 1 The Lord is my shepherd; I shall not want. 2 He maketh me to lie down in GREEN PASTURES: He leadeth me beside the still waters. 3 He restoreth my soul: He leadeth me in the paths of right- eousness for His name's sake. 4 Yea, though I walk through the valley of the shadow of death, I will fear no evil: for Thou art with me; Thy rod and Thy staff they comfort me. 5 Thou preparest a table before me in the presence of mine enemies: Thou anointest my head with oil; my cup runneth over. 6 Surely goodness and mercy shall follow me all the days of my life: and I will dwell in the house of the Lord for ever. 4 0#: #: #: #: #: #: #: #: f#: #: #: #: #: #: #: #: # : # : # : # : # : #: #: #: #: 6#: #: #: #: #: #: #: #: # : *#: #: #: #: #: #: #: f#: #: #: #: #: #: #: #: # : # : # : # : # : #: #: #: #: Z#: #: #: #: #: #: #: #: # : # : # : # : # : #: #: *#: #: #: #: #: #: #: f#: #: #: #: #: #: #: #: # : # : # : # : # : #: #: #: #: 6#: #: #: #: #: #: #: #: # : H#: #: #: #: #: #: #: #: # : # : # : # : Z#: #: #: #: #: #: #: #: # : # : # : # : # : #: #: f#: #: #: #: #: #: #: #: # : # : # : # : # : #: #: #: #: T#: #: #: #: #: #: #: #: # : # : # : # : # : #: 6#: #: #: #: #: #: #: #: # : `#: #: #: #: #: #: #: #: # : # : # : # : # : #: #: #: #: #: #: 4 w mjggggggggg g g g g g ggggggggggg mxk 4\$Lt<d,T| EXODUS 20 And God spake all these words, saying, 2 I am the Lord thy God, which have brought thee out of the land of Egypt, out of the house of bondage. 3 Thou shalt have no other gods before Me. 4 Thou shalt not make unto thee any graven image, or any likeness of any thing that is in heaven above, or that is in the earth beneath, or that is in the water under the earth: 5 Thou shalt not bow down thy- self to them, nor serve them: for I the Lord thy God am a jealous God, visiting the iniquity of the fathers upon the children unto the third and fourth generation of them that hate Me; 6 And shewing mercy unto thou- 4 w mjggggggggg g g g g g ggggggggggg mxk 4\$Lt<d,T|ҷ PSALM 24 1 The earth is the Lord's, and the fulness thereof; the world, and they that dwell therein. 2 For He hath founded it upon the seas, and established it upon the floods. 3 Who shall ascend into the hill of the Lord? or who shall stand in His holy place? 4 He that hath clean hands, and a pure heart; who hath not lifted up his soul unto vanity, nor sworn deceitfully. 5 He shall receive the blessing from the Lord, and righteousness from the God of His salvation. 6 This is the generation of them that seek him, that seek thy face, O Jacob. Se-lah. 7 Lift up your heads, O ye gates; and be ye lifted up, ye everlasting doors; and the King н4 w mjggggggggg g g g g g ggggggggggg mxk 4\$Lt<d,T| ISAIAH 9 6 For unto us a child is born, unto us a son is given: and the government shall be upon His shoulder: and His name shall be called Wonderful, Counsellor, The Mighty God, The Everlasting Father, The Prince of Peace. 7 Of the increase of His govern- ment and peace there shall be no end, upon the throne of David, and upon His kingdom, to order it, and to establish it with judgment and with justice from henceforth even for ever. The zeal of the Lord of hosts will perform this. 8 The Lord sent a word into Jacob, and it hath lighted upon Israel. 9 And all the people shall know, even Ephraim and the inhabitant of Samaria, that say in the 4 w mjggggggggg g g g g g ggggggggggg mxk 4\$Lt<d,T| ISAIAH 53 Who hath believed our report? and to whom is the arm of the Lord revealed? 2 For He shall grow up before Him as a tender plant, and as a root out of a dry ground: He hath no form nor comeliness; and when we shall see Him, there is no beauty that we should desire Him. 3 He is despised and rejected of men; a man of sorrows, and acquainted with grief: and we hid as it were our faces from Him; He was despised, and we esteemed Him not. 4 Surely He hath borne our griefs, and carried our sorrows: yet we did esteem Him stricken, smitten of God, and afflicted. 5 But He was wounded for our transgressions, He was bruised for our iniquities: the chastis- 4 w mjggggggggg g g g g g ggggggggggg mxk 4\$Lt<d,T|ҷ DANIEL 6 It pleased Darius to set over the kingdom an hundred and twenty princes, which should be over the whole kingdom; 2 And over these three presi- dents; of whom Daniel was first: that the princes might give accounts unto them, and the king should have no damage. 3 Then this Daniel was preferred above the presidents and princes, because an excellent spirit was in him; and the king thought to set him over the whole realm. 4 Then the presidents and princes sought to find occasion against Daniel concerning the kingdom; but they could find none occasion nor fault; forasmuch as he was faithful, neither was there any error or fault found in him. н4 w mjggggggggg g g g g g ggggggggggg mxk 4\$Lt<d,T| The Gospel according to ST. JOHN In the beginning was the Word, and the Word was with God, and the Word was God. 2 The same was in the beginning with God. 3 All things were made by Him; and without Him was not any thing made. 4 In Him was life; and the life was the light of men. 5 And the light shineth in darkness; and the darkness comprehended it not. 6 There was a man sent from God, whose name was John. 7 The same came for a witness, to bear witness of the Light, that all men through him might believe. 8 He was not that Light, but was sent to bear witness of that Light. 4 w mjggggggggg g g g g g ggggggggggg mxk 4\$Lt<d,T| The epistle of Paul to the ROMANS Paul, a servant of Jesus Christ, called to be an apostle, separ- ated unto the gospel of God, 2 (Which He promised afore by His prophets in the holy scriptures,) 3 Concerning His Son Jesus Christ our Lord, who was born of the seed of David according to the flesh; 4 And declared to be the Son of God with power, according to the Spirit of holiness, by the resur- rection from the dead: 5 By whom we have received grace and apostleship, for obedience to faith among all nations, for His name: 6 Among whom are ye also the called of Jesus Christ: 7 To all that be in Rome, beloved of God, called to be 4 w mjggggggggg g g g g g ggggggggggg mxk 4\$Lt<d,T| ROMANS 10 8 But what saith it ? The word is nigh thee, even in thy mouth, and in thy heart: that is, the word of faith, which we preach; 9 That if thou shalt confess with thy mouth the Lord Jesus, and shalt believe in thine heart that God hath raised Him from the dead, thou shalt be saved. 10 For with the heart man believeth unto righteousness; and with the mouth confession is made unto salvation. 11 For the scripture saith, Whosoever believeth on Him shall not be ashamed. 12 For there is no difference between the Jew and the Greek: for the same Lord over all is rich unto all that call upon Him. 13 For whosoever shall call upon the name of the Lord shall be 4 w mjggggggggg g g g g g ggggggggggg mxk 4\$Lt<d,T| The FIRST Epistle of JOHN That which was from the begin- ning, which we have heard, which we have seen with our eyes, which we have looked upon, and our hands have handled, of the Word of life; 2 (For the life was manifested, and we have seen it, and bear witness, and shew unto you that eternal life, which was with the Father, and was manifested unto us;) 3 That which we have seen and heard declare we unto you, that ye also may have fellowship with us: and truly our fellowship is with the Father, and with His Son Jesus Christ. 4 And these things write we to you, that your joy may be full. 5 This then is the message which 4 w mjggggggggg g g g g g ggggggggggg mxk 4\$Lt<d,T|ҷ REVELATION 22 And he shewed me a pure river of water of life, clear as crystal, proceeding out of the throne of God and of the Lamb. 2 In the midst of the street of it, and on either side of the river, was there the tree of life, which bare twelve manner of fruits, and yielded her fruit every month: and the leaves of the tree were for the healing of the nations. 3 And there shall be no more curse: but the throne of God and of the Lamb shall be in it; and His servants shall serve Him: 4 And they shall see His face; and His name shall be in their foreheads. 5 And there shall be no night there; and they need no candle, neither light of the sun; for the н4  D 0 4 88'23QX!)  3d33c32P2 2O 2+|3^^z Wdz P9R@P P]bQ P]e Or&#@p QO 0p QOP o Qr o Qr c'FGdX{ 0 4 8 T$e 0 l^0 4^4{{e 0 l^0 4^4k! e  e k^48E{ 0 4 8({  M{{  S P QQ $ k  $ k Q $ k Q $ k ^4e "XZ 4 0=e KLNOPQRSTUVWeXYeeze oe |{Qpooooe Wpooe ?poooe $|'pooe ope 0e 4  TcXYeejynynyjyjny 1eej 4 J e;XY * 0 4 0e 4 e .:EoK:-Which mule?What mule?A dandy idear, but try it a little later!Ya got too far behind! That mule is long gone!!This ol, mule has a hard time leadin' the fleas on its back! It won't take ya anywhere!Ya best try that when yer outta town!I guess ya better try that somewhere else!!Ya better keep an eye on that mule of yers; it just got away!!Try that somewhere nearby!!Yer right on his tail!!Oooops! The mule went another direction!!Try that just a smidgen further outta town!Yer already followin' that ol' mule!Ya shouldn't run off while yer mule's just wanderin' around. You've gone and left yer mule behind!!Yer branding iron is cold!Ya ain't got a branding iron!Why? Ya got two strong legs of yer own!There's James' mule. Don't let it get away!This mule is slow and lazy. If you had a trusty mule, it may mean the difference between poverty and riches!4 r8?8A8B8C8D8F8H8I8J8L8M6 Bgg BBgg:8O8Q8R8U8 g g  H8< Z2 H8= [Z H8@ [Z H8E<t [Z H8G<t [Z H8P 8OZ[e [ZF F8UZ[e [ZF F8Wc[Z</+7!)T+/CX6%\#I ! eGee8PJFHC H8Z[\8<58=ZZVZ+8?$8@88U@@8+8A%8BG8C%8D&8P$88QP88RP8P88E8P88UEE8 +8F&8G!8P88 UG8GG8 +8H&8I%8J'8K+8L'8M)8NH8O+ ee rr  6 err .ee e e e!e ^ ^ ^ ^ ^ ^``^ #^# $^$ %^% &^& '^' (^( )^) *^* +^+ ,^, -^- ^ .^. AgZZ[Z[\[;<T )8Ue$e"e#E8e  %)B[t 53 O  messages displayed messages suppressedCtrl-n for next scene Your family photo was in your pocket so you still have that.Bad news! The boiler on this steamer has just blown sky high! You are on your way down!You're feeling a little strange and your gums are bleeding. You don't know exactly what is wrong, but something isn't right!Lately you have been feeling a little nauseous, a few cramps here and there and slightly dehydrated.You are in the midst of a terrible storm and the ship is taking on water.Everything that wasn't absolutely essential to the continuation of the voyage has just been thrown overboard.Everything you brought, except for the clothes on your back, is now gone.Fortunately, the gold coin was in your pocket so you still have that!Jake's letter, along with the gold flake under the stamp, was in your hip pocket so that is still with you.Jake's letter was in your hip pocket so that is still with you.The Bible wasn't thrown overboard. Everyone agreed to keep that.Everything else now belongs to the raging sea.From time to time during your voyage you eat the fruit you so wisely brought along. It has kept you healthy so far!You don't have any fruit to eat.Eating fruit won't help what you've got.Eric was buried at sea.4 )8?8A8B8E8H8L8c8N8Q6 Bgg BBgg^8D8F8G8I8J8K8S8T8U8V8W8X8Y8f g g 8<8 H8< Z28 H8= [Z H8@ [Z H8VZ[e [ZF FH H8Z[\8<58=8?#88A#8B(8C"8D38E(8 48G\8H(8 ]8^8_8L(8M`8c(8N#8Q)8RHZZ[Z[\[%0 'ee>Wp messages displayed messages suppressedCtrl-n for next scene Lately you have been feeling a little nauseous, a few cramps here and there and slightly dehydrated.Since you have entered the humid tropics, whenever necessary you have worn the mosquito net to keep those pests from biting you!You don't have any mosquito net.4 w mjggggggggg g g g g g ggggggggggg mxk 4\$Lt<d,T| GENESIS 1 1 In the beginning God created the heaven and the earth. 2 And the earth was without form, and void; and darkness was upon the face of the deep. And the Spirit of God moved upon the face of the waters. 3 And God said, Let there be light: and there was light. 4 And God saw the light, that it was good: and God divided the light from the darkness. 5 And God called the light Day, and the darkness he called Night. And the evening and the morning were the first day. 6 And God said, Let there be a firmament in the midst of the waters, and let it divide the waters from the waters. 7 And God made the firmament, and divided the waters which were 4 3s)~Fcc~~2cc~s <^< =^= >^> ?^? @^@ A^A B^B C^C D^D E^E F^F G^G H^H I^I J^J K^K L^L M^M N^N O^O P^P Q^Q R^R S^S T^T U^U V^V W^W X^X Y^Y Z^Z [^[ \^\ ]^] ^^^ _^_ `^` a^a b^b c^c d^d e^e f^f g^g h^h i^i j^j k^k l^l m^m n^n o^o p^p q^q r^r s^s t^t u^u v^v w^w x^x y^y z^z {^{ |^| }^} ~^~ ^ ^ ^ ^\KfC f~s;~:]s4   9^q% 2aq2c1b1112321q1q1q1q1q1Aq1qA1q112A2A2B2B2B2A1A2A1A2A1A2B2B2A2A12A2 2aq2c1b1112321q1q1q1q1q1Aq1qA1q11A1B2B2B2B2AA2A1A2A1A2A1A1B1A1A2A1A21A212aq2c1b1112321q1q1q1q1q1Aq1q1qA12A2A2B2B2AA2A1A2A1A1B1B1A3A1A3AB3AA4A32aq2c1b1112321q1q1q1q1Aq1q1q1q112A2B2A2B2AA2A1A2A1A1B1AA2AA2A3A3 2aq2c1b1112321q1q1q1q1Aq1q1q111A2B2B2B3B3A3A3A2A2A1B2A3A3 2aq2c1b1112321q1q1q1q1Aq1q1111B2B2B2AA2AA2A1A2A1A2A1A2A2B2A2A12A2 2aq2c1b1112321q1q1q1q1q111A1aA1aA2B2B2AA2AA2A1A2A1A2A1A2A1A1B1A1A2A1A21A212aq2c1b1112321q1q1q1Aq1q11111B1B2B2C2AA2A1A2A1A2A1B1B2A1A3A1A3AB3AA4A32aq2c1b1112321q1q1q1q1Aq1q1111A2B2B2C2AA2AA2A1A2A1A1B1A1A2AA2A3A3 2aq2c1b1112321q1q1q1q1q1Aq1q1q112A2B2B2C3B3A3B2B1B112A3A3 `Z"2qb21bb111A22321q1q1q1q1q1AqA1q1q11A1B2C2A1A2A1A2A1A2A1A2A1A2A1A2A1A2A1A2A1212"2qb21bb111A22321q1q1q1q1qA1Aq1q1q11Aa2C2C2A1A2A1A2A1A2A1A2A1A2A1A2A1A2A12A12A22"2qb21bb111A22321q1q1q1q1q1AqA1q1q11A1B2C2A1A2A1A2A1A2A1A2A1A2A1A2A1A2A12A22"2qb21bb111A22321q1q1q1q1q1AqA1q1q12A2B2C2A1A2A1A2A1A2A1A2A1A2A1A2A1A2A1A21A214"2qb21bb111A22321q1q1q1q1Aq1qA1q1q22A2C2C2A1A2A1A2A1A2A1A2A1A2A1A2A1A21A21A4A44"2qb21bb111A22321q1q1q1q1q1AqA1q1q12A2B2C2A1A2A1A2A1A2A1A2A1A2A1A2A1A21A4A44  2b1aa1c11223211111A1A1112QQ2AQA2B2A12A1A2A12A1A2A1A2A1A2A12A1q2A2 2b1aa1c112232111111A1A122QQ2AQA2C2A12A12A1A2A1A2A1A2A1A2A1A2A12A2A2 2b1aa1c112232111111AA1112QQ2AQA2C2A12A1A2A1A21A2A1A2A1A2A1A21A2q12q 2b1aa1c112232111111AA1111QQ2AQA2B2A1A2A1A21A2A1A2A1A2A1A21A2q1A4A4 2b1aa1c11223211111A11A111QQ2AQA2C21A21A2A1A2A1A2A1A2A1A2A1A21A4A4A4 2b1aa1c112232111111AA1111QQ1AQA2C21A2A1A2A12A1A2A1A2A1A2A1A2A121q4q4 s   oR72aq2c1b1112321q1q1q1q1q1Aq1qA1q112A2A2B2B2B1AA42aq2c1b1112321q1q1q1q1q1Aq1qA1q11A1B2B2B2B12A22aq2c1b1112321q1q1q1q1q1Aq1q1qA12A2A2B2B11A22aq2c1b1112321q1q1q1q1Aq1q1q1q112A2B2A2A11A2aq2c1b1112321q1q1q1q1Aq1q1q111A2B2B2B13B1A32aq2c1b1112321q1q1q1q1Aq1q1111B2B2B22AA1AA1A2aq2c1b1112321q1q1q1q1q111A1aA1aA2B2B2AA2AA1A222aq2c1b1112321q1q1q1Aq1q11111B1B2B2C2AA1A122aq2c1b1112321q1q1q1q1Aq1q1111A2B2B2C2A1A22aq2c1b1112321q1q1q1q1q1Aq1q1q112A2B2B1C2B %B2qb21bb111A22321q1q1q1q1q1AqA1q1q11A1B2C2A1A2A1A2A1A2122qb21bb111A22321q1q1q1q1qA1Aq1q1q11Aa2C2C2A1A2A1A2AA1A122qb21bb111A22321q1q1q1q1q1AqA1q1q11A1B2C2A1A2A1A2A1A1A132qb21bb111A22321q1q1q1q1q1AqA1q1q12A2B2C2A1A1A1A2AA1A1A3q2qb21bb111A22321q1q1q1q1Aq1qA1q1q22A2C2C2A1A2A1A2AA2A1A212qb21bb111A22321q1q1q1q1q1AqA1q1q12A2B2C2A1A1A1A1A1A3A21 zI2b1aa1c11223211111A1A1112QQ2AQA2B2A11A1A2A21112b1aa1c112232111111A1A122QQ2AQA2C2A11A11AA42b1aa1c112232111111AA1112QQ2AQA2C2A12A1A2A212b1aa1c112232111111AA1111QQ2AQA2B1A1A1AA3A312b1aa1c11223211111A11A111QQ2AQA2C21A2A12A122b1aa1c112232111111AA1111QQ1AQA2C21A2AA1264 "  4aq4b2c3c334211q1qq1q1A1C2B21A1AA1A1Aq1A1Aq1A354aq4b2c3c334211q1qqq1q1A1C1B11AA1AA1A1Aq1A1A11A34aq4b2c3c334211q1qqq1q1A1C1B1AA11AA1A1A1A1A11A4aq4b2c3c334211q1qqq1q1A1C1B11AA11AA1A1Aq1A1A11A34 .:OONA AAokAAbabAAaa aAAa aAAaa aAAaa aAAaa aAAaaaAAaAAqaAAsAArAAaraAAaraAAaraAAaraAAaraAAarraAArrAAss AAtrr AAtrrq AAsrrq AAsrrq AAtrrq AAtrsq AAtqrq AAtqrAAtrqAAtrqAAtrqAAtrqAAtrAAa tsqAAa tsqaAAa tsaAAa ssqaAAa ttaAAa zqaAAa yqaAA xAA wqAA vqAA srAAa rraAAa raAAaaAAaaAAaaAAaaAAb bAAokAA AOONThis might be the shovel that helps you strike it rich!4 /: a䟟aa៟aR__QRQ__QQQ__[QQ__YQRQQRQ QR RQ QQ QQ QQ QQ QQ QR RRrqRRqsRRqRRqtRRrrRRqsqRRrrsRRqqtqRRqqqrrRRrtRRqrqqRRqqqqsRRqtrRRqrqRRrqrRRqqqqRRqrqRRqqqq RRqqqq RRqqqq RR rqqqq RR qrqrq RR qqq q RR qrqRRsRRRR RR RQ QQ QQ QQ QQ QR RRRQQQQR__YRQ__YQQ__[QQ__QQaR៟Raa䟟aThis string is very fine and thin. Its intended purpose must be an easy one!4 /9R__TQOOIQA AA AA AA AA AA AA AA AA AQA AQA AQAaAQAaAQAaAQA aAQA abAQAaaa AQAaaaa AQAabacAQAaaaaabaAQAaaaaaacaAQAababaaaAQAaababdAQAaaaaaAQAbaaabac AQAaaababaa AQAbaaaaaacaAQA aaaaaab AQAbaaAQAaabab AQAbadbAQAaacbaAQAacbcaAQA aAQA  AQA AQA AQAa AQA aaAQAcAQAaAQAAQAAQAAA AA AA AA  AA  AA  AA AA AQA AQOOIR__SYou are heaping gold upon gold!! You hope it never ends!!4 .:OONA AAokAAb bAAaaAAaaAAaaAAaaAAaaAAa r aAA wAA tvAA trsAAwsAAaasuaAAaasrsaAAaasssaAAaasssaaAAaasssaaAAaaursaaAAatrtaaAA atxcAA austcAA arvucaAA acxeAAaacaaucaAArbcasbbaAArbbccAAarebcabAAbrababab AAaqabba AAracaa AAaracab AAbcrbba AAaaaaba AAaaaaaba AAaaabaada aAAababafb aAAaaaabbaaAAabadaAAabadaAAa faAA baAA aAA aaAAcAAaaaAAaaAAaaAAaaAAaaAAaaAAb bAAokAA AOONThese matches are from yer brother's cabin!4 @.:OONA AAokAAb bAAaaAAaaAAaaAAaaAAaaAAaaAAAAAAAArAAauaAAawaAAa yaAAa xaAAaxaaAAaxcaAAtfAAqarhqAAaqed sAAck rqAAceg rrAAccefrrAAdkfsrAAcdbcetrqAAgbhtrqAAdcgbrsqAAcccgqsqAA eccdsq AA hcdrq AA jcqq AA hbqq AAa jq AAahr aAAadqaAAa aAAa aAAa aAAa aAAqrrqqrqqqAAqqqqqqqqqqqqrrAAsrrqqqqrsuAAqqqqqqqqqqqqqqqqAAaqqrqqqqqqqqqqaAAaaAAaaAAaaAAaaAAaaAAb bAAokAA AOONAs stubborn as our friend may be, just leave it to him and he'll lead you to me!4 f"/:RS_ZSQQ_XQBBOFBB៖A៟AAAAAQQ㟑RQ A AAAAAA A Q╂QAAQAAQA AQA AQA AQAAQA AQAAQAaAQA cAQA bAQAcaAQAcAQAcqAQAbrAQAcqaAQAcqAQAqbqaAQqAqrAqArAAqArAAqArAABAqqAQ⟒qBR⟑ AQ㟑AQDBAAAAA៟A៖BBOFBBQQ_XQRS_ZSIt has a worn, black leather cover. The pages are edged with gold.4 /:Q__WQ__WbOOEbr rr  raa aaQQd dQAAQA AQA AQA AQA AQA AQA AQA AQA i AQA m AQA ccAQAazaAQAassaAQAaqraAQAqerAQAqaarAQAqrAQArarAQAqarAQAarbbrqAQAasgsaAQAaqyqaAQAaaAQAbqqbAQA bqqb AQA fqqf AQAodAQAaoaAQAbibAQA ccAQA i AQAAQA AQAAQAAQA  AQA  AQA  AQQ bbrrrrOOEaaaa__Wd__WdThis solid gold disk was lost on the ancient Spanish road in Panama centuries ago. It is priceless!4 /:Q__YQa__Yaa__UaaaaONaßQŸQŸQ⟘Q៖yQ៕tsQ។rurQ្qzqQ៑rusqQqstrQAqsyqAQAqrusAQAqrttrAQAqrtyqAQAqrszqAQAqqs}AQAqrr~AQAqrrAQArqrAQAqrqqAQAqrqqAQArqrqAQAqrqqAQArqrqAQAqrqqAQArqrAQAqrqqAQAqrqAQAqqr~AQArqq~AQAqrq~AQAqrq}AQAqrq|AQAqrq{AQAqrqxAQAqrrvAQArrqqAQArrAQᔁrQᕁQQQ៟Q៟Q⟟QŸQŸßaONaaaa__UaQa__YaQ__YIf a man knows how to operate a pan properly, he can be a rich man!4 3/:OOOA AA AA AA AA AA AA AA AAAA dAAaj AAdoa AAonaAAooaAAooaaAAooaaAAoobaAAoobbAAohhaAAoggAAogbhaAAofbgaAAofdhAAofdhaAAofdhaAAofdiaAAofcbfaaAAogcafaaAAogcgaAAogbafAAohaafaAAohbhaaAAofalAAoemAAoeanaAAoeanaAAoenaAAofoaAAoogaaAAoogaaAAoogaAAoogaAAhomaAAhombAAholaAAholaaAAholaaAAholaAAholaaAAhokaAAhojaAAhojbAAgoiaaAAgoiaAOOOThis trusty, high-spirited and stubborn mule bears a special brand!4 P/:Q__YQa__Yaa__UaaaaONaßQŸQŸQ⟟Q៟Q៟Q៟Q៟Q៟Q៟QAsAQAsAQAsAQAsAQAsAQAsAQAsAQAsAQAqsAQArsAQArsAQAqsAQAsAQAsyAQAsyAQAqsAQArsAQAs񃟕AQAs񃟕AQAssAQAssAQA񃟖AQAs񃟖AQAsAQAsAQAsAQAAQA񃟓AQ្sQ្񃟕Q៟Q៟Q៟Q៟Q⟟QŸQŸßaONaaaa__UaQa__YaQ__YBranding irons are a fairly common article around the area, but this is a rare brand indeed!! Looks like a horseshoe and a key!!4 9/:aOOGaaOOGaR__QRQ__QQQ__[QQ__YQRQQRQQARRAQQAQQAQQAQQAQQAQQARRARRARRARRARRARRARsRARuRARrrRARrrRARrsRARrrvRARrrRARrrRARrrRARrrrrRARrrrrRARurrRARsrRARrRARRARRARRARRARRARRARRARRARRAQQAQQAQQAQQAQџQRRRџRQQQQR__YRQ__YQQ__[QQ__QQaROOGRaaOOGaYou have in your possession a steel key. Its purpose is very special.4 */:OOOA AA AA AA AA AA AA AA AAAA dAAaj AAdoa AAonaAAooaAAooaaAAooaaAAoobaAAoobbAAohhaAAoggAAogbhaAAofbgaAAofdhAAofdhaAAofdhaAAofdiaAAofcbfaaAAogcafaaAAogcgaAAogbafAAohaafaAAohbhaaAAofalAAoemAAoeanaAAoeanaAAoenaAAofoaAAoogaaAAoogaaAAoogaAAoogaAAhomaAAhombAAholaAAholaaAAholaaAAholaAAholaaAAhokaAAhojaAAhojbAAgoiaaAAgoiaAOOOThis slow, lazy and awkward mule serves a special purpose!4 k/: a䟟aa៟aR__QRQ__QQQ__[QQ__YQRQQRQ QR RQ QQ QQ QQ QQDQQEQRFRRHRRCCRRCCRRCBRRBBRRBCRRCCRRBBRRBBRRBBRRBBRRBBRRrBRRrrRRrrRRsrRRrrRRrrRRrrRRrrRRrrRRrrRRrrRRrrRRrRRrRR RR RQ QQ QQ QQ QQ QR RRRQQQQR__YRQ__YQQ__[QQ__QQaR៟Raa䟟aThis magnet was left ot you by your brother, so there must be some good reason for it!4 m/: a䟟aa៟aR__QRQ__QQQ__[QQ__YQRQQRQ QR RQ QQ QQ aQQcQQfQQhQR oRR obRR aefcRRabdeRR fhRR daebRR cfbRR ibbRR faeRR baah RRbhb RRgbc RRfbd RRbbi RRbl RRchb RRgc RRfaf RRffbaRRcedaRRiebRRfeb RRdai RRjd RRhaRRccRRiRRhRRbRQ QQ QQ QQ QQ QR RRRQQQQR__YRQ__YQQ__[QQ__QQaR៟Raa䟟aDear Jerrod, Thanks for coming! If you're looking for gold, then find me. Make sure no one follows you! Your brother, Jake Alias, James Wilson Marshall4      %                   &               % 4   z`]W2s1r1rq1r1q232q1r1s1r1sststt1s1s2r2s2s2q1q2q1q2q1q2s2r2r2q1q2q2r2s1r1rq1r1q232q1r1s1rtstuuu1s1s1r2s2s2s2q1q2q1q2q1q1r1q1q2q1q2q1q3q1r2s1r1rq1r1q232q1r1s1r1sstuuu1s1s2r2s2s2q1q2q1q1r1r1q3q1q3qr3qq4qr3r2s1r1rq1r1q232q1r1s1r1s1r1s1r1s1s1s1s2r2r2s2s2q1q2q1q1r1qr2qr2qq3qq3r2s1r1rq1r1q232q1r1s1r1s1r1s1r1s1r1r1r2r2r3r3r3r3r2r2r1s2r3q3r2s1r1rq1r1q232q1r1s1r1sstsqusqt1qq1qq2s2s2q1q2q1q2q1q2r2r2r2q1q2q2r2s1r1rq1r1q232q1r1s1rtsusqusqtqr1r2s2s2q1q2q1q2q1q2q1q1r1q1q2q1q2q1q3q1r2s1r1rq1r1q232q1r1s1r1sstsqusq1s1qq2r2s2q1q2q1q2q1r1r2q1q3q1q3qr3qq4qr3r2s1r1rq1r1q232q1r1s1r1s1r1s1r1s1r1r1r2r2r2s2s2q1q2q1q1r1q1q2qr2qq3qq3r2s1r1rq1r1q232q1r1s1r1s1r1s1r1s1s1s1s2r2r2s3r3r3r2r1s1q1q2r3q3r !1 2s1qq1rr1q1qq232qq1rr1u1rr1u1rr1u1rr1u1u1rq1r2s2s2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q 2s1qq1rr1q1qq232qq1rr1u1rr1u1rr1u1rr1sq1r1s2s2s2s2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q2q2q 2s1qq1rr1q1qq232qq1rr1u1rr1u1rr1u1rr1u1u1rq1r2s2s2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q2q2q 2s1qq1rr1q1qq232qq1rr1u1rr1u1rr1u1rr1u1u1qr2r2s2s2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q1q4q 2s1qq1rr1q1qq232qq1rr1u1rr1u1rr1u1rr1qs2r2s2s2s2s2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q1q4q4q4q 2s1qq1rr1q1qq232qq1rr1u1rr1u1rr1u1rr1u1u1qr2r2s2s2q1q2q1q2q1q2q1q2q1q2q1q2q1q4q4q4q |^>2s1u1u1u1u2s32s1u1u1u1u1u1u1u1u1u2t2s2s2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q2q2s1u1u1u1u2s32s1u1u1u1u1u1u1u1u2t2s2s2s2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q2q2q2s1u1u1u1u2s32s1u1u1u1u1u1u1u1u1u2t2s2s2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q2s1u1u1u1u2s32s1u1u1u1u1u1u1u1u1u1t1s2s2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q1q4q4q2s1u1u1u1u2s32s1u1u1u1u1u1u1u1u1t1s2s2s2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q1q4q4q4q2s1u1u1u1u2s32s1u1u1u1u1u1u1u1u1u1t1s2s2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q1q2q1q4q4 &  W= ,32222223A4A3A3A22q22q22q11q11q12q2223333444444444444144 +32222223A4A3A3A22q22q11q11q11q11q1113333333131313131212222232322 *32222223A4A3A3A22q22q22q22q22q22q22233333313121231313144555 +32222223A4A3A3A22q22q22q22q22q222223333333322211123445 ,32222223A4A3A3A22q22q21q11q1112222333444443322223444 ,32222223A4A3A3A22q22q11q11q1111111A3333333444333312122232 +32222223A4A3A3A22q22q21q11q11122223333332122222222121313454 *32222223A4A3A3A22q22q22q22q222222233333121222223231344667 +32222223A4A3A3A22q22q22q22q22q222223334455443221213131326 n .3222A2A223AA4B32q11r11r11r11r11r111A1A133331313131313131313131313131333 .3222A2A223AA4B32q11r11r11r11r11r111A223333131313131313131313131333333 .3222A2A223AA4B32q21r11r11r11r11r1111A113333131313131313131313133333 .3222A2A223AA4B32q11r11r11r11r11r1112233331313131313131313131313131666 .3222A2A223AA4B32q11r11r11r11r11r111A223333131313131313131313131666666 .3222A2A223AA4B32q11r11r11r11r11r1112A23333131313131313131313166666 ep .322222234321111111111112223333131313131313131313131r3333 .322222234321111111111111223333131313131313131313131333333 .32222223432111111111111122333313131313131313131313131313r3r3r .32222223432111111111111112333313131313131313131313r16666 .322222234321111111111111123333131313131313131313131666666 .32222223432111111111111112333313131313131313131313131316r6r6r4 {  fR !#%1"#!!!2!*1A!A1qA2"A!!111qq2q1A1!1q2 !3"121A"#2$312q3q2!7!2 !##!12&8&)"!!AqAzqqrqq AAAqqqqAA"qqw$r!#!q%"q##v!!sBtsvr{ AAAAAAqqqqqqqqBqArqqq!ABeAACiCuAqAItAqAwuqqqqqqs ACAqAAAqqqAqBBEABAqrAwA!qqqqHqqqD!"A!qD'!|aDaqqqqqqqaaaaaaa arA×AsAA$A!!%u!r#q!qAq!r#qB!BrEqDtcsbFqrrrrrqrr qqqqqCA!!CA"q¡""sq##a1$r!$!C"a"rA"C#A"qB%A$Cs#crqqqeqqrrqccq qqqqqqqAAAqAšAA“!AAAqA’!qAA!qqqqqq"Aqq!!r!AA"qrBrqAq"!BsA"CrAbqBArAaaArBbqsca qqqqAqqqrAqqqAAqAAAqqA!AaAa"Aq!qqqqqCqqqbqqAqaaabAACgrqrgaba qqqqqqqq!q!"qq#qqq#qqqq"qqqq"rsaqqqDBaBqqBtCqBqqqrCrqqq qq!"!#!AAA%"AAAa"!!qqq#ausqbrrAaabqabaaaegc AAq!AAAB#Er#CÑA"q#qAAr"a!qsCAqa!aqqqqqaqarBAqCqBdqBqB1q1q1qaAqAqqq4  56 qqqqqqqqqqqqqqqqqq qiqa1a1a1a1aqaaaaaBBqcAAq AAqBBqq1111qAqaqAwAAAAAAqC BqCqCqFAAHOHAAAFqOHAAAF M56 qqqqqqrqrqrqqqqqqqqqqqqqqqqqqqqq qiqa1a1a1a1aqaaaaaBBqcAAq AAqBBqq1111qAqaqAwAAAAAAqC BqCqCqFAAHOFqAAAAEqqqODqqqAACqqqqq56 qqqqrrrqqqqqqqqqqqqqqqqqqqqqqqq qiqa1a1a1a1aqaaaaaBBqcAAq AAqBBqq1111qAqaqAwAAAAAAAqC BqCqCqDAAAFOFqAAAADqODqqAADqqqqqq4 q  #9Rq1r1rq2q3q1qq1qq3q1qq2qq1q2q1qq1qq3q4 _ a1211212111211111211312221117222?1'121113121111 9q9q8r8rrrqqrqqqqqqqqqqr*1211111111111  14qqqrqqqqqqqrqq 2221Q3!!1!"1!!Q!!ѡa"1""2"a4 D}&b 21qqqqqqqqqqqqqqqqqtrtrrqqrqrqqqrqqqqqqq1q12 1q11r1qrqqqqqq1211qrqrqrrqqqqqqqq3q3q2rqqrqqqqqqrqrq rrqssqqqrr2 rqrrqqrqqrqtqrrqqrrqt2r4 {   -X<!311A111A2332q222q2q22qq22r2222333222111q233q3"311A111A2332q222q2q222q22q2q2222333321q122q3"311A111A2332q2222q222q2q2q22q22233133222q22q12"311A111A2332q222q1q1q11q1q1qq22222222121222212113q1q311!311A111A23322q11qrq1q1qqqq1122222221212133q4q2!311A111A23322q21q1r1q111q1q1q222222212111q233q3"311A111A23322q22q1q1q1q11q1q22q222333321q122q3"311A111A23322q22q2q2222q22q22222212212122q22q12"311A111A23322q2q2222q22q2r22222222121222212113q1q311!311A111A2332q2222q222q2q2r2222222111121334q4q2 Cy!2111AA1A12A321qq1q1q11q11q111222121212121212121q2q1212!2111AA1A12A321qq1q1q11q11q1q122221212121212121q21212q22!2111AA1A12A321qq1q1q11q11q111q2221212121212121212q22!2111AA1A12A321qq1q1q11q11q11q1q22212121212121212q121q214!2111AA1A12A321qq1q1q11q111q22222121212121212q121214q44!2111AA1A12A321qq1q1q11q11q11q1q2221212121212121214q44 z!2111112321111111q1q1q22221212121212121q2121q2q2!2111112321111111q1qq22222121212121212121q2122q2!21111123211111111qq1qq1q22212121212121212q121q2q12q!2111112321111111q1qq1qq1222121212121212q1212q14q4!2111112321111111q1q1112212121212121212q12144q4!21111123211111111q1q1222121212121212121q2q121q4q4   (I`$())r!)q(aA'!a)&q)%!q)q%#q)q$$q)r")sA%q)rA!$q)s)qr!$q)q$$q+b)".aq)")"c)E#)ca&CB#b&e#CEA#ab#f!BBCA"cbadq!CCAA!fa!bq!ACCAA!hba"q!ABAqCqAA!haAa!ABAqCqAA!eCrB!ABBqAqBAaFa!AACqAqCFac!AAqAqAArBqdcBAArAq!!brbbq!D##!b"rc!A"##!c#qb$!r"!b(b$q!!!r!a)b!$#q!q"q!b)a!%"!""!a)a%!q#q!#!b'b%!#q!#!a'a&#%!(a&#%!(a('*$())r!)q(aA'!a)))q'q)q&#q)r#)s!&q)rA!)s$q)qr!)q$#q,b)".aq)")"c)E#)ca&CB#b&e#CEA"ab#f!BBCA!cbadq!CAAAA!fa!bq!ACBqBAA!hba"q!ABCqCA!haAa!ABqBqBqAeCrB!ABBqBAaFa!AABAqAqBFac!AABAqABBecBACqqB!!cqbbq!Dsq"!!b!rc!A""s!b#c$##"b&b!$"q!!"!!a'b"$"!!"!!a(a#%"q"q""a(a#%"q"""a(a#%#q#""b'a#&"q"##a'a"&!q!#"a&a!(%"&$())r!)q(aA'!a)))q')q&"q)r##q)s!&q)rA!%q)s$q)qr!)q$#q)"#q,b)"!q'#aq)E#)c&CB#b&ca#CEA"ab#e!BBCA!dbae!CCAA!fdq!ACCAA!hba!bq!ABAqCqAA!haAa"q!ABAqCqAAeCrB!ABBqAqBAaFa!AACAqCFac!AAqAqAArBqdcBAArAq!!crbbq!D##!!c"rc!A"##!b$qb$!qq""c)b$!!!r!b*b$#q!q"q!a+a%"!"#a)a!%!q#!$a(b!%!q#q!$a'a"&#%a!'!&#%a)!('+$())r!)q(aA'!a)&q)%"q)q%#q)q$%q)r")sA'q)rA)r"$q)t)qr!$q)"/!b)!*#aq)E"*c&CB"c&ca#CEA#d#e!BBCA"acae!CAAAA!edq!ACBqBAA!hba!bq!ABCqCA!haAa"q!ABqBqBqA!eCrB!ABBqBAaFa!AABqAqAqBFac!AABAABBqdcBACqqB!!crbc!Drq"!c"re!A""qs!c#rc$##!b(c$"q!!q"!b)b$"!!"!b)!a%q"q"q"a")"a%"q""a"("a%#q#"a#(!b&"q"#a#(!&!!#a"'(%"'4   m0(/&/&r/&q/%qA/&q/&&q/&%!q/&q%#q/&q$$q/%"/%1A%q/%11A!$q/%1/%!$q/%$$q+b/%".aq/&")"c'&$#)ca!GGGB#b&e!#ab#f!ABGAC"cbadq!AAAGCAA!fa!bq!BqBGCAA!hba"q!CqCFqCqAA!haAa!qBqBqFqCqAA!eCrB!BqBFAqAqBAaFaAAqAqADAAqAqCEacqqqqqqrCqdcBqqCDArAqBBbrbbq!sq!b"rcqs"c#qb##$!r"!!b(b"q!!"$q!!!r"a)b!"!!"$#q!q"q"b)a!!"q"q&"!"#!a)a!"q"&!q#q!$!b'b!#q#&!#q!$!a'a""q"(#&!(a"!q!(#&!(a$,(*0(/&/&r/&q/%qA/&q/&/&/&q'q/&q&#q/%#/%1!&q/%11A!/%1$q/%!/%$#q,b/%".aq/&")"c'&$#)ca!GGGB#b&e!"ab#f!ABGAC!cbadq!CGAAAA!fa!bq!CGBqBAA!hba"q!AqCqAFCqCA!haAa!AqCqAFqBqBqAeCrB!BqAqBFBqBAaFaBAqBDBAqAqBEacqqqrqqqCecArqADCqqCBcqbbq!sq!!b!rc!qs!!b#c!qq"$###b&b!!!!r$"q!!""!a'b"#q!q"q$"!!""!a(a#!"!"&"q"q#"a(a#!!q#!&"q"#"a(a#!!q#q!&#q##"b'a#"#("q"$#a'a""#(!q!$"a&a!$,&"&0(/&/&r/&q/%qA/&q/&/&/&q'/&q&"q/%##q/%1!&q/%11A!%q/%1$q/%!/%$#q/%"#q,b/&"!q'#aq'&$#)c!GGGB#b&ca!"ab#e!ABGAC!dbae!AAGCAA!fdq!BqBGCAA!hba!bq!CqCFAqCqAA!haAa"q!qBqBqFAqCqAAeCrB!BqBFBqAqBAaFaAqAqAqBDCAqCEacqqqqqrCqdcBqqCDArqABcrbbq!rq!!c"rc!qs!!b$qb##$!qq"#c)b"q!!q"$!!!r"b*b"!!"$#q!q"q"a+a!q"q"q&"!"$a)a!!"q"&!q#!%a(b!!#q#&!q#q!%a'a"""q"(#&a!'!"!!(#&a)!$,(+0(/&/&r/&q/%qA/&q/&&q/&%"q/&q%#q/&q$%q/%"/%1A'q/%11A/%1"$q/%/%!$q/%"/!b/&!*#aq'&$"*c!GGGB"c&ca!#d#e!ABGAC"acae!CGAAAA!edq!CGBqBAA!hba!bq!AqCqAFBqCA!haAa"q!AqCqAFqBqBqA!eCrB!BqAqBFqBqBAaFaBqAqCDAqAqAqBEacqAqqArqqCqdcrqADCqqCBcrbc!rq!c"re!qs"c#rc!r"$##!!b(cq!!!r$"q!!q""b)b#q!q"q$"!!""b)!a!"!"&q"q"q#a")"a!!q#q!&"q"#a"("a!!#q!&#q##a#(!b"#("q"$a#(!"#(!!$a"'$,&"'4 w   =hB!SRqRqRQaQAQQRASRrRqqRRqqRRrRqRqqRR1R2R2R2R2R1Q1R1Q1R1Q1R3R2R1R1QR1R!SRqRqRQaQAQQRASRrRqqRRqqQQqqQQqQQ2R3R2R2R1R11R1Q1R1Q1R1Q1Q2Q1Q1R1Q1RQ1RQ!SRqRqRQaQAQQRASRrRqqRRqqQQqqQRrRR2R3R2R2R11R1Q1R1Q1Q2Q2Q1S1Q1S12S11T1S!SRqRqRQaQAQQRASRrRqqRRqqRRqqRRqqRR1R2R1R2R2R11R1Q1R1Q1Q2Q11R11R1S1S!SRqRqRQaQAQQRASRrRqqRRqqRRrRqRrRqRR1R11R11S1S1S1S1R2R2Q2R1S1S!SRqRqRQaQAQQRASRrRqqRRqqRRrRqRrRR2R2R1R2R11R1Q1R1Q1R1Q1R2R2R1R1QR1R!SRqRqRQaQAQQRASRrRqqRRqRqQQrQqQsQQ3Q3R2R2R11R1Q1R1Q1R1Q1R1Q1Q2Q1Q1R1Q1RQ1RQ!SRqRqRQaQAQQRASRrRqRRqRqQrQqQsQR2R2R1R11R1Q1R1Q1R1Q2Q2R1Q1S1Q1S12S11T1S!SRqRqRQaQAQQRASRrRqqRRqqRRrRqRrRR1R11R1R2R11R11R1Q1R1Q1Q2Q1Q1R11R1S1S!SRqRqRQaQAQQRASRrRqqRRqqRRrRqRqRR1R2R2R2S2S1S1S2R2Q2QQR1S1S YI"SRRQQcQAAQAQRSRqqQsQqQqqQqQqqQqQqqQQ2Q2R2R11R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1QRQR"SRRQQcQAAQAQRSRqqQsQqQqqQqQqqQqQqQQ2R3R3R11R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1QR1QR1RR"SRRQQcQAAQAQRSRqqQsQqQqqQqQqqQqQqqQQ2Q2R2R11R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1QR1RR"SRRQQcQAAQAQRSRqqQsQqQqqQqQqqQqQqqQR2R2R2R11R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1RQ1RQT"SRRQQcQAAQAQRSRqqQsQqQqqQqQqqQqQqRR2R3R3R11R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1RQ1RQ1T1TT"SRRQQcQAAQAQRSRqqQsQqQqqQqQqqQqQqqQR2R2R2R11R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1RQ1T1TT C{ SRRQQQQRSRsQqqQqQqqQqQqqQqQqqQR3R3R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1QR1QqR1R SRRQQQQRSRsQqqQqQqqQqQqqQqQqqRR3R3R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1QR1R1R SRRQQQQRSRsQqqQqQqqQqQqqQqQqqQR3R3R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1RQ1RqQRq SRRQQQQRSRsQqqQqQqqQqQqqQqQqqQQ3Q3R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1RQ1RqQ1T1T SRRQQQQRSRsQqqQqQqqQqQqqQqQqqQQ3R3R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1RQ1T1T1T SRRQQQQRSRsQqqQqQqqQqQqqQqQqqQQ3Q3R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1Q1R1QRQqTq4  l !3;U211A11232A2B1C1A1B1B1B11B1B1B1122221212122A2212A2211A11232A2B1C1AA1B1B11B1B1B1B1122222121211112A121A21211A11232A2B1C1AA1A1B1B11B1B1B1122221211113133A4A3211A11232A2B1C1AA1AA1A1B1B1A1AA1122222121112A23A3211A11232A2B1C1AA1AA1AA1AA1AA1A1B11223333221A23A3211A11232A2B1C1AA1AA1AAAAAAAA1A1122221212122A2212A2211A11232A2B1C1AA1AA1AAAA1ABC1112221212121111212A1A21211A11232A2B1C1AA1AA1AAAAA11A1B11222121211213133A4A3211A11232A2B1C1AA1AA1AA1AA1AA1AA1A11222221211112A23A3211A11232A2B1C1AA1AA1AA1AA1AA1AA1AA1122333321A1123A3 4Z 211AA1A1232AA1E1D1C1C1C1C1C1C1B112212121212121212121212 211AA1A1232AA1E1D1C1C1C1C1C1B1B122212121212121212121222 211AA1A1232AA1E1D1C1C1C1C1C1C1C1122121212121212121222 211AA1A1232AA1E1D1C1C1C1C1C1C1B222212121212121212121214 211AA1A1232AA1E1D1C1C1C1C1C1B2B222212121212121212121444 211AA1A1232AA1E1D1C1C1C1C1C1C1B2222121212121212121444 21112232C1E1E1C1C1C1C1C1C1C22212121212121212121q2221112232C1E1D1C1C1C1C1C1C2C2221212121212121212122221112232C1E1D1C1C1C1C1C1C1C222121212121212121212q12q21112232C1E1E1C1C1C1C1C1C1C1121212121212121212q14421112232C1E1D1C1C1C1C1C1C1C1221212121212121212144421112232C1E1D1C1C1C1C1C1C1C1121212121212121212121q4q4   Ai5 221Q1Q1Q1Q1Q2Q1Q111Q1Q1Q1Q1QQ1S11122221212122q2212q2 221Q1Q1Q1Q1Q2Q211Q1QQQQQQQS1122222121211112q121q21221Q1Q1Q1Q1Q2Q211Q1Q1Q1Q1Q1QQ1S11222221211113133q4q3221Q1Q1Q1Q1Q2Q21Q11Q1Q1Q1Q1Q1R12222222121112q23q3 221Q1Q1Q1Q1Q2Q1Q111Q1Q1QQ1QQ1Q1Q11122333322123q3 221Q1Q1Q1Q1Q2Q1Q11QQQQQQ1Q1Q1112222121222q2212q2 221Q1Q1Q1Q1Q2Q21Q11QQQQQRR11222212121211112q121q21221Q1Q1Q1Q1Q2Q21Q11QQQQQ1R112222121211213133q4q3221Q1Q1Q1Q1Q2Q2Q1Q111Q1Q1QQ1QQ1111222221211112q23q3 221Q1Q1Q1Q1Q2Q2Q1Q1111Q1Q1Q1Q11122233321q1123q3 K!221Q1Q1Q12QQ3Q2QQ1QQ11QA1QAA1Q1Q1Q1S11122121212121212121q2q1212!221Q1Q1Q12QQ3Q2QQ1QQ11A1QAA1QQ1Q1Q1R112221212121212121q21212q22!221Q1Q1Q12QQ3Q2QQ1QQ11A1AA1Q11Q1S1112212121212121q21212q22!221Q1Q1Q12QQ3Q2QQ1QQ11A1AA11Q1Q1S1222212121212121212q121q214!221Q1Q1Q12QQ3Q2QQ1QQ11A1AAQ1Q1Q1Q1R2222221212121212q121214q44!221Q1Q1Q12QQ3Q2QQ1QQ11A1AAQ1QQ1QQ1S122222121212121212q1214q44 %7 2211112Q32QQ1QQ11Q1Q1Q1Q1QQ1T122Q21212121212121q2121q2q2 2211112Q32QQ1QQ11Q1QQ1Q1QQ1QQ1T2222121212121212121q2122q2 2211112Q32QQ1QQ11Q1Q1QQ1QQ1QR1T122Q212121212121212q121q2q12q 2211112Q32QQ1QQ111111QQQ1T11Q22121212121212q1212q14q4 2211112Q32QQ1QQ11Q1Q1Q1QQ1QQ1T111Q212121212121212q12144q4 2211112Q32QQ1QQ11QQ11Q1Q1QQ1T1Q112121212121212121q2q121q4q4  O 7Ub 222bA1bA1b1aA1a2Q1Q111Q1Q1Q1Q1QQ1S11122221212122q2212q2 222bA1bA1b1aA1a2Q211Q1QQQQQQQS1122222121211112q121q21222bA1bA1b1aA1a2Q211Q1Q1Q1Q1Q1QQ1S11222221211113133q4q3222bA1bA1b1aA1a2Q21Q11Q1Q1Q1Q1Q1R12222222121112q23q3 222bA1bA1b1aA1a2Q1Q111Q1Q1QQ1QQ1Q1Q11122333322123q3 222bA1bA1b1aA1a2Q1Q11QQQQQQ1Q1Q1112222121222q2212q2 222bA1bA1b1aA1a2Q21Q11QQQQQRR11222212121211112q121q21222bA1bA1b1aA1a2Q21Q11QQQQQ1R112222121211213133q4q3222bA1bA1b1aA1a2Q2Q1Q111Q1Q1QQ1QQ1111222221211112q23q3 222bA1bA1b1aA1a2Q2Q1Q1111Q1Q1Q1Q11122233321q1123q3 K!221aCa1aAa1aAa1aa2QQ3Q2QQ1QQ11QA1QAA1Q1Q1Q1S11122121212121212121q2q1212!221aCa1aAa1aAa1aa2QQ3Q2QQ1QQ11A1QAA1QQ1Q1Q1R112221212121212121q21212q22!221aCa1aAa1aAa1aa2QQ3Q2QQ1QQ11A1AA1Q11Q1S1112212121212121q21212q22!221aCa1aAa1aAa1aa2QQ3Q2QQ1QQ11A1AA11Q1Q1S1222212121212121212q121q214!221aCa1aAa1aAa1aa2QQ3Q2QQ1QQ11A1AAQ1Q1Q1Q1R2222221212121212q121214q44!221aCa1aAa1aAa1aa2QQ3Q2QQ1QQ11A1AAQ1QQ1QQ1S122222121212121212q1214q44 %7 222c1e1e2c2aQa32QQ1QQ11Q1Q1Q1Q1QQ1T122Q21212121212121q2121q2q2 222c1e1e2c2aQa32QQ1QQ11Q1QQ1Q1QQ1QQ1T2222121212121212121q2122q2 222c1e1e2c2aQa32QQ1QQ11Q1Q1QQ1QQ1QR1T122Q212121212121212q121q2q12q 222c1e1e2c2aQa32QQ1QQ111111QQQ1T11Q22121212121212q1212q14q4 222c1e1e2c2aQa32QQ1QQ11Q1Q1Q1QQ1QQ1T111Q212121212121212q12144q4 222c1e1e2c2aQa32QQ1QQ11QQ11Q1Q1QQ1T1Q112121212121212121q2q121q4q4   ~yo3a2a2b1cA2B1A11222q111qq1q1r1122211122q23q33a2a2b1cA2B1A11222q111qq1qq1q1q12333211122q33a2a2b1cA2B1A11222q111qq1qq1qq1q1q1222212222q123a2a2b1cA2B1A11222q111qq1rq1q1q1q2221212222121131q3123a2a2b1cA2B1A11222q11qqrrqqq112221212133q433a2a2b1cA2B1A11222q11q1q1qq1qq1q222212111q23333a2a2b1cA2B1A11222q111q1q1q11222321q112233a2a2b1cA2B1A11222q11q1r11122212212122q22123a2a2b1cA2B1A11222q111qq1q1q12222121222212113q13123a2a2b1cA2B1A11222q111qq1q1q12221111213344q3 {2c21e1C11A2222qq11q11r1q11222121212121q212122c21e1C11A2221qq11q1q11q12222121212121212222c21e1C11A2221qq11q1q1q1q11q2221212121212222c21e1C11A2221qq11q1qq111q1q22212121212q121q2142c21e1C11A2221qq11q111q22222121212121214442c21e1C11A2221qq11q1111q1q222121212121444 mZ2c2a1aa1e1AcA1C22AA2A21q111q1q1q222212121212121q222c2a1aa1e1AcA1C22AA2A21q111q1qq22222121212121212222c2a1aa1e1AcA1C22AA2A21q1111qq1qq1q222121212121212q12q2c2a1aa1e1AcA1C22AA2A21q111q1qq1qq12221212121212q1442c2a1aa1e1AcA1C22AA2A21q11q1q1q111221212121212121442c2a1aa1e1AcA1C22AA2A21q1111q1q12221212121212121q4q4   -Lv%!2111A11222211q11q1111q1q1122332221112q23q3"2111A11222211q11q111111q12333333211q22q3"2111A11222211q11q1111111q23333133222q22q2"2111A11222211q11q11111qq11q233332121222212q131q211!2111A11222211q11q11111q1q11222221221212133q3q2!2111A11222211q11q11111qq11q223322121112q23q3"2111A11222211q11q1111111q2233333211q22q3"2111A11222211q11q111111q123331312212122q22q2"2111A11222211q11q11111q11223332121222212q131q211!2111A11222211q11q1111q1q1122222111121334q3q2 L)"2111AA1122AA22111q11q11q11q1q222121212121212121q2q1212"2111AA1122AA22111q11q11q1qq122221212121212121q21212q22"2111AA1122AA22111q11q11q11q1q2221212121212121212q22"2111AA1122AA22111q11q11q11q1q22212121212121212q121q214"2111AA1122AA22111q11q11q1qq22222121212121212q121214q44"2111AA1122AA22111q11q11q11q1q2221212121212121214q44  !2111122221111111112q22212121212121212121q22!21111222211111111q2222212121212121212121222!211112222111111111q1q222121212121212121212q12q!211112222111111111qq12221212121212121212q144!2111122221111111111q12212121212121212121444!211112222111111111q1q2221212121212121212121q4q4 ~  ?qAAqqrqQqSQRQQQQQQQQQQQQQQQRQQQRQQQQQQQQQqAAqqrqQqRQRQQQQQQQQQQQQQQQRQQQRQQQQQQQQQqAAqqrqQRqQQRQQQQQQQQQQQQQQQQQRQQQQQQQQqAAqqrqQqRQRQQQQQQQQQQQQQQQQQRQQQQQQQQ NAAAAAAqqqrrqqqRQQQQQQRQQQRQRQQQQRQQRQQQQQAAAAAAqqqrrqqqRQQQQQQRQQQRQRQQQQRQQRQQQQQQQAAAAAAqqqrrqRqQQQQQQQQQRRRRQQQQRQQRQQQQQQQAAAAAAqqqrrqqRRQQQQQQQQRQRQQQQQRQQRQQQQQQ =qAqqqqrqSQQQQQQRQQQRQRQQQQRQQRQQQQQqAqqqqqqSQQQQQQRQQQRQRQQQQRQQRQQQQQQQqAqqqqSqQQQQQQQQQRRRRQQQQRQQRQQQQQQQqAqqqqqSQQQQQQQQQRQRQQQQQRQQRQQQQQQ4 $/8OOOAqqqqAAq qAA AA AA AAq qAAq qAAAAAONAAAAAkAAAAAccbAAACaaaaaaCAAAacaaAAAAaaaaaaAAAAabbaaaAAAAjAAAAiAAAAhAAAAjAAAAcgAAAAabfAAAAabaAAAAacaAAAAaaAAAAabAAAAaacAAAAbbdAAAAacAAAAacAAAAcAAAAdAAAAcfAAAAacadAAAAaaAAAAaAAAAaaAAAAaAAAAaAAAAAAAAAAAAAAAACCAAAAAAAAAAAAAONAAAqqAAq qAA AA AA AAq qAAqqqqAOOOYou have in your possession a ticket entitling you to a trip to California via Cape Horn.4 /8OOOAqqqqAAq qAA AA AA AAq qAAq qAAAAAONAAAAAdAAAAAdAAACdCAAAgAAAAgAAAAgAAAAcaaAAAAcbAAAAdbAAAAeeAAAAfeAAAAeeAAAAfeAAAAefAAAAcfAAAAbagAAAAfcbgAAAAnhAAAAidhAAAAebhAAAAcbhAAAAblAAAAblAAAAbaiAAAAiAAAAjAAAAjAAAAcbcAAAAaaabAAAAabAAAAaaaabAAAAcaabAAACgCAAAgAAAAAgAAAAAONAAAqqAAq qAA AA AA AAq qAAqqqqAOOOYou possess a ticket entitling you to a trip to California via the Panama isthmus.4 M.8_]saqOOqasqqqqrrqqq qq qaq qaaqoocqaqaa aaqaaojaacojcAaojaAAaonaaAQAacbaaabbccaaAQAacaaaabbaababaaAQAacbaaaaaababaaAQAacaaaabbababaaAQAacaaaabbaababaaAQAaccbbbaabcaaAQAaonaaAQAammaaAQAakaakaaAQAakbbkaaAQAajccjaaAQAajbbjaaAQAajbbjaaAQAaibaabiaaAQAaibaabiaaAQAaicciaaAQAaiabiaaAQAaibaiaaAQAaicciaaAQAaibaabiaaAQAaibaabiaaAQAajbbjaaAQAajbbjaaAQAajccjaaAQAakbbkaaAQAaiaaiaaAQAckkcaAQAaaojaaaAAaa aaaAAoocaAaodaqoodqaq qaaq qaq qq qqqrrqqqqsaqOOqas_]This ticket provides transportation from Brooklyn to Buffalo by stage, then continuing service to Independence, Missouri, via lake and river steamer.4 &  9i 2111A11111111 2111A11111112 2111A11111112 2111A11111111 2111A11111112 2111A111111124 $q;D&= 4MMMMMMMMMMMMMMMMMMMMMMMMMMMM6 JJJJJJJJKLLLLL JJJJJJJJKLLLLL&NNNNNNNNNNNNNNNNNNNNNNNNNNNN.NNNNNNNNMMMMMLNNNNNNNNMMMMML8MOOAOBOBOBOBOBOBOBOBOBOBOBMOOAOBOBOBOBOBOBOBOBOBOBOB@GGHIJJKKLLLMMMGGHIJJKKLLLMMM5MMMMMMMMMMMMMKMMMMMMMMMMMMMK4 D &/OOFAcdcAAaeeaAAabbaAAbaabAAaaaaAAcb sbcAAbc qqcbAAaqaAAaaAAab qbaAAaa qqaaAAd qdAAaa qqaaAAaqsaAAaqsqaAAaqsqaAAaqtq aAAa qsq aAAa qsq aAAa qsq aAAa qtq aAAa qsq aAAa qsq aAAa qsq aAAa qtq aAAa qsq aAAa qsq aAAa qsq aAAb qtq bAAa qsq aAAa qsq aAAa qsq aAAa qtq aAAbqsq bAAaqsq aAAcqsq cAAabqtq bAAbaqsq aaAAaaaesqeaaaAAbdcqqcdbAAcaahaacAAbcdcbAAdccdAOOFLong pipes, short pipes. You have all kinds of pipe!!4 ,3OOJAccccABaeeaBAbbbbAAabaabaAAaaaaAAcbbcAAbc cbAAaaAAaaAAbbAAaaAAccAAсaaAAAA qAA qAA taAAqaAAqqaAAqqaaAAqaaAAocqAAaaaaaAAaqAA qqbaaaqAA q aaaAAAA aqAA aqAA arAAAAAAaaAAaaAAaaAAaaAAaaAAbbAAaaAAccAAab bAAba aaAAaaaeeaaaAAbdc cdbAAcaacbcaacABbcjcbBAdccdAOOJThis is the key to your residence, 10 Front Street.4 ("&/OOFAcdcAAaeeaAAabbaAAbaabAAaaqaaAAcbr bcAAbc cbAAa qqaAAaraAAabqqbaAAaaqsqaaAAdqqqrdAAaaqqq aaAAaqqqq aAAa qq aAAa qqaAAa qqaAAa qqqqaAAa qqqqqaAAa qqqqaAAa qrqqaAAa rqaAAaqqqqaAAaqqqqaAAaqrqqqaAAaqqqqaAAaqqqaAAaqqqaAAb qqqbAAa qqaAAa qqaAAa qqqaAAa qqqqaAAb qqqqbAAa qqqqaAAcqcAAabbAAbaaaAAaaae eaaaAAbdccdbAAcaahaacAAbcdcbAAdccdAOOFnails4 .:OONAAAokAAb bAAaaAAaaAAaaAAaaAAaaAAaaAAAAAA AA AAa aAAa aAAa qaAAa qaAAa saAAa saAA rrAA tqrAArsrAArrAArsAAtqsAArsqqqAAssqrqAArrtqrAAqqqqrrsAArtsqqAAststAAuqqruqAArqtqqrqAAsqqrqqAAauurqqqAAassrrqaAAatrtraAAarssqaAAasqrraAAarqaAAaqqaAAqqAAsrAArAAqqqAAtqqaAAasqaAAasraAAasqaAAaqtqaAAaur aAAbvrbAAokAAAOONYou are carrying around with you a sack of 100\% pure bull manure! What are you going to do with that?!4 J)&/OOFAcdcAAaeeaAAabbaAAbaabAAaaaaAAcbbcAAbc"!cbAAa !q!! aAAa !q!q!! aAAab!q!!q!! baAAaa!rq!! aaAAd!qq!qq!!dAAaa!q"q"q!!aaAAa!q(q!! aAAa!q"q"q#q!!aAAa!q"v#q!!aAAa!q#qqs#q!!aAAa!q"qsr#q!!aAAa!qu!qq!!aAAa!q!qqqqrqq!aAAa!q"trr!rq!!aAAa!q%rrq!r!"aAAa!q(rq!"!aAAa!q!t$qr"!aAAa!q!qr"s#!aAAa!q!qq"r"q!"!aAAa!!qsq"q#q!!"aAAa!q"qqqq$q!""aAAb"qrqq"s!"!!bAAa$qrqq!r!!!"aAAa!q"qqq!!!!!aAAa!r"qqq!q!"!!aAAas#q!q!!!!aAAbr#s!!q!!!!!bAAa!r##r!"!"aAAcs#!q"!"cAAbt!"bAAaaqq!q"!!!!aaAAaaaqe!񁡁e!aaaAAbdc!cdbAAcaahaacAAbcdcbAAdccdAOOFYou have a fistful of cold cash!4 B/8OOOAqqqqAAq qAA AA AA AAq qAAqrqqqqAAqtqsAAqqAAqAAqAAAAqAAAAqAA AAqAAqAAqAA AAqAAqAAqAAqtqAAqAAAAqAA AAqAAqAAqAA AAqAAqAAqAAAAqAAqAAqAAqAAqqAArrqqAAsttvqAAwrrs{AA AAq qAAq qAA AA AA AAq qAAqqqqAOOOIt is your handwritten, quarterly statement from the Brooklyn Bank. On the date of this statement, the balance of your account, account number %v48, was $200.4 A/:Ł    !a !aa a! aa! ab c!A !a!!AA#BA !!AB  A!!BA  !1!B  AA!!11!!  B"!1Q!!! A!!!A!!!!#!!Q!!1!1!!"#!"1" Q"!# QQ!!Q1" Qѡ1"  QQ!Q1!  !! #R  #!!!! "!! !!! !!!  !! !!!!!  ŁIt is a lovely bouquet of flowers. There must be something nice to do with them!4 .:OONA AAokAAb bAAaaAAaaAAaaAAaaAAaaAAaaAAAAAAAA AAa aAAa aAAa aAAa aAAaaAAaBaAAA AAtDAAs AACrrDACBBAABAGDAqACFDqADDBFqAAEHGrADEDBDqAFAEFBqqqAAOBJqqAFEGEqqAAAEFHqAAAAGDHqqAAaBFECqAAaBFDqaAAaAFAaAAa ADaAAaAAaAAa aAAa aAA AAAAAAAAaaAAaaAAaaAAaaAAaaAAaaAAb bAAokAA AOONYou are carrying around some fine lumber!4 .:OONA AAokAAb bAAaaAAaaAAaaAAaaAAaaAAaaAAAAaqaAA qaraqAA araqaqaqAAa qaraqaaAAaaqra qaqaaAAaaqqaraqqararaAAarqqaraqaqaqbraAAaaqraqbqaarqaAAaqaaraqqaaqqaqqqaAAaqraqqaqqarrAAqaaqaqararrqrAArraqqqaqaqrqAAqaqqaqaqqaqabqqqAAqqaraqarsrAAqqqaqaqarqqAAqqaqaqrqAAqaqarqqAAraqbqqqrAAaq qarqrAAqa qarrqqAAr aqqaqqAAaq qaaqqsqAAqq qarqqAArq rqrqqAAbqraqqaqqAAaqaqrqaqrraAAarqaqqrqqaAAcsqaqrqqaAAarqrqqaqqaAAaqaqaqqaqqaAAbqrqarrrraAArqrrqrAArqarqaqAAsaqaqrrAAqqaqrqqAAaqrrqaqqaAAaraqqarqraAAarrqrqqaAAaqarqaqqaAAaraqaqrraAAaqrarrqaAAbqaqqqarbAAokAA AOONA long, lengthy, and sturdy piece of rope.4 q%.:OONA AAokAAb bAAaaAAaaAAaaAAaaAAaaAAaaAAAA AA qrr AA qqrt AAa qqrtr aAAa qqrtr aAAa qqqsr aAAa 1qqqr1 aAAa 21 aAAa 1q3121 aAA 1q=21 AA 1q1:21 AA 1q1r921 AA 3qq921 AA 2r;1 AA 1q2811 AA 1q3711 AA 1q4711 AA 1q4611 AA 1q5511 AA 1q661 AA 1q7121 AA 1q921 AA 1q:1 AA =1 AAa <11 AAa <11 aAAa 1q:11 aAAa 1q:11 aAAa 1q:11 aAAa 1q<1 aAAa >1 aAA >1 AA <1 AA 1q:1 AA 2q73 AAa 3s6 aAAa8aAAaaAAaaAAaaAAaaAAb bAAokAA AOONThis is a rust-proof, stainless steel bucket. You don't see many like this!4 H.:OONA AAokAAbqqqqbAAaqqqqqq aAAaqrqqrq aAAa rqqrqq aAAa qqqqqq aAAa rqrq aAAa qq aAA qq AA  AA qq AA qqqq AAa qqqq aAAa qqqq aAAa sqsq aAAa sqsq aAAa qqqq aAAa rqrq aAA qsqqsq AA qqqqqq AA qqqq AA qqqq AA qqqq AA qqqq AA qqqq AA qrqqrq AA rrqrrq AA rrqrrq AA rqqrqq AA sqsq AA rqrq AA qq AA qqqq AAa qqqq AAa qqqq aAAa qq aAAa qqqq aAAa qrqqrq aAAa rqrq aAAa rqrq aAA rqrq AAqqqq AAqqqq AAqqqq AAaqqqq aAAaqqqq aAAaqqqq aAAaqqqq aAAaqtqt aAAaqqqqqq aAAbqqbAAokAA AOONWith chain as strong as this, there aren't many jobs that are too big for it!4 X.:OONA AAokAAb bAAaaAAa1aAAa13aAAa 122aAAa 112 aAAa 111111 aAA BAC3A1A1 AA AA1A1B1A1A2 AA AE1A1A1A1 AA AA1A1B2A3 AAa A aAAa N aAAa  aAAa  aAAa  aAAa 1112 aAA 11111111 AA 11211 AA 11211 AA1111111 AA 11111AA 111111 AA11311 AA 2212AA211112 AA 11211AA 11121 AA11111AA 11111 AA 2212 AA 12211 AAa 1A2A11 AAaA1D122 aAAa 1B1A2A1A11 aAAa D1A1A1A12 aAAa AB122A1A21 aAAa AB11B1 aAAa C11111A1 aAA A22 AA 11BA AA 2BA1AA A11AAAa A11BaAAa A11AaAAa AaAAa AAaAAa AAaAAaCaAAb bAAokAA AOONIf you were to visit a place with many, many mosquitos, this netting would keep those pesty insects from biting you.4 [/:__WC__WCAAOOCAAAA AAAA AAAA AAC C Q Q Q QA AQA AQA AQA AQA AQA AQAAQAAQAAQAAAQAAŁ AQAAAAAQA CEABaAQA AABBBbAQABAAAEBbAQAHAAÁbAQAfCBaaAQAoaaaAQAojaaAQAojaaAQAojaaAQAboeaaAQAghaaAQAodaaAQAojaaAQAojbAQAojbAQAojbAQA oda AQA ha AQA AQA AQA AQA AQA AQA AQ Q Q  C CAA AAAA AAAA AAAAOOCAAC__WC__WOranges can do amazing things to keep a body healthy!4 ,/:__WC__WCAAOOCAAAA AAAA AAAA AAC C QrqQs Qr QAq AQAqqAQAqqqAQAqqqqqAQAqqrAQAqrqAQAqqqqqAQAqrqqAQAqqqAQA rrqrAQA rrqqqAQA rqqqAQA qqqAQAqqrAQArqAQAqqqrqAQArqqrAQAqsrqAQAqvrAQArsq AQAqqtr AQAqrqq AQAqrr AQArrr AQArqqrr AQArrr AQAqrqqr AQAsru AQAqqqqqrAQAqqrrAQAsqrrAQAsrsAQAsssAQA trAQA tsAQA utAQ zQtrQu C CAA AAAA AAAA AAAAOOCAAC__WC__WThis flour would make some delicious cinnamon rolls. It reminds you of the times your mother would make them.4 b/:__WC__WCAAOOCAAAA AAAA AAAA AAC C Q Q Q QA AQA AQA AQA AQA AQA AQA!!AQA"AQAqqrAQAsAQAqtAQAssAQArrAQAqrAQAqqsAQAqqAQAqqqAQAqrAQArrAQAqqqsAQAqrqAQAqrsqAQArqAQAqqrqsqAQAqrrqAQArqqrqAQAqqtqAQAqrrrrAQAqsqsrAQAtrAQAqsqtAQA{AQA AQA AQA AQA AQ Q Q  C CAA AAAA AAAA AAAAOOCAAC__WC__WPeas aren't real popular with a lot of people, but they are supposed to be good for you!4 g/:__WC__WCAAOOCAAAA AAAA AAAA AAC C Q Q Q QA AQA AQA AQA AQA AQA AQAabAQAabAQArqqAQAsAQAtqAQAqqqqAQAqrAQArqAQAsqqAQAqqAQAqqqAQArqAQArrAQAsqqqAQAqrqAQAqsrqAQAqrAQAqsqrqqAQAqrrqAQAqrqqrAQAqtqqAQArrrrqAQArsqsqAQArtAQAtqsqAQA{AQA AQA AQA AQA AQ Q Q  C CAA AAAA AAAA AAAAOOCAAC__WC__WThese beans are an excellent source of protein and other things.4 /:__WC__WCAAOOCAAAA AAAA AAAA AAC C Q Q Q QA AQA AQAAQAAQA13AQA1121AQA1121AQA q111AQA q1131AQA r1112 AQA q3111 AQA "q3111 AQA"$2113 AQA"$2113 AQA"%212 AQA"#!2113 AQA"#!442 AQA"#!11122"!AQA"#!121#"!AQA&!24##AQA#$33""! AQA#"!4"! AQA#$2"! AQA '"q! AQA '!qq" AQA &!qq" AQA ""q$ AQAq!q#AQAq#AQAqAQAq AQA AQA AQA AQA AQA AQ Q Q  C CAA AAAA AAAA AAAAOOCAAC__WC__WVegetables are a definite necessity for a balanced diet.4ē  ) * + @DEHT U#T$R%P,X,V(Q(?+B-C/C1A2>4?5?6=7;8=<;@:A7B:E9H8I7J2J1JKJJ HGDA>=;;= =<==&=999::983/.. 0 0/- - )'$! !    @B EFGHIJKLMNOP QRSST T! !T" "S##S$$Q%%O&&P''Q+V *((?))?**@++A, ,B- -B..B//B00A1// 01?22>33>44>55>66<77:88;9 9<::;;;:<<:=<= =:>>9??:@@9AA6BB9CC9DD9EE8FF8GG8HH7I I6J3J)Q L"N N$L$L)M8P8Q6S8T8T4U3V8W;Y=\>^=_;`8b8abc@cdAdeCefCfgDghDhiDi jCjkCklBlmAmn@no>op?pq@qr@rs?st>tu@u vBvw@wxBxyEyzDz{D{|H|}I}~H~FEDTIVJVLW~M~W}O}X|P|USSQPONMLKJIHGF5 :DC<  ) * , ?CFF!!9< ?"E >%!! ! !(!-#4&6&6 )* )5/>,?*@,C+G*H'I#IJII I ѐ= > >=>>%=(<*<*<:9&9&6*6766 7 7 8 88"11011*0-/....../..- - !! %&>@BBAA?'&%    1  ' & &'&&1'2(2(2)0)()) ) C CDCC'D'D'E%EDEE D M!O ONOO"O$M%M)M) ) T"TUVVW*Y0Y0!0 1*d,5h53@:+2)2 }/}1255! " 6!   }} ~~~w wvww+v,v,  q q  ti)lo&p+p+l4* i&f&g#ghgg g hhhd dcdd$d%b&a&a&`%`a`` a aa\ \[\\ ]&]& +ZZ YYɡTT U V V VU !"0255 " 0&%$ 8D + :@ CEFFGAGBGCFCFAEC  % B!>@CADDE         #    " "." #2# $4$%4%& &)'*) + +3* *4)2)4(3(5'3'5&2&5,1, --/2/.00.1,1.2.21 100 33-4.4 5.56 6776.    :,:";,;<,- ?)?==>> @@*AA+BB*C(C*D(D*E'E)F)FE ED DCC GG(H"H NPP'O%O(N(N&Q'QRR%T'T(T%S%STTUUV VWW"XX+Y Y.Z#Z1[+[3\.\3]/]3^.^3_3_*`0`+b)b'`(a'_'`&_&_`` ^^&]]"\ V AXXYY Vd0 ee'd&d(c'c)f f$e*f'f0g'g2h&h/i'i.j)j-h2q6qp(po$on!nmmllkkjj m   !rrq qss ttr!r5s$s3t't1t.w/v-w.w,x0xwwyy/zz/{{0|}}| |2}1}2} 55255687(441231<:D9E9F9F:E?CBHEFI\]_`degfjkpowx !!%%)++@BB>)!  ! ""$')* *+**1(3'3"!",#2)!*!$%'024<+ $F"*  !59}2|/||| }{zxwh/* d!k)1s m&qt(t-t/`XɡG74 ./6+ E'N&\.`&!X Y YXX&`_ ___$gf fff$S SSS$T&0"2 2322+0.:"9)="? ?@??%=*E F FFF&`.   ADCCBA'%*+ , --&20.1,25?BHF>'=)<+;:"9)H T%TUVXY Y Z#[+_*`+]_e*h2j4i4k5m5l5n4o2p0kj feq xw,v-21"34Dx0o7d(c)^Q&Q'O(@*A+4.5?@CBDEFGDE    F`DDA@A>@>0:@:04@40.I-0%I#Y#! +! 3 @# G#P$ X%]!e!o# x%0%1&!#- +- 2-9-X+ _-e-@q- w-@++0$4`h4o4 4@4: >PAAPDD@F$1+13* :*?(0E( N' T'Z0Pf*0^&e&p10|1000f0k70q* x)0@ G5&-(%(P R WW ]em0x0H"T#THG$S#SH;(H(I<*60B1A+5k9gDfDj9j8eDi96(D408<9<50H)I5I7G+=-@:?:<.\5[>Z=[5Y2Xp w$5MK` ( 8 =D O Xd m Vz  Zkr^zxqT  ß     . ) c? ON `a !  aJ    63yRI:Y3:lDpIToSx;ǒm|Sf}\Sjnp"A%'֯-1h2ht<B $B>R_Kj|9?muh˰?4$9B@K@]AAFRaAlvH{_  '/܏cyIiH8>DJPNY^tddiNoіtzu}+OBH OlU[*bhnGu{%9kPf%wՄ X  ,& l6 H 3[ o d pG     4=2AUCE!HfK>Wbqz0{ ||yOҐ :~Բ7*T &M#077FP\fuGIXcY_<%:vJ& 7(BK_tBJuS[Gd[lt*xU{}tC~nj/{- x &/6d;/E|KMQV]ci~q W{u $;}w,hX(D iBm)H.&-0e60/6U=tӫ2O lN>;H<@w1 H #vBQ)?EXcI/JtbASl3anzHk :f2c  ݾ)l mo E u 9| 2 > Q :R d 9u Ά ~7=BKPEWA_ch|jT^ u ?ƭ̠7ɰ!aRE1,5\j:O:m9!1 Ȧ W `cj>mrх ,I& ȝgY#$)DAN/`iz0k 0AA[N\mk[ w (, < ?U q x  ܥ   q   x}6) )+   nDA "fVu&7t+'FQ/~w2c;&P  p 6h "/&(+$$( ,a/15H7   K::[;  v ;X<>ٶ%:??O\   1C J CC  DCF8 ЕD8KQWU^dkrqw0~M jɪ(Eb =Z w#5*06R=CJoPV-]ciJpv}gƉ%Bgg d pw _0p HT5//|pwpo: pWt2 O" )l/5*<BHGO p p@U\dbhp "o] u{?_%~g ppggB / \ܿ pL?PipeHouse keyNailsPure bull manureShovelCash, $15Cash, $165Cash, $215Cash, $415Cash, $665Cash, $765Cash, $865Cash, $965Cash, $1065Bank statementGold flakeGOLD $8,427,3%&ERRORMessage for room 11Family photoGold coinFlowersCape Horn ticketPanama ticketStage coach ticketLetterBibleWooden stickStringMetal scrapsPaper clipPiece of hamFishGold diskLumberRopeBucketChainMosquito netLanternCitrus fruitFlourPeasBeansVegetablesPickGold panMuleBranding ironEnvelopeSteel keyJames' ol' muleMagnetNote from JakeMuleMatchesAerogramGoldmine expert BONUSGOLD! $37GOLD! $98GOLD! $156GOLD! $207GOLD! $243GOLD! $298GOLD! $337GOLD! $395GOLD! $427GOLD! $484GOLD! $532GOLD! $577GOLD! $621GOLD! $679GOLD! $747GOLD! $793GOLD! $849GOLD! $898GOLD! $937GOLD! $982GOLD! $1040GOLD! $1099GOLD! $1147GOLD! $1186GOLD! $1255GOLD! $1302GOLD! $1364GOLD! $1421GOLD! $1492GOLD! $1529GOLD! $1587GOLD! $1633GOLD! $1679GOLD! $1762GOLD! $1849GOLD! $1890GOLD! $1941GOLD! $1994GOLD! $2023GOLD! $2076GOLD! $2142GOLD! $2208GOLD! $2265GOLD! $2327GOLD! $2406GOLD! $2478GOLD! $2526GOLD! $2587GOLD! $2643GOLD! $2698GOLD! $2783GOLD! $2874GOLD! $2988GOLD! $3123GOLD! $3247GOLD! $3375GOLD! $3516GOLD! $3632GOLD! $3751GOLD! $3869GOLD! $3994GOLD! $4137GOLD! $4309GOLD! $4464GOLD! $4695GOLD! $4821GOLD! $4978GOLD! $5083GOLD! $5232GOLD! $5387`NbNgNqNwNNNNNNNNNNNNO O!O5OBOLOTOeOsOOOOOOOO`NOOOOOOOP PPP!P'P2P7P@PEPSP\PfPvP`N}PPPPPPPPPPPPQQQ$Q/Q:QEQPQ[QfQqQ|QQQQQQQQQQQQ RR"R.R:RFRRR^RjRvRRRRRRRRRRRRSSS*S6SBSNS`NZSfSrS~SSSSSSSSSggggggggg,+,+*+*^ QQQQX Y nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn account ʁaddress aerogram albumall Dalligator american animal9ant antler around articlesƁask (attic$away axɁback bacon Cbakery balance balcony bandanna banditbankbank statement bankerqbarbarn Kbarrel basementbay beachbeamtbeanbed _bedroom behindbell bench bible billboardbinbirdkblacksmith blotterfblowboa board 'boardwalkboat boilersbook bookcasePboot ҁborrowboss Nbottle bowlbox brake jbrand nbranding ]break brick bridge brooklyn zbucket bucksbud buildingbull manure bulletinbush Ybusinessybutter churn buzzerbye cabin cabinet cacti\cage calendar $califcamp campfire *candle Icandy ^cannon canopy%cape [capsule captain carpet)cart catch cattleicave ceiling (cemetery chain )chair "check chest churchTcitrus fruit~city #clerk cliff climbclip ,clipping 'close closet clothes coachScoal coalhold́coatcobblestone coin 'coloma commode company compass connect-cookրcop corral ԁcount &counter !crack crank crash `crawlTcrew Ucrewman cross cupboardLdeck :deliver1demo ؁deposit desert2desk desk top diconnect7dig 8digger5disk/dock donkey.door 6doormat0down 9drawer 4dress drink ;driver6drop?east@east riverengine >enlarge =enter Aentrance BenvelopeEeric Deveningexitf Zfamily #fastest Kfence Sferry AfieldfindIfire Rfireplace Jfirewood VfirstOfish Pfishingflag Wflake Uflour Nflowerfly XfollowDfood foot hill forestVform formatQfort Gfront *fultonHfund Mfurniture 4galleygame\gate _gauge Ygazebo^give]goagold ggoods fgrain [grass `gravegravestone hgreen ground cguard Bguidedgun egunpowder ohallwayAhang "hardwarephathaymheadnheat ihellohelphit uhitchingwholdkholejhomeshop horizonqhorn rhorsevhot thotel-howhut {iceberg inxindependence |insert inventoryyiron zisland isthmus}itemjailjake jamesjeff jerrodjob journal journeyjump ~junglejunkjustkegkey =keyholekickkillkiss kitchen knock ladderland lantern Elarry latchlay leaderleaf /ledge leonardlet letter lleverlift light listen livery livestock livingloan lobbylocklogloislook looked at lookingJloom lower magnet mail man mailboxmainmakeman mantle Gmaplemast5mat gmatchWmate mattressmemeatmem message metal midgetmillmine >minermosquito netmove mr weest.muchmudnailnameρnapneed new yorknewsnextno normal north note pad notesnow nugget numberobj ocean off office;oiloldoneȀopen Āopeningout outhouse outsideover overboard Fowensoxlpack paddle paintingopan ?panner paperҀpark passage Bpasturepath vpattern pauseڀpay GpaycheckupeaHpeal photoppick pillar pillowpipe pitcher ΀place @plain plank plants ցpocketpole porch positionpost ̀post markԀpost office Lpowderpressure relief valvepri priceprovisions }psalm݀pullՀpump purchaseepush put on quarter hquench quicksand rafterrail raiserake rancher,randread register release removearent reportreservation reserve reset restart restore xribbonride riggingringrio riverrockroof room 10 room 12 room 13 0room 21 1room 22 2room 23{rope rotate 7route rowboat rudder wrulerssacramentosandsave saving sawhorse sawmill scene schedule secretarysellӁsend servicesetsf ?shaft shelfOshoeshopMshot shovelshovel handleshowside sidewalksign sinksitsky Ёsleep slots smell smokesmokestack southsp 8spanishspit stairs stamp @stand+star steal steam rsteel Cstock stoneworḱstop Rstove string Estuff stump 3sutter ߁swampswim :swing table tailraceZtake talkteamtell tellertent thank Fthing bthree tickettietimetop touch!tptrap trapdoor Xtrough dtwentyctwo under unlock untieupuse valley&var vegetable versionvine+wall /wallpaper$want !warehouse (water0wear <weight%west *wheel,wheelbarrow whistle%wilderness -wilson "window.wine #withdraw &womanword worker 4yardstick1yes2you 3youngXY[7^^v_`6aaObbc deefggWi_k lJl|l>mDUDPET@@APP@D@E@@EA@PQP@@E@AD@P@D@l(!@`  *@5  4 @  "    (l(!@p  *@u  4@ $"    (h(!@p `+@P5 4 E@ $"    (h( @@`  !+@@5  4  "    (@i( t  +P5  4   "    (@m@(!p  +P5  4  "    (m@(!0 *@  0 U  "V @   (}P(!0  *P@5  4  " @   (y( p  *E 5  4 @!  "    @(lP(!@  *@%  0@E  "    (((`0  @*@  HYP@   " B   @(,(`0  @+  HYP@p  " B@   @()( 0 +@ 5  0@$  "    ()@(!@0H *$  0    "    ()( 0 + 4 0 !"    ()(@ @0P  +@ % 0   !" @   ()( @` * t  0$  "    @(y(!@p  *\%  $A  "    ((8 @p @ @*L$  $ @  "    (i(!  *  $ X "    ((@(!@  * @  "    (8TS( 0  * `K p P@  #    (-(!0  *@!  A $"    (((00 !@*AH @! @0 @ @ #`B   (A8($0 `@B+ 0  H@0@ Q " IF@   ((P( 0 @* X 0   "    h(( 0@ > @0  0  @B  " B@   ((( @0  *@ Pa 0M@ !"  ! (() p@ * `  0  @F _ # @   (h(   :    A  " !  (((  :     "    (((   *    "    (((   *    "    (((   *    "    (((   *    "    (((  :     "    (((   :     "    (@h( 0 @X !*Hp  0@U  "@V @B!  (@h( 0L@ *  0H P  "R H@P   (h( 0 X *L 0   "V H@P   (h( 0  :X  4   b @P!  (h( 0  :X  4   b @P!  (h(   :     "    (@h( 0 @X *Lp  0@U  b@V B!  (@h( 0L@ *  0H P  bR HP   (h( 0 X *H 0   bV @   (((  *    "    ((( # 2*0    0  "    (i@(   *H$  $  "    (i( 0 @ *$ LJ4 E  "   ! (B(h !  *$ J    "   d(B(h a  *$ Z  D  "   d((h    *X  $ A  "    ((h q L *  0 @   " @   ((h q  @ *  0H T P  " @@$  ((h$q  @*   @   " B@   ((l @q  *  0 @B   " @  `((h q  *   @@   " @   ((h q  $*`   @   " @   ((h q  *   @B   " @   ((h q  @*   @   " B@  `((Cl q  +@ 1  0  @  @ " @@   @((h$q  +@ a   I@  $& @   ((x @1  *  0 @   " @   ((x @0  *   @   " @   ((h a @ *L$      " @   ((h 0 @ *L     "   !(i( 0  :X$  4   b$@PQ!  (h8 p  :\$  4   b @PA   (h, p  :X$  4   c @PA   @(h( p  :X$  4   b @PA   )i(  :   $ A  " !  ((( 0 *    " 0 00((( 00Ȁ: 0 0    "    (((   *    "    (((  *     "    ((( p EA*  4  B   "Y BT@   ((( p  @*  4 B   " B@   ()( @0  R*C  4 @R X "!   (((F p  @*  $    " B@   ((( 0 @ *B  DI  &    ((( 0  *BX  @   "    ((h 0 *C$  @B  " PE   ((h q   *X  $    " @   ((h q  *H  4    " @   ((h q   *X$  4 P   " @   (((  *    "    (((  *    "    (((  *    "    (( 0  *20     0 "    (( 0  ࠀ*20      "    ()h @q   * %   I@@  d&    @(((`0 Ѓ+ @`  0V@ T  "    ((( B !*  0@@@  "    ((( 0 B !. a H @@@  "    ((( B !*  @@@  "    ((( B !*  @@@  "    (h( 0 @X :Hp  0@  "@V B!  (h( 0L@ : 0H P  "R @   (h( 0  :  0   "V @   ((( @0  !@*  H @  " B@   ((x 0  ࠀ*@0     @ "    @@((h 0  j@H0   @   " @   P((h 0  ȁjH0  @   " @0  P((h 0  jH0   @   " @   P((h 0  jH0   @   " @   P((h 0  jH0   @   " @   P((h 0  jH0   @   " @   P((h 0  jH0   @   " @   P((h 0  jH0   @   " @   P@((h 0  jH0   @   " @   P((h 0  jH0   @   " @   P((h 0  jH0   @   " @   P((h 0  jH0   @   " @   P((h 0  jH0   @   " @   P((h 0  jH0   @   " @   P((h 0  jX0   A   " @   P((h 0  jH0  0 @   " @   P(B(h a  *X $    @"    @(B(h q  *X$ 4    @" P   @(B(h q  *X$ 4    @"   `@(B)h @q  *X$  $@  X "   `(B)h @a  *X$ 4 @  X @"   `(B(h a  *X$ J$    "   `(B@)h @q  *X$  $@  X "   `(B)h @a  *X$ J$ @  X "   `(BP)h @q  *X$  $ @  X "   `(B)h @a  *$ J$ @  X "   `(((  *  X@   "    @(((`  *  X@   "    @()8 @q  *@$   ! @ " @   (i(!  *  $ X "    (i(!  *  $ X "    (i(!  *  $ X "    (i(!  *  $ X "    (i(!  *  $ X "    (i(!  *  $ X "    (i(!  *  $ X "    (i(!  *  $ X "    (i(!  *  $ X "    (i(!  *  $ X "    (i(!  *  $ X "    (o_ppqrr>ssdttuvvCwwixxy"zzH{{n|}}'~~Ms,Rx 1ĆW}6Ɋ\;Ύa@ӒfEؖk$Jݚp)Ou.Tz 3ƥY8˩^=ЭcBձh!Gڵm&L߹r+Qw 0V